UNCORRECTED PROOF!
Euphytica 00: 1–8, 2003. © 2003 Kluwer Academic Publishers. Printed in the Netherlands.
1
Studying genetic relationships among coconut varieties/populations using microsatellite markers L. Perera1,∗ , J.R. Russell2 , J. Provan2 & W. Powell2 1 Genetics and Plant Breeding Division, Coconut Research Institute, Lunuwila, Sri Lanka; 2 Department of Cell and
Molecular Genetics, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, Scotland, U.K.; (∗ Author for correspondence: e-mail:
[email protected],
[email protected])
Received 17 July 2002; accepted 2 March 2003
Key words: coconut, Cocos nucifera, genetic diversity, microsatellite, SSR
Summary The extent of genetic diversity and the genetic relationships among 94 coconut varieties/populations (51 Talls and 43 Dwarfs) representing the entire geographic range of cultivation/distribution of the coconut was assessed using 12 pairs of coconut microsatellite primers. A high level of genetic diversity was observed in the collection with the mean gene diversity of 0.647±0.139, with that of the mean gene diversity of Talls 0.703±0.125 and 0.374±0.204 of Dwarfs. A phenetic tree based on DAD genetic distances clustered all the 94 varieties/populations into two main groups, with one group composed of all the Talls from southeast Asia, the Pacific, west coast of Panama, and all Dwarfs and the other of all Talls from south Asia, Africa, and the Indian Ocean coast of Thailand. The allele distribution of Dwarfs highlighted a unique position of Dwarf palms from the Philippines exhibiting as much variation as that in the Tall group. The grouping of all Dwarfs representing the entire geographic distribution of the crop with Talls from southeast Asia and the Pacific and the allele distribution between the Tall and Dwarf suggest that the Dwarfs originated from the Tall forms and that too from the Talls of southeast Asia and the Pacific. Talls from Pacific Islands recorded the highest level of genetic diversity (0.6±0.26) with the highest number of alleles (51) among all the regions.
Introduction
The coconut palm (Cocos nucifera L., Arecaceae) is the most widely cultivated/occurring tropical plantation crop. It is monospecific. It consists of two forms, the Talls and Dwarfs. The Talls are generally cross-fertilized and the Dwarfs self-fertilized. Hybrid between two forms display pronounced heterosis. In the natural state, the Dwarfs occur only very sparingly. Morphological diversity and geographical distribution of coconut have led to the identification of more than 600 putative diverse coconut varieties/populations (Coconut Genetic Resources Database Ver.4/COGENT/IPGRI). However, as evaluation and characterization of coconut based on morphology are largely influenced by environmental factors and therefore are not accurate, this collection would probably
have redundancies and genetically very similar materials. Therefore a reliable assessment of the genetic relationships between varieties/populations of coconut and the accurate estimation of the genetic diversity present in coconut are pre-requisite for sustainable future coconut breeding and genetic resources conservation programme. Thus, methods independent of environmental factors for establishment of these parameters are of great importance to the plant breeders. In this regard, molecular marker techniques are advantageous as they directly reflect variations in the DNA sequence and therefore of independent of environment. Among many molecular maker techniques currently available, microsatellites or SSRs (Simple Sequence Repeats, Powell et al., 1996) provides an improved technology in assessing genetic diversity and genetic relationships in plants (Powell et al., 1995a,b,
