ISSN 10630740, Russian Journal of Marine Biology, 2015, Vol. 41, No. 3, pp. 203–211. © Pleiades Publishing, Ltd., 2015.
ALGOLOGY
Study on Biological Characteristics of a Newly Isolated Vietnamese Strain of Microalga Isochrysis galbana Parke for Utilizing as Live Aquaculture Feed1 Ngo Thi Hoai Thua, Hoang Thi Lan Anha, Minh Hien Hoanga, Dang Dinh Kimb, and Dang Diem Honga a
Institute of Biotechnology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Cau Giay, Hanoi, Vietnam bInstitute of Environment Technology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Cau Giay, Hanoi, Vietnam email:
[email protected] Received November 27, 2014
Abstract—Marine microalga Isochrysis sp. was isolated from Hai Phong area of Vietnam coastal zone. Their pure cultures were raised in the laboratory for culture optimization, molecular identification and biochemical analysis. Based on the morphological studies the newly isolated species was identified as Isochrysis galbana Parke and was confirmed by 18S rRNA gene analysis. The nucleotide sequence of partial 18S rRNA gene was submitted to the GENEBANK with accession number FJ536744. Optimum conditions for growth of the species was f/2 medium at temperature 25 ± 1°C, salinity 30 ± 1 psu, pH 7.0 and light intensity of 100 µmol m–2 s–1. Under these optimum conditions, the content of protein, carbohydrate and total lipid were 27.981 ± 0.892%, 25.263 ± 0.789% and 9.780 ± 0.120% of dry cell weight, respectively (equivalent 38.768 ± 0.892%, 35.000 ± 0.789% and 13.550 ± 0.120% of ash free dry weight). I. galbana Parke, strain HP has the highest content of docosahexanenoic acid (DHA), up to 14.7% of total fatty acid and maximal polyunsatu rated fatty acids (PUFAs) values at the early stationary phase in f/2 medium. The n3 and n6 PUFA ratio (n3/n6) of strain HP was from 4.50 to 5.69 at different phases of growth curve. These results suggest that biomass of this strain can be used as live feed in aquaculture. Keywords: aquaculture, feeding, Isochrysis galbana Parke, microalgae, polyunsaturated fatty acids DOI: 10.1134/S1063074015030074 1
INTRODUCTION
Microalgae are considered as valuable primary food sources and utilized in aquaculture as live feeds for all growth stages of bivalve mollusks (e.g. oysters, scallops, clams and mussels), for the larval/early juve nile stages of abalone, crustaceans and some fish spe cies, and for zooplankton used in aquaculture food chains. Marine microalgae such as Isochrysis and Nannochloropsis genera have received increasing interest as a suitable nutritional diets used in aquacul ture due to their suitable size (4–6 μm), easy digest ibility, rich nutritional value and precious polyunsatu rated fatty acids (PUFAs) contents, such as docosa hexaenoic acid (DHA, 22:6n3) [13] and eicosapentaenoic acid (EPA, 20:5n3) [1]. These PUFAs belonging to n3 are essential for growth and development of animals and human. The feeding of DHA and EPA improves growth and feeding effi ciency, while EPA alone is less effective in preventing high mortality and poor growth [10]. Isochrysis gal bana Parke is rich in PUFAs and grows well in mass cultures, either indoors or outdoors [10]. Therefore, 1 The article is published in the original.
this species is the species historically first used as a live food in molluscan mariculture as primary feed source for all growth stages of bivalves and for the larvae of some crustacean and fish, such as the clam Mercenaria mercenaria [21] and cited most often since. In Vietnam, there is a great demand of I. galbana biomass for aquaculture feed. However, most of the strains are being imported from abroad, which have poor adaptability to the prevailing environmental con ditions. Vietnam is tropical country and the main strains of I. galbana are generally originated from the temperate zone and maybe, it could be moved from another zone to Vietnam coastal seawater. Exploration of local algal flora for isolation of indige nous Isochrysis spp. for utilization as aquaculture feed is necessary. So far, there is no any published report on research on Vietnamese indigenous species belonging to Isochrysis genus. In this study, Isochrysis sp. (strain HP) has been isolated from the Hai Phong coastal region of Vietnam for exploration as aquaculture feed. The morphologi cal, physiological, biochemical characteristics, opti mal conditions for biomass production, and the nucle otide sequence of the 18S rRNA gene fragment of the
203
204
NGO THI HOAI THU et al.
