Substrate preference of ...

RESEARCH LETTER

Substrate preference of 5′-methylthioadenosine/ S-adenosylhomocysteine nucleosidase in Burkholderia thailandensis Qiang Gao1,2, Dasheng Zheng1 & Zhiming Yuan1 1

Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China; and Graduate School of the Chinese Academy of Sciences, Beijing, China

2

Correspondence: Zhiming Yuan, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China. Tel.: 86 27 87197242; fax: 86 27 87198120; e-mail: [email protected] Received 5 September 2012; revised 27 November 2012; accepted 27 November 2012. DOI: 10.1111/1574-6968.12059 Editor: Kendra Rumbaugh

MICROBIOLOGY LETTERS

Keywords MTAN; AdoHcyase; substrate preference; Burkholderia thailandensis.

Abstract 5′-Methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) plays crucial roles in the production of autoinducers and methionine metabolism. Putative genes encoding MTAN and AdoHcyase from Burkholderia thailandensis were cloned and characterized. The Km values of MTAN for 5′-methylthioadenosine (MTA) and S-adenosylhomocysteine (SAH) were 19 and 58 lM, respectively. The catalytic efficiency of MTAN for SAH was only 0.004% of the value for MTA, indicating an almost complete substrate preference of MTAN for MTA. The results of autoinducer-2 assay of B. thailandensis and recombinants indicated that LuxS enzyme activity was lacking in Burkholderia species. Instead, AdoHcyase hydrolysed SAH directly to homocysteine and adenosine in the activated methyl cycle. Meanwhile, the Km value of AdoHcyase for SAH was determined to be 40 lM. Sequence analysis revealed that MTAN had much higher diversity than AdoHcyase, which likely contributes to its substrate preference for MTA. Furthermore, the phylogenetic tree of MTAN sequences revealed that LuxS+ bacteria could be discriminated from LuxS bacteria. These results suggested that the substrate preference of MTAN for MTA and SAH degradation pathway evolved with the bacterial-activated methyl cycle.

Introduction The activated methyl cycle is a central metabolic pathway responsible for the methylation of cellular components and the recycling of sulphur-containing amino acids. S-Adenosylmethionine (SAM), synthesized from methionine and adenosine triphosphate, is a methyl group donor in a myriad of biological and biochemical events (Lu, 2000). N-acyl-homoserine lactone (AHL) synthase catalyses the transfer of the amino acid moiety of SAM to an acyl acceptor to produce homoserine lactones in the synthesis of AI-1 molecules with 5′-methylthioadenosine (MTA) as a byproduct of this reaction. MTA is also derived from polyamine biosynthesis, where the nucleoside is produced stoichiometrically with spermidine and spermine. 5′-methylthioadenosine nucleosidase/S-adenosylhomocysteine nucleosidase (MTAN) catalyses the physiologically irreversible hydrolysis of MTA to adenine and ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

5-methylthio-D-ribose (MTR). Adenine is subsequently recycled into the adenine nucleotide pool by the widely distributed adenine phosphoribosyltransferase, while the MTR is subsequently phosphorylated to 5-methylthioD-ribose-1-phosphate (MTR-1-P) and converted into methionine. Meanwhile, more than 40 metabolic reactions involve the transfer of a methyl group from SAM to various substrates generating S-adenosylhomocysteine (SAH) as a byproduct. SAH is converted into homocysteine (Hcy), adenine and 4, 5-dihydroxy-2, 3-pentanedione (DPD) by the sequential action of the MTAN and LuxS enzymes. The byproduct, DPD, can spontaneously cyclize and interact with borate to form at least two different interconvertible molecules described as a universal signal molecule, AI-2. In every case, an AI-2 synthase, which is highly similar to the Vibrio harveyi LuxS protein, is required for its synthesis. AI-1 and AI-2 are two classes of autoinducers synthesized from SAM. FEMS Microbiol Lett 339 (2013) 110–116