GSB/Prepr: EUPH 6772-DISK / Pipsnr. 5123551 / JM.KLUTEX2K (euphkap:bio2fam) v.1.2 5123551.tex; 27/03/2003; 12:57; p.1
2 Table 1. Name of varieties used, their International variety code and country of origin
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51
Names of Tall varieties/populations
Variety code
Country of origin
Tagnanan San Ramon Spicata Agta Baybay Laguna Zamboanga Mapanget Tenga Pungkol Kenari Palu Takome Igo-Duku Australian Tall Bali Tall Sawarna Jepara Banyuwangi Lubuk Pakam Ta Dau Kalok Thai Tall Pak Chok Thalai Roi Andaman Ordinary Tonga Tall Rotuma Tall Solomon Tall Rennell Tall Tahitian Tall Karkar Tall Vanuatu Tall Cameroon Kribi West African Tall Comoro Tall Mozambique Tall Panama Aquadulce Panama Monagre Malayan Tall Fijian Tall Niu Damu Ran Thembili Pora Pol Bodiri Typica (SLK Tall) Kamandala San Ramon (SL) Gon Thembili Nawasi
TAGT SNRT SPIT AGAT BAYT LAGT ZAMT MPT TGT PGLT – PUT TKT IDT – BAT SAT JPT BGT LPT TAAT DAUT THT08 THT PCKT TLRT ADOT TOT RTM T SIT RIT TAT KKT VIT CKT WAT CMT MZT PNT01 PNT02 MLT FJT NDMT CRAT PPT BDRT SLT KMT SNRT01 GONT NAWT
Philippines Philippines Philippines Philippines Philippines Philippines Philippines Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Vietnam Vietnam Thailand Thailand Thailand Thailand India Tonga Solomon Is Solomon Is Rennell Is Tahiti PNG Vanuatu Cameroon Ivory coast Comoro Is Mozambique Panama Panama Malaysia Fiji Island Fiji Island Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43
Names of Tall varieties/populations
Variety code
Country of origin
Santo Nino San Isidro Banigan Baguer Catigan Green Pilipog Kinabalan Tacunan Banga Kapatagan Mangipod Raja Brown Sagerat Orange Bali Yellow Jombang Nias Yellow Nias Green Tebing Tinggi Salak Xiem Green Eo Brown Tam Quan Thailand Red Nali Kei Pathiu Nok Koom Nam Horm Thung Kled Aromatic Green Niu Leka Madang Brown Cameroon Red Ghana Yellow Brazilian Green Malayan Yellow Malayan Red Malayan Green Sri Lanka Red Sri Lanka Brown Sri Lanka Yellow Sri Lanka Green King Coconut Rathran Thembili
SNOD SNID BNGT BAGD CATD PILD KIND TACD BAND KAPD MGPD RBD SOD BAYD JGD NYD NGD TTD SKD XGD EOD TYD – – PTID NKMD – TKD AROD NLAD MBD CRD GYD BGD MYD MRD MGD SLRD01 SLBD CYD01 PGT RTB01 RTB03
Philippines Philippines Philippines Philippines Philippines Philippines Philippines Philippines Philippines Philippines Philippines Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Indonesia Viet Nam Viet Nam Viet Nam Thailand Thailand Thailand Thailand Thailand Thailand Thailand Fiji Island PNG Cameroon Ghana Brazil Malaysia Malaysia Malaysia Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka Sri Lanka
5123551.tex; 27/03/2003; 12:57; p.2
3 Table 2. Oligonucleotide primer sequences, repeat pattern, TM and expected product size for 11 nuclear SSR loci of coconut Locus
Repeat type
Forward primer (5’–3’)
Reverse primer (5’–3’)
TM
Expected product size
CAC20 CAC21 CAC23 CAC39 CAC52 CAC56 CAC65 CAC68 CAC71 CAC72 CAC84
(CA)19 (CA)11 (CA)8 (CA)13 (CA)19 (CA)14 (AC)15 (CA)13 (CA)17 (CA)18 (CA)13
CTCATGAACCAAACGTTAGA AATTGTGTGACACGTAGCC TGAAAACAAAAGATAGATGTCAG AATTGAGATAAGCAGATCAGTG TTATTTTCTCCACTTCTGTGG ATTCTTTTGGCTTAAAACATG GAAAAGGATGTAATAAGCTGG AATTATTTTCTTGTTACATGCATC ATAGCTCAAGTTGTTGCTAGG TCACATTATCAAATAAGTCTCACA TTGGTTTTTGTATGGAACTCT
CATCATATACATACATGCAACA GCATAACTCTTTCATAAGGGA GAAGATGCTTTGATATGGAAC GTCGGTCTTTATTCAGAAGG ATATACCCATGCACAGTACG TGATTTTACAGTTACAAGTTTGG TTTGTCCCCAAATATAGGTAG AACAGCCTCTAGCAATCATAG ATATTGTCATGATTGAGCCTC GCTCTCTTTCTCATGCACA AAATGCTAACATCTCAACAGC
52 53.7 53.9 53.8 53.5 53.9 53.4 54 54 54 54
128 154 192 153 156 154 151 142 183 130 160