newly isolated Isochrysis galbana Parke strain HP are presented. MATERIALS AND METHODS Isochrysis galbana Parke strain HP used in this study was originally isolated from a saltwater fish pond on the Hai Phong coastal zone of Vietnam in 2008 using phytoplankton net with a pore size of 5 to 10 μm. Unicellular culture of the species was isolated by pick ing single cell up using micropipette as described by Andersen [3]. Mixture of antibiotics (250 mg/L ampi cilin, 100 mg/L kanamycin, 50 mg/L streptomycin, 50 mg/L gentamycin) was used for isolation treat ment. The isolated pure microalgal cells were cultured in f/2 medium [9] and maintained in controlled labo ratory conditions in solid and liquid medium. All iso lates were maintained in semicontinuous culture by transfers every 2 weeks at 25°C on a 12 : 12 light : dark cycle, at an irradiance of 100 μmol m–2 s–1. The strain HP was examined for purity and axenic property by method of bacterial test. Living cells of the strain HP were observed with a light microscope (LM) (Olympus microscopes CX21 and BX51, Tokyo, Japan) and scanning electron microscope (SEM) (model JSM5410L, JEOL Com pany, Tokyo, Japan) for their cellular morphological details. Cultivation Media The basal medium for the isolation of Isochrysis was f/2 [9]. The algal cells were cultured in Walne and Erdschreiber’s media with their components and con centration as described in the report of Walne [25] and McLachlan [23], respectively.
(Difco Laboratories) plates. Each test plate was allowed to incubate at 20°C for 2 weeks to account for slowgrowing microorganisms also. Cultures were grown in 1000 mL Erlenmeyer flasks containing 600 mL sterilized Walne’s or f/2 or Erdschreiber enriched sea water medium with an initial cell density of 1 × 106 cells/mL. To avoid flocculation of microal gae, the culture medium was agitated gently by bub bling air and the flow meter was used to control the air flow rate. Air was humidified before entering the cul ture vessels by incorporation a humidifier. The air sup ply was sterilized by filtration through cellulose nitrate membranes with a pose size of 0.2 μm. The optimal air flow rate supplied was 1 v v–1 min–1 (vol ume of air per volume of medium per minute). The apparatus was used to find the optimal culture condi tion. The genomic DNA of the strain HP was extracted by following the procedure described in Hong et al. [11]. PCRmediated amplification of 18S rRNA gene was carried out using the 18S F (5'TACCA CATCTAAGGAAGGCAGCAG3') and 18S R (5' GCATCACAGACCTGTTATTGC3') primers [2]. PCR was performed with PCR reagents and Gene Amp ® PCR System 9700 (Applied Biosystems, United States) as described previously report of Hong et al. [11]. Then the PCR product was sequenced using an autosequencer (ABI PRISM 3100 Avant genetic analyzer). Sequences that we determined were added to the aligned sequence data set through a profile alignment process, using Clustal X v. 1.81 [20]. The sequence obtained was edited and manipulated using MEGA3 software [15]. The phylogenetic tree was inferred by using the neighborjoining (NJ) algorithm [19] in MEGA3 software and the applied bootstrap analysis from 1000 bootstrap replications.
Solid Medium The basal medium for isolation of Isochrysis was Walne’s or f/2 or Erdschreiber enriched sea water medium containing agar (15 g/L), ampicillin (250 mg/L), kanamycin (100 mg/L), streptomycin (50 mg/L), and gentamycin (50 mg/L). To determine the best solid medium for axenic isolation and cultiva tion of I. galbana, we compared the cell growth on dif ferent gelling agents as supporting matrices. An inoc ulums of 1.0 × 106 cells/mL, treated with percoll gra dient and a 4 antibiotic cocktail was spread on an f/2 solid medium composed of different gelling agents and cultured for 2 weeks under culture conditions men tioned previously. Cell counts were measured after vortexing the solid culture with autoclaved seawater taking into account the dilution factor.
To test optimal nutrition medium, cells were cul tured in three media compositions such as f/2, Erd schreiber (Erd) and Walne in 1000 mL Erlenmeyer flasks at 28–30°C, under constant illumination of 100 μmol m–2 s–1. Other conditions such as tempera ture (15–40°C), light intensity (60 μmol m–2 s–1– 800 μmol m–2 s–1), initial pH (3.0–11.0), salt concen tration (5–60 psu of seawater) were varied in the given ranges based on optimal nutritional media. Culture temperature (15, 20, 25, 30, 35, and 40°C) was main tained by circulating water of constant temperature through a metal coil inserted in the cultures. The irra diance level was measured with a PAR scalar irradi ance meter (model QSL100, 4π sensor, Biospherical Instruments). The pH was measured after every 48 h with a pH meter (Altex). All the experiments were conducted in triplicate (n = 3 for each treatment) using an initial cell density of 2 × 106 cells/mL.