111

Substrate preference of 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase

MTA and SAH need to be removed efficiently, as they are potent feedback inhibitors of polyamine biosynthesis and biological methylation, respectively. MTAN catalyses the irreversible cleavage of the glycosidic bond in MTA and SAH and functions at two steps within bacterial pathways related to polyamine biosynthesis: (1) quorum sensing and methylation and (2) purine and methionine salvage reactions (Cornell & Riscoe, 1998). In mammals and some prokaryotes, MTAN does not exist. Two distinct enzymes catabolize MTA and SAH. MTA is converted to 5-methylthioribose-1-phosphate (MTR-1-P) and adenine by MTA phosphorylase (MTAP) (Sekowska et al., 2004). SAH is hydrolysed by adenosylhomocysteinase (AdoHcyase) to produce Hcy and adenosine. Adenosine is then rapidly converted to inosine (I) and adenosine monophosphate (Baric et al., 2004). Blocking MTAN activity is expected to cause the accumulation of MTA, resulting in product inhibition of AHL synthase and reduced AI-1 synthesis. In addition, inhibition of MTAN can directly block the formation of S-ribosylhomocysteine (SRH), the precursor of AI-2 (Gutierrez et al., 2009). Therefore, the inhibition of MTAN is expected to inhibit autoinducers synthesis, polyamine biosynthesis and the salvage pathways for adenine and methionine. Structural analogues of MTA and SAH have been synthesized, which display effective antimicrobial activity both in vitro and in vivo (Singh et al., 2005a, b; Gutierrez et al., 2009). Burkholderia species can be opportunistic or obligate pathogens, causing human, animal and plant diseases. Human Burkholderia infections are usually treated with antibiotics to improve control of the disease and patient survival. Increasing bacterial resistance to antibiotics has become a serious public health problem. Burkholderia thailandensis is a nonfermenting motile gram-negative soil bacterium. It is closely related to Burkholderia pseudomallei and regularly used to model B. pseudomallei because of similarities in the immune response. In this study, we have cloned and characterized MTAN and AdoHcyase from B. thailandensis. Our study represents the first direct enzyme kinetics study of MTAN and AdoHcyase of B. thailandensis, and we compare the activated methyl cycle of B. thailandensis with other species. Exploitation of potential differences in substrate specificity between the Burkholderia and mammalian enzymes represents a promising opportunity for development of selective antimicrobial agents. These data are of importance for further understanding the role of MTAN and AdoHcyase in activated methyl cycle of Burkholderia species and provide an insight into developing new antibiotic design and curative treatment approaches for melioidosis. FEMS Microbiol Lett 339 (2013) 110–116

Materials and methods Bacterial strains and growth conditions

Bacterial strains used in this study are listed in Table 1. Strains of Escherichia coli, B. thailandensis and recombinants were grown in Luria–Bertani (LB) medium with appropriate antibiotics at 37 °C. Antibiotics were added at the following concentrations (per mL): 50 lg kanamycin, 10 lg tetracycline, 100 lg gentamycin for E. coli and 50 lg tetracycline for B. thailandensis. Vibrio harveyi BB170 was cultured at 30 °C in autoinducer bioassay medium for the AI-2 assay (Taga, 2005). Plasmid construction and DNA manipulation

Plasmids and primers used in this study are listed in Tables 1 and 2. DNA manipulations and transformations were performed according to Sambrook (Sambrook & Russell, 2001). To over-express His6-tagged MTAN in E. coli BL21 (DE3), a DNA fragment containing the open reading frame of mtan with the stop codon (BTH_I2631) was amplified by PCR with primers mtan-F-EcoRI and mtan-R-HindIII. The PCR product was digested with EcoRI/HindIII and