1996b; Rafalski et al., 1996), as they are highly polymorphic, co-dominant, very informative and PCR based. We have previously reported development of SSRs in coconut (Perera et al., 1999) and their application on a worldwide coconut collection (Perera et al., 2000). In this paper we publish the sequences of another newly designed eleven polymorphic coconut specific SSR primers and the results obtained by analysing molecular data generated from five of them in the same formally analysed worldwide coconut collection combined with the molecular data generated from seven previously designed SSR primers (Perera et al., 1999). This increased number of SSR markers greatly improved the previously established genetic relationships between coconut varieties/populations. Materials and methods A total of 130 individuals representing 94 coconut varieties/populations that included 51 Talls and 43 Dwarfs were used for this study. Each variety/population was represented by 1–3 individuals. The names, their international variety codes and countries of origin of the samples used are given in Table 1. Total genomic DNA was isolated from frozen young coconut leaves using the standard CTAB nucleic acid extraction method. Construction of a small insert genomic library enriched for coconut SSRs, PCR primer designing and detection of SSR polymorphism is described in Perera et al. (1999, 2000). The sequence of the previously used SSR primers and their related information could be found in Perera, et al. (1999) and in
EMBL Nucleotide Sequence Database with accession numbers AJ011865 to AJ011878.
Data analysis Data analysis is described in detail in Perera et al. (2000). In summary diversity values based on phenotype frequencies were calculated for each SSR locus using Nei’s unbiased statistic (1987). Distances between individuals were calculated from SSR repeat sizes using the computer program MICROSAT V1.5 (Eric Minch, Stanford University, USA) to calculate the absolute distance (DAD ) metric. A neighbourjoining tree showing relationships based on DAD genetic distances was constructed using the NEIGHBOR and DRAWTREE options in the PHYLIP package (V3.57c: Joe Felsenstein, University of Washington, USA).
Results Microsatellite primers, level of polymorphism detected and the genetic diversity The sequences of eleven newly designed SSR primers that flank (CA)n simple perfect repeats of coconut and their related primer information are given in Table 2. The number of alleles and the gene diversity values observed for each of the eleven primer pairs tested on a set of Sri Lankan coconut germplasm are given in Table 3. The data generated from seven of the previously used SSR primers and from five new SSR primers reported here are given in Table 4. All new five loci studied were
5123551.tex; 27/03/2003; 12:57; p.3
4 Table 3. Number of alleles and the level of polymorphism detected for 11 SSR primers Locus
Number of alleles
Diversity index
CAC52 CAC68 CAC65 CAC20 CAC56 CAC72 CAC84 CAC71 CAC39 CAC21 CAC23
7 6 8 6 11 4 3 3 5 2 3
0.56±0.03 0.65±0.02 0.77±0.02 0.72±0.01 0.84±0.01 0.62±0.03 0.60±0.04 0.55±0.04 0.70±0.02 0.50±0.01 0.59±0.02
polymorphic within the 130 individuals of the 94 varieties/populations and produced single locus profiles. All twelve loci in a combination produced a total of 85 alleles with an average of 7.4 alleles per locus (Table 4). In general a high level of genetic diversity was observed with the highest gene diversity value of 0.837±0.009 for CAC56 and with a mean gene diversity of 0.647±0.139. A total of 84 alleles were observed for Talls with an average of 7 alleles per locus as compared with only 42 alleles for Dwarfs with an average of 3.5 alleles per locus. The mean gene diversity of Talls was 0.703±0.125 in contrast to that of 0.374±0.204 in Dwarfs. Heterozygous loci were evident in both Talls and Dwarfs, but the overall percentage of heterozygotes in Dwarfs