Bacterial Test For bacterial counts, 100 μL aliquots of culture were spread on the surface of a Bacto marine agar 2216
The microalgal cells were harvested at four differ ent points in the growth curve: during the exponential growth phase, linear growth phase, early stationary phase and the late stationary phase for analysis of fatty
RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
No. 3
2015
STUDY ON BIOLOGICAL CHARACTERISTICS
205
acid profile [5, 7, 16]. In addition, algal biomass which collected in early stationary phase was analyzed in terms of total lipid, carbohydrates, protein, macro and microelements and heavy metal contents. Cell growth was determined by dry weight and cell density as described in Hong et al. [11]. Growth rate was determined as the slope of ln cell numbers vs. times, from daily abundance measurements, in exponentially growing cultures. Biochemical component of strain HP was analyzed as described by Hong and Hien [12]. Total lipid content was determined as described in the report of Bligh and Dyer [4]. The fatty acid profile was analyzed as described in Hong et al. [11].
formula, rotifers were fed continuously with a mixture of two algae, N. oculata and C. gracilis, and in the sec ond formula—with strain HP only. After 7 hours for enrichment, rotifers were collected and their lipid and fatty acid contents were analyzed. The data were statistically analyzed by oneway ANOVA using the SPSS 12.0 software package. Signif icance of differences between two means was deter mined by Tukey’s test. Pvalue < 0.05 was regarded as significant.
Cultivation of I. galbana HP Biomass for Animal Feeding Outdoor growth experiments in small ponds were started by inoculating them with 30–40% of their volume by indoor cultures. At noon throughout the summer, outdoor light intensities reached 2000 μmol m–2 s–1. In order to protect the lowlight adapted cultures, need to cover the ponds by screens cutting 40% of the light intensity on the surface of the ponds. We have operated the ponds as semicontinuous reactors: The cultures were diluted by replacing up to 30% of the pond’s volume with fresh medium when cultures reached the stationary phase of growth. In outdoor cultures, doubling time of strain HP was 5 days, and its maximal cell density was 6.0–6.5 × 106 cells/mL, which was highest density obtained under our experimental conditions. Cultures were maintained essentially monoalgal for over two months, providing yields of 10–14 g m–2 day–1. I. gal bana HP biomass was cultivated using for animal feeding. Free miroalgae biomass was used as live food for genitors of Snout otter clam (Lutraria rhyncheana Jonas, 1844) before spawning, as well as larvae. Clams (one of animals which have high nutritional value, high economic and popular product aquaculture farms in Vietnam) were kept in water tanks of 10 m3 volume (110 kg per tank). There were two experimental for mulas (control and experimental). Clams were fed with Chaetoceros gracilis and Nannochloropsis oculata in control formula while experimental group was fed by strain HP two times per day. In experimental for mulas, algal cell density was 0.04–0.06 × 106 cells/mL. After 15 days of experiment, fresh weight, shell length, width and thickness of body were measured in all clams. Their nutritional and fatty acid composition, lipid and survival rate were analyzed for estimating the growth rate of genitors of clams before spawning, as well as larvae. Free biomass of strain HP was used as live food for rotifer enrichment. In rotifer (Brachionus plicatilis) culture, after feeding with baker’s yeast strain HP bio mass was replaced by other autotrophic microalgae. The experiment consisted of 2 formulas. In the first
Isolation and Morphological Identification of Isochrysis sp. HP
RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
RESULTS AND DICUSSION
Unicellular culture of the isolated species was iso lated by single cell using micropipette, grown and maintained in f/2 medium. The strain HP was axenic and clonal. Morphological features of the Vietnamese isolate, revealed by both LM (Fig. 1a) and SEM (Fig. 1b) demonstrated its similarity with the genus Isochrysis. Under the light microscope, Isochrysis cells are generally solitary, motile, 4.1–5.2 μm long and 2.8–3.7 μm wide in ellipsoid form. The cells of Iso chrysis have no distinct cell wall and only possess a plasma membrane covering as confirmed by Liu and Lin [17]. Morphological and ultrastructural informa tion about strain HP from the class Prymnesiophyceae is as following. Cells of strain HP are oblong in shape, 4.4 ± 0.3 μm long, 3.4 ± 0.3 μm wide and 2.5–3 μm thick; bi—flagellate, solitary, motile and yellowish to brownish in color. Their flagella are equal in length, smooth and about 7 μm long. Their haptonema is smaller than flagella with scales. Scales of strain HP are plate (2 types). Pattern is rad. ribs both faces. There is not base plate scale and coccoliths. Flagellar root system based on 5 microtubular roots in free part of haptonema. The cells were fragile, plasmolysis occurred at sudden change of osmotic pressure. Simi lar observations of strain HP were made by Parker [18] and by Edvardsen et al. [6] on morphological charac teristics of Isochrysis galbana species. Further analysis of the partial 18S rRNA gene sequence was carried out to confirm the taxonomical identify of the Vietnamese isolate, which revealed its taxonomical homogeneity with I. galbana. Molecular Phylogeny The partial 18S rRNA gene sequence of strain HP was sequenced and deposited in the GENBANK with accession number FJ536744. The haptophyte phylo genetic tree (Fig. 2) was constructed using published 18S rRNA gene sequences of 7 species (Table 1) belonging to the Isochrysis genus from DNA Data Bank of Japan (DDBJ)/European Molecular Biology Laboratory (EMBL)/GenBank, 18S rRNA gene No. 3
2015
206
NGO THI HOAI THU et al. (a)
(b)
Fig. 1. Cell morphology of Isochrysis sp. strain isolated from Hai Phong coastal zone. (a) Cell morphology observed under light microscope with 400 magnifications. (b) Cell morphology observed under scanning electron microscope with 10000 magnifica tions.