Table 1. Bacterial strains and plasmids used in this study Strain

Relevant properties

B. thailandensis E264 Wild-type strain E264Dmtan mtan mutant of E264, Tcr* E264luxS E264 with the plasmid pRKluxS, Tcr E. coli BL21(DE3) hsdS gal (kcIts857 ind-l Sam7 nin-5 lacUV5-T7 gene 1) S17-1 k pir Tpr Smr recA thi pro hsd R M+::RP4:2-Tcr::Mu Kmr::Tn7, k pir V. harveyi BB170 luxN::tn5Kan Plasmids pET28 Prokaryotic expression vector, Kmr* pET-mtan pET28a with the mtan gene pET-ahcY pET28a with the ahcY gene pET-luxS pET28b with the luxS gene pRK415 Broad host range expression vector with lactose-inducible promoter, Tcr pRKluxS pRK415 with the luxS gene

Reference or source

ATCC Unpublished study This study

Novagen

Simon et al. (1983)

Bassler et al. (1997) Novagen This study This study This study Keen et al. (1988) This study

*Km , Tc represent resistance to kanamycin and tetracycline, respectively. r

r

ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

112

Q. Gao et al.

Table 2. Primers used in this study Name

5′–3′ sequence*

mtan-F-EcoRI mtan-R-HindIII achy-F-EcoRI achy-R-HindIII luxS-F-HindIII luxS-R-XhoI luxS-R-XbaI

GGAATTCATGAATCAGCAGACGTCTTTCGACCG CCGCTCGAGTCAAGCCACGCGCGCCTTC GGAATTCATGAACGCCGCTGTCATCG CCCAAGCTTTCAGTAACGATAGTGATCCGGC CCCAAGCTTATGCCGTTGTTAGATAGCTTC CCGCTCGAGCTAGATGTGCAGTTCCTGC GCTCTAGACTAGATGTGCAGTTCCTGC

*Restriction endonuclease sites added for cloning purposes are underlined.

then inserted into the corresponding site of the pET28a vector to create the plasmid pET-mtan. The primers ahcYF-EcoRI/ahcY-R-HindIII and luxS-F-HindIII/luxS-R-XhoI were used to amplify ahcY (BTH_I3165) and luxS (ECBD_1033), respectively. Fragments were inserted into the corresponding digested sites of pET28a and pET28b to produce the plasmids pET-ahcY and pET-luxS. To express the luxS gene in B. thailandensis E264, the luxS gene was amplified with the primers luxS-F-HindIII/ luxS-R-XbaI and cloned into the same digested sites of pRK415 to produce pRKluxS. Phylogenetic analysis of MTAN and AdoHcyase

The cloned ORFs were sequenced, and the corresponding translated protein sequences were submitted to NCBI Conserved Domains Database (CDD) for analysis of the conserved domains. Putative proteins that shared similar functions were selected, and sequences were downloaded from the Kyoto Encyclopaedia of Genes and Genomes (KEGG). All of the sequences were aligned, and phylogenetic trees reconstructed and visualized in MEGA4 software (Tamura et al., 2007). Expression and purification of recombinant proteins

The expression of MTAN, AdoHcyase and LuxS in E. coli BL21 were performed according to Sambrook (Sambrook & Russell, 2001). Recombinant proteins were purified from the supernatant with a His-Bind Resin chromatography kit (Novagen). The protein concentration was determined utilizing a BCA-protein assay kit (Pierce). Expression of LuxS in B. thailandensis E264

Escherichia coli S17-1 cultures containing plasmid pRKluxS and parental B. thailandensis were conjugated using the method described previously (Barrett et al., 2008). A recombinant named E264luxS was screened and confirmed ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

by plasmid identification. E264luxS was grown in LB medium with tetracycline, and LuxS was over-expressed by induction with isopropyl b-D-1-thiogalactopyranoside (IPTG). In vitro autoinducer-2 synthesis and assay