were as low as 2.5% compared to that of 30% in Talls. Thirteen Dwarf varieties/populations out of 43 studied were appeared heterozygous but the level of heterozygosity varies among them, for example variety ‘Niu Leka’, which is known to have shown cross-pollination was heterozygous for six out of twelve loci studied (CAC2, CAC3, CAC4, CAC10, CAC52 and CAC56), ‘Banigan’ for five loci (CAC2, CAC6, CAC8, CAC20 and CAC56), ‘Malayan green Dwarf’, which is known to show partial cross-pollination and ‘San Isidro’ for three loci each and the rest of the varieties (‘Tacunan’, ‘Kapatagan’, ‘Salak’, Nok Koom, Malayan Yellow Dwarf, Sri Lanka Yellow Dwarf, Cameroon Red Dwarf, Ghana Yellow Dwarf and Brazilian Green Dwarf) for one or two loci. The allele distribution of Dwarfs highlights the unique position of the Dwarf palms sampled from the Philippines that exhibit as much variation as that
observed in the Tall group (0.442±0.19 for Dwarf Vs 0.512±0.22 for Talls). Further the lowest population differentiation value was observed between Philippines Talls and Dwarfs compared to that from other countries (FST = 0.21 Vs 0.51 for Sri Lanka and 0.36 for Indonesia). Dwarf palms sampled from Sri Lanka appear to show a very low level of allelic diversity with the highest population differentiation statistic with Sri Lankan Talls (FST = 51%). The diversity value for Indonesian Dwarfs (0.223±0.23) is comparable to that of Sri Lanka (0.223±0.29) but out of twelve microsatellites described here, Indonesian Dwarfs showed diversity at seven loci, while Sri Lankan Dwarfs were polymorphic only at five loci. Eight alleles that were not present in Sri Lanka Talls were present in Sri Lanka Dwarfs and interestingly they were present in Talls either from Indonesia, the Philippines or from Pacific Islands. Pacific Islands Tall coconuts recorded the highest level of genetic diversity (0.6±0.26) with the highest number of alleles (51) and therefore it is likely that higher levels of genetic diversity exist in the Pacific region compared to the rest of the regions. Since two Dwarf varieties/populations were sampled from Pacific Islands, an analysis of the status of Dwarfs in the Pacific Islands has not been possible. Genetic relatedness A phenetic tree showing the genetic relationships among the 130 individuals studied is shown in Figure 1. It can be seen that there are two main groups, the first group composed of three subgroups (I, II and III), which are two main Tall subgroups (I and III) and one main Dwarf group (II). All the Tall varieties/populations in the group I and III were from southeast Asia, Pacific Islands and Papua New Guinea. Coconut varieties/populations from the west coast of Panama (Panama Aquadulce and Panama Monagre) and one east African coconut, ‘Comoro Tall’, were also tightly grouped within Tall subgroups of III and I respectively. Subgroup II consisted of all Dwarf coconuts, except ‘Niu Damu Tall’ and were from all coconut growing regions including Sri Lankan Dwarfs and Sri Lankan intermediate coconuts (‘King Coconut’ and ‘Rathran Thembili’). However, Dwarf varieties ‘Banigan’, ‘Banga’, ‘Kinabalan’, ‘Aromatic Green Dwarf’, ‘Santo Nino’, ‘Malayan Green Dwarf’ and ‘Niu Leka Dwarf’, all of which were from southeast Asia or from Pacific Islands were positioned in between the Talls of the same regions. The second
5123551.tex; 27/03/2003; 12:57; p.4
5 Table 4. Number of alleles detected, diversity statistics and FST for eight coconut microsatellite primers Locus
CAC2 CAC3 CAC4 CAC6 CAC8 CAC10 CAC13 CAC52 CAC68 CAC65 CAC20 CAC56 Mean Total
Number of alleles All Tall Dwarf
Observed product size range (bp)
Gene index All (n = 130)
Tall (n = 75)
Dwarf (n = 55)
9 5 8 9 9 5 3 7 6 7 6 11 7.4 85