sequences of Crypthecodinium cohnii (M34847), Fucus distichus (M97959) were used as outgroups. On the phylogenetic tree, Isochrysis sp. strain HP possesses length of equal evolutionary branch in I. galbana Parke (AJ246266) lying beside Isochrysis sp. CCAP927/14 (DQ079859) and Isochrysis sp. zhangjiangensis (DQ075203). The genetic similarity matrix and phylo genetic tree revealed that the strain HP has the highest genetic similarity with I. galbana Parke (AJ246266) as 99.5% (Table 2). Based on genetic similarity of 18S rRNA gene sequences and distribution on phyloge
netic tree, strain HP identified as Isochrysis galbana Parke. Optimal Growth Conditions of Isochrysis galbana HP The I. galbana HP was cultured in three different nutritional media (Erd, f/2 and Walne media) con taining 30 psu (Fig. 3a). The growth profiles were sim ilar with three media. No lag phase was observed. The growth rate increased during 7 days and the stationary phase was obtained in 13 days. After 10 days of cultiva tion, the growth rate of I. galbana in f/2 medium was
98
Isochrysis sp. strain HP I. galbana Parke AJ246266
Isochrysis sp. CCAP927/14 DQ079859 53 Isochrysis sp. zhangjiangensis DQ075203 50
100
I. galbana 3011 DQ071572 98 62 I. galbana 8701 DQ071573 Isochrysis sp. santou 2 DQ071574 I. litoralis AM490996 Fucus distichus M97959 Crypthecodinium cohnii M34847
0.02 Fig. 2. Phylogenetic relationship of Isochrysis genus based on the partial 18S rRNA gene sequences (7 species). Determined DNA sequence in this study is underlined. The tree was constructed using the Kimura 2—parameter method [14] and 1,000 boot strapped replicates in MEGA3. Crypthecodinium cohnii (with accession number—M34847) and Fucus distichus (M97959) used as outgroups. Bootstrap values of less than 50% are not shown. Branch lengths represent genetic distance among taxa. The bar denotes substitution per nucleotide position. RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
No. 3
2015
STUDY ON BIOLOGICAL CHARACTERISTICS
207
Table 1. The strains used in the molecular phylogenetic analysis with GenBank accession number and citation Species
Strains
Crypthecodinium cohnii (Seligo) Chatto Fucus distichus Linnaeus Isochrysis galbana Parke emend. Green et Pienaar Isochrysis litoralis Billard and Gayral Isochrysis galbana 3011 Isochrysis galbana 8701 Isochrysis sp. santou 2 Isochrysis sp. zhangjiangensis Isochrysis sp. CCAP 927/14
Accession number
Reference
n/a n/a UIO 102
M34847 M97959 AJ246266
Medlin et al., 2008 [24] Medlin et al., 2008 [24] Medlin et al., 2008 [24]
HAP18 n/a n/a n/a n/a n/a
AM490996 DQ071572 DQ071573 DQ071574 DQ075203 DQ079859
Medlin et al., 2008 [24] Coolen et al., 2009 [22] Coolen et al., 2009 [22] Coolen et al., 2009 [22] Coolen et al., 2009 [22] Coolen et al., 2009 [22]
n/a = not available.
