Subtractive hybridization for differential gene expression in ...

Am J Physiol Heart Circ Physiol 291: H2714 –H2722, 2006. First published June 9, 2006; doi:10.1152/ajpheart.00445.2005.

Subtractive hybridization for differential gene expression in mechanically unloaded rat heart Heiko Bugger,1 Stefanie Leippert,1 Daniel Blum,1 Peter Kahle,1 Bernhard Barleon,2 Dieter Marme,2 and Torsten Doenst1 1

Department of Cardiovascular Surgery, Albert-Ludwigs University of Freiburg, and 2Clinic for Tumor Biology, Freiburg, Germany Submitted 3 May 2005; accepted in final form 30 May 2006

Bugger, Heiko, Stefanie Leippert, Daniel Blum, Peter Kahle, Bernhard Barleon, Dieter Marme, and Torsten Doenst. Subtractive hybridization for differential gene expression in mechanically unloaded rat heart. Am J Physiol Heart Circ Physiol 291: H2714 –H2722, 2006. First published June 9, 2006; doi:10.1152/ajpheart.00445.2005.—The objective of this study was to identify differentially expressed genes in the mechanically unloaded rat heart by suppression subtractive hybridization. In male Wistar-Kyoto rats, mechanical unloading was achieved by infrarenal heterotopic heart transplantation. Differentially expressed genes were investigated systematically by suppression subtractive hybridization. Selected targets were validated by Northern blot analysis, real-time RT-PCR, and immunoblot analysis. Maximal ADP-stimulated oxygen consumption (state 3) was measured in isolated mitochondria. Transplantation caused atrophy (heart-to-body weight ratio: 1.6 ⫾ 0.1 vs. 2.4 ⫾ 0.1, P ⬍ 0.001). We selected 1,880 clones from the subtractive hybridization procedure (940 forward and 940 reverse runs assessing up- or downregulation). The first screen verified 465 forward and 140 reverse clones, and the second screen verified 67 forward and 30 reverse clones. On sequencing of 24 forward and 23 reverse clones, 9 forward and 14 reverse homologies to known genes were found. Specifically, we identified reduced mRNA expression of complex I (⫺49%, P ⬍ 0.05) and complex II (⫺61%, P ⬍ 0.001) of the respiratory chain. Significant reductions were also observed on the respiratory chain protein level: ⫺42% for complex I (P ⬍ 0.01), ⫺57% for complex II (P ⬍ 0.05), and ⫺65% for complex IV (P ⬍ 0.05). Consistent with changes in gene and protein expression, state 3 respiration was significantly decreased in isolated mitochondria of atrophied hearts, with glutamate and succinate as substrates: 85 ⫾ 27 vs. 224 ⫾ 32 natoms O 䡠 min⫺1 䡠 mg⫺1 with glutamate (P ⬍ 0.01) and 59 ⫾ 18 vs. 154 ⫾ 30 natoms O 䡠 min⫺1 䡠 mg⫺1 with succinate (P ⬍ 0.05). Subtractive hybridization indicates major changes in overall gene expression by mechanical unloading and specifically identified downregulation of respiratory chain genes. This observation is functionally relevant and provides a mechanism for the regulation of respiratory capacity in response to chronic mechanical unloading. suppression subtractive hybridization; respiratory chain gene; mitochondria MYOCARDIAL ATROPHY HAS NOT been intensely investigated, presumably because it is not usually occurring in living organisms. The advent of left ventricular assist devices (LVADs) has changed this situation. LVADs are clinically used in patients with terminal heart failure as a bridge to transplantation or even destination (24). Studies have shown that, during this waiting time, unloading of failing hearts has beneficial effects on contractile function (8, 12). Implantation of LVADs has also

Address for reprint requests and other correspondence: T. Doenst, Dept. of Cardiovascular Surgery, Univ. of Freiburg, Hugstetter Str. 55, 79106 Freiburg i. Br, Germany (e-mail: doenst@ch11.ukl.uni-freiburg.de). H2714