210–154 187–203 182–216 150–168 188–210 195–205 158–172 148–162 136–152 154–180 122–138 144–168
0.713±0.024 0.386±0.035 0.762±0.015 0.704±0.019 0.722±0.018 0.468±0.032 0.488±0.013 0.568±0.031 0.630±0.014 0.765±0.013 0.723±0.012 0.837±0.009 0.647±0.139 0.995±0.001
0.830±0.016 0.549±0.036 0.792±0.012 0.793±0.016 0.74±0.025 0.616±0.028 0.499±0.015 0.731±0.02 0.534±0.036 0.800±0.011 0.684±0.026 0.867±0.008 0.703±0.125 0.999±0.001
0.418±0.016 0.072±0.033 0.573±0.02 0.476±0.041 0.303±0.055 0.156±0.045 0.348±0.176 0.124±0.042 0.203±0.047 0.575±0.022 0.545±0.043 0.693±0.024 0.374±0.204 0.971±0.006
9 5 8 9 8 5 3 7 6 7 6 11 7 84
5 2 3 5 4 3 2 3 2 3 4 6 3.5 42
main group (IV) consisted of Talls, mostly Sri Lankan Talls. Interestingly, ‘Andaman Ordinary Tall’ from the Indian Ocean, ‘Mozambique Tall’ from east Africa, ‘Cameroon Kribi Tall’ and ‘West African Tall’ from west Africa and all Thailand Talls except ‘Kalok’, were also grouped with the main Sri Lankan Tall coconut group (IV). The variety ‘San Ramon’ sampled from Sri Lanka grouped with Sri Lankan coconuts, while the same named variety sampled from the Philippines was grouped with the rest of the southeast Asia coconuts. The twelve microsatellites uniquely discriminated 106 out of the 130 individuals evaluated. All of the Tall individuals could be uniquely identified with twelve SSRs. The 24 genotypes that could not be discriminated were Dwarf types found in group II.
Discussion and conclusions Data generated from five most diverse newly designed SSR primers out of eleven published here have been used to analys the genetic diversity of a worldwide collection of 94 coconut germplasm with molecular data generated from seven previously designed SSR primers to obtain more precise and in depth information. The results of the phenetic tree of the 130 individuals of the 94 varieties/populations (Figure 1) based on SSR markers generally agree with the results of other
FST (Tall/Dwarf) 0.184∗∗∗ 0.187∗∗∗ 0.154∗∗∗ 0.125∗∗∗ 0.381∗∗∗ 0.191∗∗∗ 0.285∗∗∗ 0.292∗∗∗ 0.549∗∗∗ 0.148∗∗∗ 0.243∗∗∗ 0.100∗∗∗ 0.233∗∗∗
genetic relationships established using RFLP markers (Lebrun et al., 1998) and ISTR markers (Rohde et al., 1995). Harries (1978) suggests that naturally evolved coconuts (‘Niu Kafa’) predominate in south Asia, Africa, Caribbean and the Atlantic coast of Central America while coconuts selected under cultivation (‘Niu Vai’) are predominant in southeast Asia, the Pacific Islands and the west coast of Central America. It is accepted that the coconut palm has existed on the Atlantic coast of Africa, south America and around the Caribbean region for less than 500 years (Child, 1974; Purseglove, 1972) and that there is a great similarity between these coconuts and those in east Africa, India and Sri Lanka (Harries, 1977). The grouping of ‘Mozambique Tall’, which Harries (1977) suggests as the main source of coconuts in east Africa and the Atlantic coast of America, ‘Cameroon Kribi Tall’, ‘West African Tall’, ‘Sri Lankan Tall’ and the ‘Andaman Ordinary Tall’ from the Indian Ocean together in the phenetic tree supports Harries’s theory of natural and human-assisted coconut germplasm dissemination. The observation of grouping of the ‘San Ramon’ sampled from Sri Lanka with Sri Lankan Tall cluster suggests that this variety has been introgressed with the Sri Lankan Tall. Interestingly, the ‘Comoro Tall’, from east Africa fell in with subgroup I and seems to originate from southeast Asia coconuts (‘Niu Vai’ type). Lebrun et al. (1998) noted that ‘Comoro Tall’ took an intermediate position between southeast Asian populations and Indian Ocean populations. The
5123551.tex; 27/03/2003; 12:57; p.5
6
Figure 1. Phenetic tree showing the genetic relationships between coconut varieties (Dwarfs are in italics).