indicated highest specific growth rate (μ = 0.66 d–1) and cell density (reached 15.71 × 106 cells/mL) in Erlenmeyer flasks at temperature 25°C in comparison to the other temperatures applied in this experiment. Figure 3D was shown the effect of light intensity from 60 to 800 μmol m–2 s–1 on growth of the native isolate of I. galbana HP. After 10 days of cultivation, the highest growth was determined at the light inten sity of 100 μmol m–2 s–1 with a cell density of 8.11 × 106 cells/mL. The effect of pH ranging from 5.0 to 10.0 on growth of I. galbana HP had no significant difference in the experimental formulas (Fig. 3e). Optimal pH for cul tivation of I. galbana HP was found to be 7. After 10 days of cultivation, at all experiments having differ
the fastest in compared to that in Erd and Walne medium. The final cell density were 7.34 × 106, 4.95 × 106 and 4.71 × 106 cells/mL, in f/2, Erd and Walne medium, respectively. The effect of salinity on growth of I. galbana HP was investigated using 5 to 60 psu of NaCl concentra tion (Fig. 3b). After 10 days of cultivation, I. galbana HP grew well at both 30 and 40 psu, indicating that this strain can potentially be grown in hypersaline condi tions. This characteristic is good for its outdoor growth experiments. Medium containing salinity of 30 ± 1 psu was used for all other experiments. The effect of culture temperature on growth of I. galbana HP was tested in the range from 15 to 40°C (Fig. 3c). The indigenous isolate of I. galbana HP
Table 2. Genetic similarity (percent identity) and divergence matrix of 7 species of Isochrysis and two species of Cryptheco dinium cohnii and Fucus distichus used as outgroups Percent Identity 1
Divergence
1
2
3
4
5
6
7
9
10
99.5 98.0 98.9 99.3 99.0 99.4
99.3 81.5 84.0
1 Isochrysis sp. strain HP
98.4 99.3 99.8 99.5 99.9
99.8 81.4 83.1
2 I. galbana Parke AJ246266
98.1 98.4 98.4 98.5
98.5 82.4 84.0
3 I. litoralis AM490996
99.6 99.1 99.5
99.4 81.7 83.6
4 I. galbana 3011 DQ071572
99.6 99.9
99.9 82.1 83.9
5 I. galbana 8701 DQ071573
99.7
99.6 82.3 83.2
6 Isochrysis sp. santou 2 DQ071574
2
0.4
3
2.2
1.8
4
1.0
0.6
2.0
5
0.7
03
1.7
0.3
6
0.8
0.4
1.6
0.6
0.3
7
0.6
0.2
1.6
0.4
0.1
0.2
8
0.6
0.2
1.6
0.4
0.1
0.2
100.0 82.1 83.8 0.0
9 22.4 22.1 22.5 22.7 22.4 22.3 22.3 10 19.4 19.3 19.8 19.1 19.2 19.3 19.3 1
8
2
3
4
5
6
7
RUSSIAN JOURNAL OF MARINE BIOLOGY
81.9 83.7 22.3
81.8
19.3 22.3 8 Vol. 41
9
7 Isochrysis sp. CCAP 927/14DQ079859 8 Isochrysis sp. zhangjiangensis DQ075203 9 Crypthecodinium cohnii M34847 10 Fucus distichus M97959
10
No. 3
2015
208
NGO THI HOAI THU et al. (a)
9
Cell density, ×106 cells/mL
8 7 6 5 4 3 2 5
7
10 F/2
60
10
40 20 30 Salinity, psu (d)
Cell density, ×106 cells/mL
Cell density, ×106 cells/mL Cell density, ×106 cells/mL
9 8 7 6 5 4 3 2 1 0
5
50
400 600 100 200 Light intensity, µmol/m2 s
Walne (c)
18 16 14 12 10 8 6 4 2 0 15
60
800
25 20 Time, days
15
Nutrient medium Erd
(b) 9 8 7 6 5 4 3 2 1 0
13
Cell density, ×106 cells/mL
0
20
9 8 7 6 5 4 3 2 1 0 3
4
25 30 35 Temperature, °C (e)
5
6
7 pH
8
9
40
10
11
Fig. 3. Effect of nutrient medium (f/2, Erd and Walne media) (a), different NaCl concentrations (b), the temperature (c), the light intensity (d) and pH (e) on the growth in I. galbana HP after 10 days of cultivation.
ent initial pH, the pH of the cultivation medium shifted to 7.0. In cultivation medium having different initial pH, the microalgal organisms can adjust pH value by secreting some compounds outside which could shift medium pH to 7.0 as an optimal initial pH for growing I. galbana HP.
Based on the obtained results, we suggested that the optimal conditions for biomass production of the newly isolated I. galbana HP cultured in f/2 medium are 30 psu of NaCl, pH = 7.0 at 25°C, and 100 μmol m–2 s–1 photon flux density.
RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
No. 3
2015
STUDY ON BIOLOGICAL CHARACTERISTICS
209
Table 3. Total lipid content and fatty acid composition of Isochrysis galbana HP at different growth phase (% of total fatty acids) Fatty acids
Exponential growth phase
10:0 12:0 14:0 14:1 (n5) 15: 0 15:1 (n5) 16:0 16:1 (n7) 17:0 17:1 (n7) 18:0 18:1 (n9) 18:1 (n7) 18:2 (n6) 18:3 (n6) 18:3 (n3) 20:0 20:1 (n9) 20:1 (n7) 20:3 (n6) 20:4 (n6) 20:5 (n3) 22:0 22:4 (n6) 22:5 (n3) 22:6 (n3) Total SFAs Total MUFAs Total PUFAs SFA + MUFA (SFA + MUFA)/PUFA n3 PUFA n6 PUFA n3/n6
0.2 ± 0.0 Trace 7.9 ± 0.9 0.1 ± 0.0 0.2 ± 0.0 0.4 ± 0.0 6.7 ± 0.6 1.9 ± 0.1 Trace 0.4 ± 0.0 0.1 ± 0.0 5.5 ± 0.2 0.7 ± 0.0 1.9 ± 0.1 1.7 ± 0.1 12.9 ± 1.1 1.0 ± 0.1 0.1 ± 0.0 0.9 ± 0.1 0.2 ± 0.0 1.6 ± 0.4 1.0 ± 0.1 Trace 0.2 ± 0.0 2.9 ± 0.3 8.3 ± 1.2 16.1 10.0 30.7 26.1 0.85 25.1 5.6 4.5
Linear growth phase 0.4 ± 0.0 Trace 15.5 ± 1.1 0.2 ± 0.0 0.1 ± 0.0 0.6 ± 0.0 13.1 ± 1.3 2.2 ± 0.1 Trace 0.4 ± 0.0 0.1 ± 0.0 16.0 ± 1.3 0.9 ± 0.1 1.9 ± 0.1 2.1 ± 0.1 24.3 ± 1.4 1.2 ± 0.1 0.1 ± 0.0 1.0 ± 0.1 0.6 ± 0.0 1.9 ± 0.4 1.2 ± 0.1 Trace 0.5 ± 0.0 3.0 ± 0.3 11.3 ± 1.4 30.4 21.8 46.8 52.2 1.12 39.8 7.0 5.69
Fatty Acid Composition The fatty acid composition of I. galbana HP which was collected at the same moment in the different growth phase is shown in Table 3. The major saturated fatty acids in this strain were myristic acid (14 : 0) and palmitic acid (16 : 0). The major monoenoic acid was oleic acid (18 : 1n9). The DHA content in the TFA increased with time of the cultivation together with an increased myristic acid (14 : 0), palmictic acid (16 : 0), RUSSIAN JOURNAL OF MARINE BIOLOGY
Early stationary phase
Vol. 41
0.6 ± 0.0 Trace 12.0 ± 0.7 0.3 ± 0.0 0.5 ± 0.0 0.8 ± 0.1 11.6 ± 0.8 3.2 ± 0.2 Trace 0.6 ± 0.0 0.2 ± 0.0 18.0 ± 1.1 1.2 ± 0.1 2.5 ± 0.1 2.4 ± 0.1 21.0 ± 1.7 1.5 ± 0.1 0.2 ± 0.0 1.3 ± 0.1 0.4 ± 0.0 2.1 ± 0.9 1.7 ± 0.2 Trace 0.4 ± 0.0 2.7 ± 0.2 14.7 ± 0.8 26.4 25.6 48.2 52.0 1.10 40.1 7.8 5.14
Late stationary phase 0.2 ± 0.0 Trace 17.5 ± 1.3 0.3 ± 0.0 0.4 ± 0.0 0.7 ± 0.1 13.4 ± 1.1 3.1 ± 0.2 Trace 0.3 ± 0.0 0.2 ± 0.0 9.6 ± 0.9 1.0 ± 0.1 2.4 ± 0.1 2.0 ± 0.1 18.6 ± 1.5 1.1 ± 0.1 0.1 ± 0.0 0.9 ± 0.1 0.5 ± 0.0 1.9 ± 0.4 1.5 ± 0.1 Trace 0.5 ± 0.0 3.2 ± 0.4 13.6 ± 1.4 34.8 16.0 44.2 50.8 1.15 36.9 7.3 5.06
αlinolenic acid (18 : 3n3), and EPA. The values of saturated and monounsaturated fatty acids subtotal (SFA + MUFA) and PUFAs increased from exponen tial to early stationary phase then decreased in the late stationary phase. The I. galbana HP had the highest content of (SFA + MUFA) and PUFAs in the early stationary phase (Table 3). The SFA with MUFA sub totals reached 52.0% of TFA while PUFAs had a max imal value of 48.2% of TFA in the early stationary phase. Our result has been agreed with the one No. 3
2015
210
NGO THI HOAI THU et al.