The assay for synthesizing autoinducer-2 in vitro was based upon the report of Chen-Yu Tsao with some modification (Tsao et al., 2011). The cultured cells of B. thailandensis (wild type and recombinants) were harvested by centrifugation, washed twice with ice-cold PBS (pH 7.4) and finally resuspended in 50 mM Tris-HCl (pH 7.8). Cells were disrupted by ultrasonication, and the supernatant was collected and added to 1 mM SAH in 50 mM Tris-HCl (pH 7.8) and incubated at 37 °C for 12 h. In parallel, purified His6-MTAN and His6-LuxS were added as positive controls. The enzymatic reaction product was extracted twice with chloroform and recovered from the aqueous phase. Cell-free supernatants (CFS) of B. thailandensis wild type and recombinant were harvested at various growth stages (early log phase, mid to late log phase, stationary phase). Synthesis of autoinducer-2 and CFS were passed through a 0.22 lm filter unit prior to conducting the assay. Autoinducer-2 production was assayed based on the protocol of Taga (2005). CFS of E. coli was tested as the positive control. Data, reported as fold activation, were obtained by dividing the light produced by the reporter cells after the addition of CFS by the light output from the reporter cells when enzymatic reaction buffer alone was added. Enzymatic assay of recombinant MTAN and AdoHcyase

MTA/SAH hydrolase activity of MTAN was determined by the enzyme-linked spectrophotometric assay (Dunn et al., 1994). A 0.28 units of xanthine oxidase were mixed with 200 lL of 1 mM p-iodonitrotetrazolium violet (INT) dissolved in 100 mM HEPES buffer (pH 7.5). For enzyme kinetics, the concentration of MTA and SAH substrates was varied from 0.625 to 100 lM. Enzyme reactions were initiated with the addition of 10 nM–4 lM MTAN (250 lL final volume). The A470 of the reaction mixture was recorded every 10 min at 25 °C for 1 h using a 96-well plate reader (BioTek). The molar extinction coefficient (e470 = 15 400 M 1 cm 1) was used to measure the conversion of INT to its formazan salt. Enzyme reactions containing similar concentrations of adenine served as the positive control. Reactions lacking the addition of MTAN were used as the negative control. FEMS Microbiol Lett 339 (2013) 110–116

113


SAH hydrolase activity of AdoHcyase was determined according to a method reported previously (Lozada-Ramirez et al., 2008). Enzyme reactions were conducted at 37 °C in 50 mM phosphate buffer (pH 7.6) that contained SAH (0.625–200 lM) and 100 lM 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB). Reactions (final volume 250 lL) were initiated by the addition of 1 lM purified AdoHcyase. AdoHcyase activity was measured every 10 min for 1 h by monitoring the conversion of DTNB to 5-thio-2-nitrobenzoic acid (TNB) at 412 nm (e412 = 13 700 M 1 cm 1) (Ellman et al., 1961). Enzyme reactions containing cysteine or lacking AdoHcyase were used as positive and negative controls, respectively. Reaction conditions were optimized by measuring the effect of pH (4.5–9.5) and temperature (4, 20, 37, 45, 55 °C) on recombinant enzyme activity. For the calculation of enzyme activity in the Synergy HT plate spectrophotometer, the path length was determined to be 0.8 cm. Enzyme assays were performed in triplicate at each experimental condition. The results represent the mean (SD) from three independent experiments.

Data analyses

Data for determining the kinetic constants were fitted to the Michaelis-Menten equation using GRAPHPAD PRISM v.5.0 (GraphPad Software). The Student’s t-test was applied for statistical analysis with SPSS software (version 13) between the groups.

Results Sequence analysis and phylogenetic tree construction

We identified a 789-bp fragment corresponding to a putative mtan gene and a 1422-bp fragment corresponding to a putative ahcY gene based on the complete B. thailandensis E264 genome sequence (Kim et al., 2005). MTAN matched to a multi-domain model belonging to PRK06698 (bifunctional 5′-MTA/SAH nucleosidase/phosphatase), and AdoHcyase matched to a specific hit on cd00401 (SAH hydrolase) from CDD. A consensus tree was generated from the bootstrap replicates using MEGA4 with default parameters. Branches with bootstrap scores of < 50 were collapsed in the tree (Fig. 1). MTAN and AdoHcyase were conserved among different Burkholderia species with 95% homology. The phylogenetic tree of MTAN was subdivided into three subgroups: (1) LuxS+ bacteria (Vibrio cholerae, E. coli, Staphylococcus aureus and Streptococcus pneumoniae), (2) LuxS bacteria (B. thailandensis, B. pseudomallei, Burkholderia mallei, Mycobacterium tuberculosis, Brucella melitensis, Ralstonia pickettii and Pseudogulbenkiania_NH8B) and 3) eukaryotic organisms including plants (Arabidopsis thailana) and protozoa (Tetrahymena thermophila) (Fig. 1a). AdoHcyase was subdivided into three subgroups: (1) LuxS bacteria (Burkholderia spp., pseudogulbenkiania_NH8B, M. tuberculosis, R. pickettii and B. melitensis), (2) plants (Arabidopsis thaliana) and protozoa (T. thermophila and