been shown to increase patient survival until transplantation compared with drug therapy alone (24). In a few patients, cardiac function improved to an extent that transplantation was not necessary and the assist device could be explanted (18, 20). These observations generated a surge of interest in the mechanisms underlying unloading (4, 8, 12, 13). For assessment of the mechanisms underlying recovery of failing hearts during unloading, an understanding of the physiological response to mechanical unloading is imperative. Infrarenal heterotopic heart transplantation has been found to be a convenient animal model for investigation of these mechanisms (9, 22). These hearts show a 20 – 40% reduction of heart weight within 1 wk of unloading (6, 16). We used this model previously to demonstrate changes in isoform gene expression resembling a fetal genotype (6, 10). We now use suppression subtractive hybridization to systematically identify differentially expressed genes (7, 14). Suppression subtractive hybridization is a widely used powerful and highly effective technique for screening for differentially regulated genes (27, 28, 30, 31). With this technique, mRNA is transcribed into cDNA, enriched, and amplified by suppression PCR (7, 14). After suppression subtractive hybridization, PCR products reflecting differentially expressed genes can be separated by cloning and screened for verification of differential expression (7, 27). The verified clones can be sequenced and compared with known gene sequences (7, 27). Finally, the results should be validated by Northern blot analysis or PCR (27, 28). In this study, we have used subtractive hybridization to identify 23 genes that are differentially expressed in the heterotopic transplanted rat heart. Specifically, we identified a significant reduction in mRNA expression of respiratory chain genes that was also apparent on the protein level. These changes were accompanied by decreased respiratory capacity of isolated mitochondria. We suggest that, in response to a chronic decrease in workload, the heart regulates its respiratory capacity mainly via changes in respiratory chain gene expression. METHODS

Animals. Male Wistar-Kyoto rats (275–300 g body wt; Charles River, Sulzfeld, Germany) were fed ad libitum and kept at 21°C with a 12-h:12-h light-dark cycle. The use of animals and the experimental

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

0363-6135/06 $8.00 Copyright © 2006 the American Physiological Society

http://www.ajpheart.org

SUBTRACTIVE HYBRIDIZATION IN UNLOADED HEART

protocol were approved by the Animal Welfare Committee of the University of Freiburg. Materials. Chemicals and kits were obtained from Sigma-Aldrich (Deisenhofen, Germany), Delta-Pharma (Pfullingen, Germany), Merck (Darmstadt, Germany), Serva (Heidelberg, Germany), Essex (Munich, Germany), Amersham Pharmacia Biotech (Freiburg, Germany), Life Technologies (Eggenstein, Germany), Clontech (Heidelberg, Germany), Peqlab (Erlangen, Germany), Pan Biotech (Aidenbach, Germany), Big Biotech (Freiburg, Germany), Applied Biosystems (Darmstadt, Germany), Dianova (Hamburg, Germany), Bayer (Leverkusen, Germany), Narkodorm-n (Neumu¨nster, Germany), Qiagen (Hilden, Germany), Pierce (Rockford, IL), MitoScience (Eugene, OR), and Invitrogen (Groningen, Germany). Surgical protocols. Ventricular unloading for 8 days was achieved by infrarenal heterotopic heart transplantation in rats, as described by Ono and Lindsey (22). The heart was transplanted by end-to-side anastomosis of the ascending aorta of the donor to the abdominal aorta of the recipient and the donor pulmonary artery to the recipient inferior vena cava. The graft beat spontaneously and was perfused through the coronary arteries, but the left ventricle was unloaded. Suppression subtractive hybridization. Total RNA was isolated using the RNeasy Maxi kit (Qiagen). Subtractive hybridization was performed as schematically described in Fig. 1 using the PCR-Select cDNA subtraction kit (Clontech). cDNA was generated from 2 ␮g of poly(A)⫹ mRNA of unloaded and control hearts by reverse transcription. The cDNA under investigation was named tester, and the reference cDNA was named driver. In a forward run control, cDNA was designated tester; in a reverse run, cDNA of unloaded hearts was used as tester to investigate up- and downregulation of mRNA molecules. After digestion with RsaI (1.5 h at 37°C), tester, but not driver, cDNA was divided in two halves and incubated with two different adaptors (nucleotide sequences that bind to the 5⬘ end of the tester molecules) for ligation (overnight incubation with DNA ligase at 16°C). Tester and driver were denatured (1.5 min at 98°C) and rehybridized (8 h at 68°C, 1st hybridization) with excess driver concentration. Abundantly expressed cDNAs rehybridize faster and become enriched as single-strand cDNAs. Both incubations (tester 1 and driver and tester 2 and driver) were merged and undenatured, and denatured driver was again added in excess to further enrich differentially expressed cDNA single strands (incubation overnight at 68°C; 2nd hybridization). Hybridized double-strand cDNA molecules, which are characterized by different adaptors bound to the 3⬘ and 5⬘ end at each strand, were amplified by two serial PCRs with two different primer pairs annealing to the adaptors (PCR1 consisted of 27 cycles for 30 s at 94°C, 30 s at 66°C, and 1.5 min at 72°C; PCR2 consisted of 10 cycles for 30 s at 94°C, 30 s at 68°C, and 1.5 min at 72°C). Rehybridized cDNA molecules with only one or no adaptor at the end were not amplified, and amplification of DNA molecules with equal adaptors at the 3⬘ and 5⬘ ends will be suppressed by preferentially building secondary structures, rather than binding PCR primers. Cloning. cDNA PCR products were incubated with DNA ligase and linear plasmids for ligation of the cDNAs to the 3⬘ end. Ligated plasmids (2 ␮l) were incubated with competent bacteria for 30 min at 4°C and heated for 30 s at 42°C. Bacterial medium (250 ␮l) was added, and the mixture was incubated for 30 min at 37°C. Bacteria were placed on ampicillin-containing agar plates for single colony growth. Only bacteria with plasmids were ampicillin resistant and able to grow. To differentiate bacteria with plasmids with or without ligated PCR products, colonies were stained (blue/white) with 5bromo-4-chloro-3-indolyl-␤-D-galactopyranoside (X-Gal). Single colonies were transferred to 96-well PCR plates and lysed by heating (10 min at 99°C), and colony PCR was performed to amplify plasmid DNA inserts (3 min at 94°C, 30 cycles for 30 s at 94°C, 30 s at 50°C, 1 min at 72°C, and 10 min at 72°C). Gel electrophoresis and blotting. PCR products were verified by 1% agarose gel electrophoresis. For “reverse Northern blot analysis” PCR products were transferred on a membrane by spot blotting and AJP-Heart Circ Physiol • VOL