Table 4. Nutritional composition of Isochrysis galbana HP Parameter Protein total (%) Humidity (%) Ptotal (%) Ntotal (%) Fiber (%) Lipid (%) Carbonhydrate (%) Ash (550°C) Potassium (mg/kg) Sodium (mg/kg) Boron (mg/kg) Iodine (mg/kg) Calcium (mg/kg) Magnesium (mg/kg) Iron (mg/kg) Manganese (mg/kg) Lead (mg/kg) Cadmium (mg/kg) Copper (mg/kg) Zinc (mg/kg) Chromium (mg/kg) Strontium (mg/kg) Cobalt (mg/kg) Arsenic (mg/kg) Mercury (mg/kg)
Content 27.981 ± 0.892 6.247 ± 0.432 0.421 ± 0.062 1.708 ± 0.078 0.640 ± 0.017 9.780 ± 0.120 25.263 ± 0.789 27.822 ± 0.976 553.0 ± 1.123 559.104 ± 1.394 0.102 ± 0.002 451.520 ± 1.786 0.890 ± 0.016 311.210 ± 1.729 277.730 ± 1.456 21.680 ± 0.516 0.411 ± 0.012 0.052 ± 0.001 30.580 ± 1.015 40.950 ± 1.345 15.440 ± 0.814 337.910 ± 2.516 1.412 ± 0.072 0.036 ± 0.001 0.022 ± 0.001
obtained by Lin et al. (especially with the sum of fatty acids of strain HP in exponential growth phase did not add up to 100%, but only 56.7% compared with 50.6% in I. galbana CCMP 1324) [15]. The strain HP in the exponential phase had lowest n3/n6 value equal to 4.50 and reached maximal value of 5.69 in the linear growth phase. The n3/n6 quotient within 4–6 showed that the I. galbana HP utilization as a feed has an excellent nutritional value for bivalve larvae pro duction at different growth stages. In addition, the DHA content in f/2 medium was also affected by the growth phase. Table 3 showed that the DHA content varied with culture time in the growth curve. This fatty acid content increased with growth phase from 8.3% of TFA at the exponential growth phase to 14.7% of TFA at early stationary phase. Determination of Biochemical Composition The biochemical composition of I. galbana HP was analyzed using samples collected only at early station ary phase and was presented in Table 4. The total amount of protein was 27.981 ± 0.892% dry cell
weight (DCW) which is in agreement with data of Fidalgo et al. [7] and Grima et al. [8]. Lipid and car bohydrate contents reached 9.780 ± 0.120% and 25.263 ± 0.789% DCW, respectively. In addition, I. galbana HP was rich in both macro and microelements. The heavy metal content in the microalgal biomass was low. For example, Pb content was 0.411 ± 0.012 mg/kg, Cd—0.052 ± 0.001 (mg/kg), As—0.036 ± 0.001 (mg/kg) and Hg— 0.022 ± 0.001 (mg/kg). For all reasons mentioned above, it can be recommended to serve as a feed for aquaculture according to the Vietnam standard of functional food published in 1999. Application of I. galbana HP Biomass for Animal Feeding The results of the application of I. galbana HP free biomass as live feed for genitors of Snout otter clam (Lutraria rhyncheana Jonas, 1844) before spawning as well as larvae have shown that in control comparison with C. gracilis and N. oculata, clams in experimental group had fresh weight, length, width and thickness of the body increased by 63.79, 10.37, 11.41 and 11.94%, respectively; total lipid and PUFA contents increased by 10 and 41.94%; PUFAs/SFAs ratio increased 1.89 times, content of protein, macro and microele ments increased by 10% and survival rate of Snout otter clam’s larvae increased by 20–30%. The results obtained in experiments with rotifer enrichment have indicated that in experimental for mula, rotifers possess a higher 2.7 times of total lipid content compared with that in control. In addition, n 3 DPA (C22:5 n3) content was 3.751% of TFA com pared with 0.618% of TFA in control. Thus, the newly Vietnamese indigenous I. galbana HP was raised and grown successfully in the optimal growth laboratory conditions. The strain HP had the highest content of SFA and MUFA as well as PUFAs in the early stationary phase. Biomass of this strain can be utilized for supplying as live feed in aquaculture in Vietnam. ACKNOWLEDGMENTS This work was financially supported by the Minis try of Agriculture and Rural Development (2008– 2010) and Ministry of Industry and Trade (2009– 2011) to D.D. Hong. We are grateful to utilize the facilities of National Key Laboratory at the IBT, VAST, Hanoi, Vietnam. We are also grateful to Dr. Jayanta Talukdar (Gauhati University, Assam, India) for cor recting English. REFERENCES 1. Alonso, D.L., Grima, E.M., Perez, J.A.S., Sanchez, J.L.G., and Camacho, F.G., Isolation of
RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
No. 3
2015
STUDY ON BIOLOGICAL CHARACTERISTICS
211
clones of Isochrysis galbana rich in eicosapentaenoic acid, Aquaculture, 1992, vol. 102, no. 4, pp. 363–371.
marine microalga Isochrysis galbana, J. Mar. Biotech nol., 1995, vol. 2, pp. 139–142.
2. Anh, H.T.L., Thu, N.T.H., and Hong, D.D., Identifi cation of several marine microalgae strains isolated from Hai Phong and Nha Trang coasts based on mor phology and 18S rRNA gene analysis, Vietnam J. Bio technol., 2010, vol. 8, no. 3, pp. 387–396.
14. Kimura, M., A simple method for estimating evolu tionary rate of base substitutions through comparative studies of nucleotide sequences, J. Mol. Evol., 1980, vol. 16, no. 2, pp. 111–120.
3. Andersen, R.A., Algal Culturing Techniques, Phycolog ical Society of America, 2005.
15. Kumar, S., Tamura, K., and Nei, M., MEGA3: Inte grated software for molecular evolutionary genetics analysis and sequence alignment, Briefings Bioinform, 2004, vol. 5, no. 2, pp. 150–163.