E. coli(NP_285855.1) 96

(a) 73

V. cholerae(NP_232009) S. aureus(NP_372123) S. pneumoniae(YP_002738160.1) M. tuberculosis(NP_214605.1) R. pickettii(YP_001892427.1)

80

B. thailandensis E264(YP_443146.1)

100

B. mallei ATCC 23344(YP_102656.1)

100 99

B. pseudomallei K96243(YP_108576.1) A. thaliana(NP_195210.2)

100

76

Fig. 1. Phylogenetic tree of MTAN and AdoHcyase. (a) Phylogenetic tree of MTAN. MTAN was subdivided into LuxS+ bacteria, LuxS bacteria and another group including a plant and protozoa. The LuxS+ and LuxS subgroups could be separated according to the phylogenetic relationship. Plants and protozoa were more distant from the bacteria. (b) Phylogenetic tree of AdoHcyase. AdoHcyase was subdivided into three subgroups: LuxS bacteria, plant and protozoa, and animals.

FEMS Microbiol Lett 339 (2013) 110–116

(b)

100

T. thermophila(XP_001012703.1)

B. pseudomallei K96243(YP_109886.1) B. mallei ATCC 23344(YP_104353.1)

95

B. thailandensis E264(YP_443659.1)

100

Pseudogulbenkiania NH8B(YP_004845881.1)

65

R. pickettii(YP_001901206.1) B. melitensis(NP_540946.1) B. loridae(XP_002594232.1) D. rerio(NP_954688.1)

100 99

H. sapiens(NP_000678.1) A. thaliana(NP_189023.1) T. thermophila(XP_001023087.1)

100 99

P. tetraurelia(XP_001423621.1)


114

Q. Gao et al.

Paramecium tetraurelia) and (3) animals (Danio rerio, Homo sapiens and Branchiostoma floridae) (Fig. 1b).

1 lM, the catalytic efficiency of AdoHcyase for SAH was about 188-fold higher than that of MTAN towards SAH.

Cloning, expression and purification of MTAN, AdoHcyase and LuxS

Autoinducer-2 assay of B. thailandensis

MTAN and AdoHcyase of B. thailandensis and LuxS of E. coli were expressed in the recombinant E. coli BL21 strains after induction with IPTG. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) showed purified MTAN, AdoHcyase and LuxS each produced a single protein band with estimated molecular weights of 34, 58 and 26 kD, respectively (Fig. 2a). Enzyme kinetics of MTAN and AdoHcyase from B. thailandensis

Studies were performed to determine the optimal pH and temperature for MTAN activity. The results indicate that the enzyme has similar activity across a broad pH (pH 5–8) and temperature (25–37 °C) range (data not shown). Burkholderia thailandensis MTAN hydrolyses both MTA and SAH, although hydrolytic activity towards SAH is weak. Hydrolysis of MTA required only 10 nM MTAN in the assay (Fig. 2b), while 4 lM MTAN was required to measure SAH hydrolysis (Fig. 2c). All data were fitted utilizing the Michaelis–Menten equation and summarized in Table 3. A kcat/Km ratio of B. thailandensis MTAN was calculated as 9.5 9 104 M 1 s 1 for MTA; and 3.6 for SAH, only 0.004% of the value for MTA. Burkholderia thailandensis AdoHcyase also has hydrolytic activity against SAH (Fig. 2d). The AdoHcyase concentration for SAH was

(a)