H2715

Fig. 1. Overview of all steps of the subtractive hybridization procedure and suppression PCR. ds, Double-strand.

blotting of separated PCR products on a high-density gel. For spot blotting, 30 ␮l of each PCR product were diluted by addition of 120 ␮l of H2O, and 60 ␮l of each diluted PCR product were transferred to a well of a 96-well plate of a vacuum blotting apparatus for transfer on a nylon membrane. PCR products were separated by high-density gel electrophoresis on a 2% agarose gel (45 mM Tris base, 45 mM boric acid, 1.25 mM EDTA, and ethidium bromide, pH 7.5) using 5⫻ sample buffer in a 1⫻ final concentration (5⫻ ⫽ 15% Ficoll, 50 mM EDTA, 0.05% bromphenol blue, and 0.05% xylene-cyanole in 45 mM Tris base-45 mM boric acid-1.25 mM EDTA). The gel was denatured (twice for 10 min each in 1.5 M NaCl and 0.5 M NaOH) and neutralized (twice for 10 min each in 1.5 M NaCl and 0.5 M Tris base, pH 7.0), and PCR products were transferred on a nylon membrane overnight using 20⫻ saline-sodium citrate (SSC) buffer (3 M NaCl, 300 mM sodium citrate, pH 7.0) and fixed on the membrane at 80°C for 2 h.

291 • DECEMBER 2006 •

www.ajpheart.org

H2716


Screening. For effective reduction of false-positive results, two screenings were performed: a spot-blot screen followed by a highdensity gel screen. Only markedly differentially expressed genes on spot-blot membranes were separated on a gel for a second screen. Blotted PCR products (spot-blot or high-density gel) of single clones were hybridized with radioactively labeled probes from total tissue RNA from unloaded or control hearts. Probes were synthesized using the Smart PCR cDNA synthesis kit (Clontech) as described by the manufacturer and labeled using the Megaprime DNA-labeling system (Amersham Pharmacia Biotech). The membranes were prehybridized with denatured salmon sperm in hybridization buffer (2.5% dextran sulfate, 2⫻ SSC buffer, 0.1% SDS, 0.1% sodium pyrophosphate, 2 mM EDTA, 0.2% Ficoll, 0.1% polyvinylpyrrolidone, and 0.2% BSA) for 1– 4 h. For hybridization with the labeled cDNA probes, fresh hybridization buffer was used, and the probes were incubated overnight using denatured labeled probes (5 min, 95°C). Finally, membranes were washed twice in decreasing salt concentrations (2⫻ SSC and 0.5% SDS followed by 0.1⫻ SSC and 0.1% SDS) for 15 min. Differentially expressed genes as identified by the two screenings were sequenced and tested for homologies to known gene sequences in a gene data bank (BCM Search Launcher: Nucleic Acid Sequence Searches). For Northern blot analysis, the cDNAs were used as a probe for hybridization with blotted and fixed total tissue RNA in two different unloaded hearts to confirm actual differential mRNA expression, as described by von Stein et al. (27). Figure 2 shows an overview of suppression subtractive hybridization and subsequent screening and analysis of differentially expressed genes. Real-time RT-PCR. Total cardiac muscle RNA was isolated from frozen tissue samples using the Qiagen RNeasy midi kit. Complementary DNA was synthesized using MultiScribe reverse transcriptase (Applied Biosystems). Real-time PCR was performed using the TaqMan fluorometric technique (ABI Prism, Perkin Elmer). Primers and probes were designed using Primer Express 1.3 software (Table 1). For each set of primers, basic local alignment search tool (BLAST) revealed that sequence homology was obtained only for the target gene. Consecutive agarose gel electrophoresis was performed for each