5123551.tex; 27/03/2003; 12:57; p.6
7 Thailand Talls, ‘Thai Tall’, ‘Pak Chok’, ‘Talai Roy’ grouped with mainly the Sri Lankan group (IV) while ‘Kalok’ grouped with subgroup I which includes Far East and Pacific Talls. The results of a detailed study on varieties of coconut in Thailand carried out by Harries et al. (1982) based on fruit component analysis suggest that both ‘Niu Kafa’ and ‘Niu Vai’ types of coconuts are available in Thailand with the ‘Niu Kafa’ type predominant on the Indian Ocean coast of the country. He concluded that ‘Kalok’ is a large fruited coconut type that resembles other large fruited forms such as ‘San Ramon’ and ‘Tagnanan’ in the Philippines, ‘Bali Tall’ in Indonesia, ‘Rennell Tall’ in Solomon Islands and ‘Panama Tall’ in the Pacific coast of America. He also suggested that ‘Malayan Tall’ probably shares common ancestry with ‘Kalok’. He observed further that ‘Pak Chok’ could be compared with other Talls that have ‘Niu Kafa’ characteristics, for example the Talls from Sri Lanka, India, Mozambique, west Africa and the Caribbean. Rattanapruk (1970) also stated that ‘Pak Chok’ variety found growing along the coast of Indian Ocean resembles coconut from Sri Lanka. Interestingly, the variety ‘Kalok’ in this study grouped with ‘San Ramon’, ‘Tagnanan’, ‘Bali Tall’, ‘Rennell Tall’ and ‘Malayan Tall’ in subgroup I. However ‘Panama Tall’ grouped with subgroup III. Similarly ‘Park Chok’ grouped with the forms from Sri Lanka, Andaman Islands and Mozambique in group IV. However the ‘West African Tall’ obtained from the Malaysian Coconut Gene Bank grouped with the coconut varieties of the Far East. This is invariance with the overall observations. This may be because of misidentification of the variety. The grouping of Panama Talls (‘Panama Manarge’ and ‘Panama Aguadulce’) with southeast Asian and Pacific Talls (subgroup III) is in agreement with Whitehead’s (1976) proposition of the eastward movement of coconut from southeast Asia to the Pacific region and subsequently from here to Pacific coast of America. Both types of ‘Panama Talls’ were from the Pacific coast of Panama. These results are largely in agreement with the results from ISTR (Inverse Sequence-Tagged Repeats) analysis (Rohde et al., 1995), which grouped ‘Panama Talls’ with Polynesian varieties/populations. The phenetic tree also provides information on selection of better combinations of Talls for the crossing programme, in order to maximise heterosis by maximising the genetic distance between parents, for example, Talls from group IV and Dwarfs or Talls from group IV with Talls from group I or III.