(b)

(c)

(d)


CFS collected from cultures at various time points were tested to analyse the amount of AI-2. However, no growth of the reporter strain, V. harveyi, could be detected at the tested CFS concentration of 1%. Some secondary metabolites produced by B. thailandensis might inhibit the growth of V. harveyi (Duerkop et al., 2009). In vitro derived, synthetic AI-2 molecules induced 120-fold more light than V. harveyi BB170, which was comparable to the 372-fold increase in light produced by E. coli. Burkholderia thailandensis E264 and E264Dmtan were negative in the assay. Burkholderia thailandensis E264 with supplementation of LuxS in vivo (E264luxS) and in vitro (E264 + LuxS) gave 260-fold and 162-fold increases in light produced, respectively. Burkholderia thailandensis E264Dmtan with supplementation of LuxS was still negative (Fig. 3).

Discussion In most bacteria, MTANs show dual-substrate specificity for MTA and SAH, while plant MTANs (Lupinus luteus and A. thaliana) exhibit a distinct preference for MTA with little or no activity towards SAH (Guranowski et al., 1981; Siu et al., 2008). The comparison of available A. thaliana MTAN1 and MTAN2 structures (PDB ID: 2H8G/ 3BSF) suggests that a combination of differences in the 5′alkylthio binding region and reduced conformational flexibility in the A. thaliana active site likely contribute to its

Fig. 2. Enzyme dynamics of MTAN and AdoHcyase. (a) SDS-PAGE of purified MTAN, AdoHcyase and LuxS. Lane 1 standard protein marker, lane 2 purified Burkholderia thailandensis MTAN, lane 3 purified Escherichia coli LuxS, lane 4 purified B. thailandensis AdoHcyase. (b) MTAN catalytic activity for MTA. (c) MTAN catalytic activity for SAH. (d) AdoHcyase catalytic activity for SAH. Data represent mean values SD for three replicates.


115


Table 3. Enzyme kinetic constants of MTAN and AdoHcyase Proteins

Substrates

Km (lM)

Vmax (lM min 1)

kcat (s 1)

MTAN

MTA SAH SAH

19 58 40

1.08 0.05 1.63

1.8 2.1 9 10 2.7 9 10

AdoHcyase

Fig. 3. AI-2 assay of Burkholderia thailandensis E264 and E264 derivatives. E264 is the B. thailandensis wild-type, and E264Dmtan is the mtan mutant of B. thailandensis. E264Dmtan + LuxS is E264Dmtan supplemented with purified LuxS. E264 + LuxS was E264 supplemented with purified LuxS in vitro. E264luxS is utilized for LuxS overexpression in B. thailandensis; Escherichia coli is the positive control in the assay. The Y-axis was the bioluminescence induced fold change of the sample with respect to the negative control. Data represent mean values SD from at least six replicates. Three samples (E264Dmtan + LuxS, E264luxS, E. coli) showed significantly higher levels of AI-2 production than the negative control (P < 0.0001).

reduced efficiency in binding substrate analogues with longer 5′-substituents (Siu et al., 2011). Burkholderia thailandensis MTAN showed comparable activity for MTA when compared to other homologous proteins. The catalytic efficiency for MTA was 26-fold less than that of the A. thaliana MTAN1 isoform and 6-fold less than that of the A. thaliana MTAN2 isoform (Siu et al., 2008). However, at high enzyme concentration (4 lM) a small amount of SAH hydrolysis could be measured. MTAN exhibited extremely low activity towards SAH, with only 0.004% catalytic efficiency when compared to MTA, indicating the preference of MTAN for MTA. This result was similar to the A. thaliana MTAN’s substrate preference. Homology modelling analysis suggested that Phe148/ Phe120 of B. thailandensis MTAN probably hinders the divergence in specificity of the enzyme and is responsible for the low activity of MTAN for SAH (data not shown).


kcat/Km (mol 4 2

1

L s 1)