4. Bligh, E.G. and Dyer, W.J., A rapid method of total lipid extraction and purification, Can. J. Biochem. Physiol., 1959, vol. 37, no. 8, pp. 911–917. 5. Dustan, G.A., Volkman, J.K., Barret, S.M., and Gar land, C.D., Changes in the lipid composition and max imization of the polyunsaturated fatty acid content of three microalgae growth in mass culture, J. Appl. Phy col., 1993, vol. 5, pp. 71–83. 6. Edvardsen, B., Eikrem, W., Green, J.C., Andersen, R.A., Staay, S.Y.M.V., and Medlin, L.K., Phylogenetic reconstructions of the Haptophyta inferred from 18S ribosomal DNA sequences and avail able morphological data, Phycologia, 2000, vol. 39, no. 1, pp. 19–35. 7. Fidalgo, J.P., Cid, A., Torres, E., Sukenik, A., and Her rero, C., Effects of nitrogen source and growth phase on proximate biochemical composition, lipid classes and fatty acid profile of the marine microalgae Isochrysis galbana, Aquaculture, 1998, vol. 166, nos. 1−2, pp. 105–116. 8. Grima, E.M., Perez, J.A.S., Camacho, F.G., Sevilla, J.M.F., and Fernandez, F.G.A., Effect of growth rate on the eicosapentaenoic acid and docosa hexaenoic acid content of Isochrysis galbana in chemo stat culture, Appl. Microbiol. Biotechnol., 1994, vol. 41, no. 1, pp. 23–27. 9. Guillard, R.L. and Ryther, R.H., Studies of marine planktonic diatoms, I. Cyclotella nana Hustedt, and Detonula confervacea (cleve) Gran, Can. J. Microbiol., 1962, vol. 8, pp. 229–239. 10. Hemaiswarya, S., Raja, R., Kumar, R.R., Ganesan, V., and Anbazhagan, C., Microalgae: a sustainable feed source for aquaculture, World J. Microbiol. Biotechnol., 2011, vol. 27, pp. 1737–1746. 11. Hong, D.D., Anh, H.T.L., and Thu, N.T.H., Study on biological characteristics of heterotrophic marine microalga—Schizochytrium mangrovei PQ6 isolated from Phu Quoc Island, Kien Giang province, Vietnam, J. Phycol., 2011, vol. 47, no. 4, pp. 944–954. 12. Hong, D.D. and Hien, H.M., Nutritional analysis of Vietnamese seaweeds for food and medicine, BioFac tors, 2004, vol. 22, nos. 1−4, pp. 323–325. 13. Kiffe, M., Nokihara, K., and Matsunaga, T., Purifica tion of docosahexaenoic acid (DHA) produced by RUSSIAN JOURNAL OF MARINE BIOLOGY
Vol. 41
16. Lin, Y.H., Chang, F.L., Tsao, C.Y., and Leu J.Y., Influ ence of growth phase and nutrient source on fatty acid composition of Isochrysis galbana CCMP 1324 in a batch photobioreactor, Biochem. Eng. J., 2007, vol. 37, no. 2, pp. 166–176. 17. Liu, C.P. and Lin, L.P., Ultrastructural study and lipid formation of Isochrysis sp. CCMP 1324, Bot. Bull. Acad. Sin., 2001, vol. 42, no. 3, pp. 207–214. 18. Parker, M., Studies on marine flagellates, J. Mar. Biol. Assoc. UK, 1949, vol. 28, no. 1, pp. 255–286. 19. Saito, N. and Nei, M., The neighbor—joining method: A new method for reconstructing phylogenetic trees, Mol. Biol. Evol., 1987, vol. 4, no. 4, pp. 406–425. 20. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmou gin, F., and Higgins, D.G., The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools, Nucl. Acids Res., 1997, vol. 25, pp. 4876–4882. 21. Wikfors, G.H., Ferris, G.E., and Smith, B.C., The relationship between gross biochemical composition of cultured algal foods and growth of the hard clam, Mer cenaria mercenaria (L.)., Aquaculture, 1992, vol. 108, nos. 1–2, pp. 135–154. 22. Coolen, M.J.L., Saenz, J.P., Giosan, L., Trowbridge, N.Y., Dimitrov, P., Dimitrov, D., and Eglinton, T.I., DNA and lipid molecular stratigraphic records of haptophyte succession in the Black Sea dur ing the Holocene, Earth Planet. Sci. Lett., 2009, vol. 284, pp. 610–621. 23. McLachlan, J., Growth mediamarine, in Handbook of Phycological methods: Culture Methods and Growth Measurements, Stein, J.R., Ed., Cambridge, U.K.: Cambridge University Press, 1973, pp. 25–51. 24. Medlin, L.K., Saez, A.G., and Young, J.R., A molecu lar clock for coccolithophores and implications for selectivity of phytoplankton extinctions across the K/T boundary, Mar. Micropaleontol., 2008, vol. 67, pp. 69–86. 25. Walne, P.R., Experiments in the large scale culture of the larvae of Ostrea edulis L., Fish. Invest., London, 1966. No. 3
2015