The grouping of all Dwarfs from different geographical regions in a single cluster (II) within the main ‘Niu Vai’ type of coconuts and loss of allelic richness observed in Dwarfs suggest that Dwarfs evolved from the ‘Niu Vai’ type of coconuts in the southeast Asia/Pacific region, domesticated there and were introduced to the other regions later. The increased number of markers has increased already available information on genetic relationships among coconut varieties/populations. The genetic relationships established among coconut varieties/populations in this study predicts increased hybrid vigour from crosses between southeast Asia/Pacific Talls with south Asia Talls or from crosses between south Asia Talls and southeast Asia/Pacific Dwarfs as genetically divergent parents maximise heterosis and thus increase the hybrid vigour. Acknowledgements The authors greatly acknowledge the COGENT/IPGRI and COGENT member countries for supplying coconut leaf materials for this study. Special thanks go to the research staff of the Genetics and Plant Breeding Division of the Coconut Research Institute of Sri Lanka and the staff of the Cell and Molecular Genetics Department of the Scottish Crop Research Institute of Dundee, Scotland, for their tremendous cooperation in this work. The Commonwealth Scholarship Commission of the UK through British Council financed this research. References Child, R., 1974. Coconuts. (2nd ed.) Longmans, London. Harries, H.C., 1977. The Cape Verde region (1499 to 1549); the key to coconut culture in the Western hemisphere? Turrialba 27: 227–231. Harries, H.C., 1978. The evolution dissemination and classification of Cocos nucifera L. Bot Rev 44: 205–317. Harries, H.C., A. Thirakul & V. Rattanapruk, 1982. The coconut genetic resources of Thailand. In: Proc Seminar on Coconut and Cocoa, Bangkok, Thailand, 19–23 July 1982, Chumphon, Department of Agriculture. Lebrun, P., N.P. N’Cho, M. Seguin, L. Grivet & L. Baudouin, 1998. Genetic diversity in coconut (Cocos nucifera L.) revealed by restriction fragment length polymorphism (RFLP) markers. Euphytica 101: 103–108. Nei, M., 1987. Molecular Evolutionary Genetics. Columbia University Press, New York, NY, USA. Perera, L., J.R. Russell, J. Provan & W. Powell, 1999. Identification and characterisation of microsatellites in coconut (Cocos nucifera L.) and the analysis of coconut populations in Sri Lanka. Mol Ecol 8: 344–346.
5123551.tex; 27/03/2003; 12:57; p.7
8 Perera, L., J.R. Russell, J. Provan & W. Powell, 2000. Use of Microsatellite DNA markers to investigate the level of genetic diversity and population genetic structure of coconut (Cocos nucifera L.). Genome 43: 15–21. Powell, W., C. Orozco-Castillo, K.J. Chalmers, J. Provan & R. Waugh, 1995a. Polymerase chain reaction-based assays for the characterisation of plant genetic resources. Electrophoresis 16: 1726–1730. Powell, W., M. Morgante, C. Andre, J.W. McNicol, G.C. Machray, J.J. Doyle, S.V. Tingey & J.A. Rafalski, 1995b. Hypervariable microsatellites provide a general source of polymorphic DNA markers for chloroplast genome. Curr Biol 5: 1023–1029. Powell, W., G.C. Machray & J. Provan, 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Sci 1: 215–222. Purseglove, J.W., 1972. Tropical Crops: Monocotyledons. Longmans, London.
Rafalski, J.A., M.J. Vogel, M. Morgante, W. Powell, C. Andre & S.V. Tingey, 1996. Generating and using DNA markers in plants. In: B. Birren & E. Lai (Eds.), Non-Mammalian Genome Analysis: A Practical Guide, pp. 75–134. Academic Press, New York. Rattanapruk, V., 1970. Thailand. In: Yearly Progress Report on Coconut Breeding, pp. 31–33. FAO, Rome. Rohde, W., A. Kullaya, J. Rodriguez & E. Ritter, 1995. Genome analysis of Cocos nucifera L. by PCR amplification of spacer sequences separating a subset of copia-like 16RI repetitive elements. J Genet Breed 49: 179–186. Whitehead, R.A., 1976. Coconut. In: N.W. Simmonds (Ed.), Evolution of Crop Plants, pp. 221–225. Longman, London.
5123551.tex; 27/03/2003; 12:57; p.8