9.5 9 104 3.6 6.8 9 102

Burkholderia thailandensis AdoHcyase activity and catalytic efficiency was lower than the other reports (LozadaRamirez et al., 2008). The probable reason was the recombinant protein did not represent the native protein from B. thailandensis, and specific reasons will require further investigations in the future. The activated methyl cycle in B. thailandensis were confirmed based upon the qualitative AI-2 assay. Although the assay showed that B. thailandensis wild-type (E264) and mutant knockout strains (E264Dmtan and E264Dmtan + LuxS) were negative for AI-2 production, the complementation of LuxS activity in B. thailandensis E264 (E264luxS and E264 + LuxS) yielded strong positive results in the AI-2 assay. This demonstrated that the activated methyl cycle of Burkholderia spp. was in agreement with KEGG (http://www.genome.jp/kegg-bin/show_ pathway?bte00270). Burkholderia thailandensis MTAN (EC 3.2.2.9) could hydrolyse SAH to SRH, while hydrolysis of SRH is blocked due to the absence of LuxS (EC 4.4.1.21). Meanwhile, B. thailandensis AdoHcyase (EC 3.3.1.1) hydrolyses SAH to release Hcy and Adenosine. According to the different activated methyl cycle in bacteria, bacteria could be divided into two groups: LuxS+ and LuxS . Homology analysis of the MTAN sequences and phylogenetic results showed that sequence diversity of MTAN was distinguishable between LuxS and LuxS+ bacteria. We propose that sequence diversity could contribute to the decreased activity of MTANs for SAH. In the methionine metabolism, MTAN and LuxS complete one pathway (LuxS+ bacteria), whereas MTAP and AdoHcyase complete another (mostly mammals, some bacteria). MTAN and AdoHcyase complete the third pathway (LuxS bacteria, protozoa, plants). These results indicated that the substrate preference of MTAN for MTA and SAH degradation pathway evolved with the activated methyl cycle. Escherichia coli and V. cholerae (LuxS+) MTANs showed comparable activity towards substrate MTA and SAH, while B. thailandensis (LuxS ) and A. thaliana MTANs showed obviously substrate preference for MTA. We considered that MTANs of LuxS bacteria probably have different degrees of substrate preference for MTA as is reported for the plant A. thaliana (Siu et al., 2008). MTAN and AdoHcyase play very crucial functions by regulating the autoinducers produced and transmethylation activity in bacterial-activated methyl cycle. Inhibition of MTAN would prevent autoinducer production and block ª 2012 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved

116

quorum sensing, generating novel antimicrobials against pathogenic bacteria (Kamath et al., 2006; Cornell et al., 2009). Insight into the B. thailandensis MTAN three-dimensional structure will give clearer explanation for the substrate preference of MTAN and facilitate drug design against melioidosis.

Acknowledgements This project was supported by a grant (24GFCX-YJ-2306) from the Chinese Academy of Sciences and National S&T Major Project (2012ZX10004403 and 2009ZX09301-14).

References Baric I, Fumic K, Glenn B et al. (2004) S-adenosylhomocysteine hydrolase deficiency in a human: a genetic disorder of methionine metabolism. P Natl Acad Sci USA 101: 4234–4239. Barrett AR, Kang Y, Inamasu KS, Son MS, Vukovich JM & Hoang TT (2008) Genetic tools for allelic replacement in Burkholderia species. Appl Environ Microbiol 74: 4498–4508. Bassler BL, Greenberg EP & Stevens AM (1997) Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi. J Bacteriol 179: 4043–4045. Cornell KA & Riscoe MK (1998) Cloning and expression of Escherichia coli 5′-methylthioadenosine/Sadenosylhomocysteine nucleosidase: identification of the pfs gene product. Biochim Biophys Acta 1396: 8–14. Cornell KA, Primus S, Martinez JA & Parveen N (2009) Assessment of methylthioadenosine/S-adenosylhomocysteine nucleosidases of Borrelia burgdorferi as targets for novel antimicrobials using a novel high-throughput method. J Antimicrob Chemother 63: 1163–1172. Duerkop BA, Varga J, Chandler JR, Peterson SB, Herman JP, Churchill MEA, Parsek MR, Nierman WC & Greenberg EP (2009) Quorum-sensing control of antibiotic synthesis in Burkholderia thailandensis. J Bacteriol 191: 3909–3918. Dunn SM, Bryant JA & Kerr MW (1994) A simple spectrophotometric assay for plant 5′-deoxy5′-methylthioadenosine nucleosidase using xanthine-oxidase as a coupling enzyme. Phytochem Anal 5: 286–290. Ellman GL, Courtney KD, Andres V Jr & Feather-Stone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7: 88–95. Guranowski AB, Chiang PK & Cantoni GL (1981) 5′-Methylthioadenosine nucleosidase. Purification and characterization of the enzyme from Lupinus luteus seeds. Eur J Biochem 114: 293–299. Gutierrez JA, Crowder T, Rinaldo-Matthis A, Ho MC, Almo SC & Schramm VL (2009) Transition state analogs of 5′-methylthioadenosine nucleosidase disrupt quorum sensing. Nat Chem Biol 5: 251–257. Kamath VP, Zhang J, Morris PE Jr & Babu YS (2006) Synthesis of a potent 5′-methylthioadenosine/S-


Q. Gao et al.

adenosylhomocysteine (MTAN) inhibitor. Bioorg Med Chem Lett 16: 2662–2665. Keen NT, Tamaki S, Kobayashi D & Trollinger D (1988) Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 70: 191–197. Kim HS, Schell MA, Yu Y, Ulrich RL, Sarria SH, Nierman WC & DeShazer D (2005) Bacterial genome adaptation to niches: divergence of the potential virulence genes in three Burkholderia species of different survival strategies. BMC Genomics 6: 174. Lozada-Ramirez JD, Martinez-Martinez I, Garcia-Carmona F & Sanchez-Ferrer A (2008) Cloning, overexpression, purification, and characterization of S-adenosylhomocysteine hydrolase from Corynebacterium efficiens YS-314. Biotechnol Prog 24: 120–127. Lu SC (2000) S-Adenosylmethionine. Int J Biochem Cell Biol 32: 391–395. Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sekowska A, Denervaud V, Ashida H, Michoud K, Haas D, Yokota A & Danchin A (2004) Bacterial variations on the methionine salvage pathway. BMC Microbiol 4: 9. Simon R, Priefer U & Puhler A (1983) A broad host range mobilization system for invivo genetic-engineeringtransposon mutagenesis in Gram-negative bacteria. Nat Biotechnol 1: 784–791. Singh V, Lee JE, Nunez S, Howell PL & Schramm VL (2005a) Transition state structure of 5′-methylthioadenosine/Sadenosylhomocysteine nucleosidase from Escherichia coli and its similarity to transition state analogues. Biochemistry 44: 11647–11659. Singh V, Evans GB, Lenz DH et al. (2005b) Femtomolar transition state analogue inhibitors of 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidase from Escherichia coli. J Biol Chem 280: 18265–18273. Siu KK, Lee JE, Sufrin JR, Moffatt BA, McMillan M, Cornell KA, Isom C & Howell PL (2008) Molecular determinants of substrate specificity in plant 5′-methylthioadenosine nucleosidases. J Mol Biol 378: 112–128. Siu KK, Asmus K, Zhang AN, Horvatin C, Li S, Liu T, Moffatt B, Woods VL, Jr. & Howell PL (2011) Mechanism of substrate specificity in 5′-methylthioadenosine/S-adenosylhomocysteine nucleosidases. J Struct Biol 173: 86–98. Taga ME (2005) Methods for analysis of bacterial autoinducer-2 production. Curr Protoc Microbiol Chapter 1: Unit 1C 1. Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599. Tsao CY, Wang L, Hashimoto Y, Yi H, March JC, DeLisa MP, Wood TK, Valdes JJ & Bentley WE (2011) LuxS coexpression enhances yields of recombinant proteins in Escherichia coli in part through posttranscriptional control of GroEL. Appl Environ Microbiol 77: 2141–2152.