Fig. 2. Overview of subtractive hybridization and subsequent screening and analysis of differentially expressed genes. AJP-Heart Circ Physiol • VOL

Table 1. Primer and probe sequences used in quantitative PCR Sequence (5⬘-3⬘)

NADH-DH subunit 2 Forward Reverse Probe SUC-DH subunit b Forward Reverse Probe COX IV Forward Reverse Probe Histone 3B Forward Reverse Probe

Accession No.

CTATCATCCCACTTCTAGCCAACA GGCTGTAGCTTGGGTTAGAAAATATT AGCCCACGATCAACTGAAGCAGCAA

X14848

CCAAGGGTCTGAATCCAGGAA TCTCCTTGTAGGTCGCCATCA CAATTGCAGAAATCAA

XM_216558

GCCTTTCCAGGGATGAGAAAG TCTCAGCGAAGCTCTCGTTAAA CCAATTGTACCGCATCC

X15029

GGAGGCAAGTGAGGCCTATCT TGTCACTGACCTGATGCTCTAATG CATCTTCAAAAGGCCAA

BC087725

NADH-DH, NADH dehydrogenase; SUC-DH, succinate dehydrogenase; COX IV, cytochrome c oxidase subunit IV.

PCR to ensure specificity of amplification. Standard curves were measured using cDNA from control hearts, and results were calculated using the standard curve method (User Bulletin No. 2, Applied Biosystems). Target gene expression was normalized to histone 3B transcription as a housekeeping gene product, which was not different among the samples. Immunoblot analysis. Rat hearts were excised, frozen in liquid nitrogen, reduced to powder in liquid nitrogen, and homogenized in a Potter-Elvejhem glass homogenizer containing homogenization buffer (10 mM NaCl, 25 mM NaF, 15 mM Na4P2O7, 1 mM EDTA, 2 mM Na3VO4, 0.44 mM PMSF, 1% Triton X-100, 1 tablet of Complete Inhibitor Mix, and 20 mM Tris, pH 7.5). The homogenates were incubated on ice for 15 min and centrifuged at 600 g for 10 min. The resulting supernatant was solubilized in Laemmli buffer and run on a 10% acrylamide gel. Primary antibody incubations were performed in 3% nonfat dry milk in 0.1% Tween 20-containing TBS. The following primary antibodies were used: complex I (1:1,000 dilution; MitoScience), complex II (1:1,000 dilution; MitoScience), and complex IV (1:250 dilution; Invitrogen). Secondary antibodies (goat anti-mouse IgG) were diluted 1:40,000. Visualization was performed using an enhanced chemiluminescence system (Pierce). Subsequent Coomassie blue staining was used to assess protein loading. Tissue homogenization. Rats were anesthetized with an injection of pentobarbital sodium (50 mg/kg ip). Hearts were quickly excised and transferred to ice-cold cardioplegic solution containing 0.18 M KCl and 10 mM Tris 䡠 HCl, pH 7.4. The hearts were finely minced. One gram of tissue was added to 6 ml of KEA isolation medium (0.18 M KCl, 10 mM EDTA, and 0.5% BSA). The mixture was homogenized with an Ultra-Turrax T25 at 8,750 rpm for 20 s followed by one downpass in a Potter-Elvejhem glass homogenizer by a motor-driven Teflon pestle at 2,000 rpm. The pH was adjusted to 7.4. All steps were carried out at 4°C. Isolation of mitochondria. Mitochondria were isolated by a modification of the procedure described by Tomec and Hoppel (26) in which 3 ml of whole heart homogenate were centrifuged at 750 g for 10 min. The pellet was treated with nagarse (5 mg/g wet wt) for 30 s and centrifuged at 7,000 g for 5 min. The resulting pellet was resuspended with KEA isolation medium and centrifuged at 700 g for 10 min. The pellet was resuspended and spun down three times at 7,000 g for 10 min. The last pellet was diluted with 500 ␮l of KEA isolation medium. All steps were carried out at 4°C. Protein concen-

291 • DECEMBER 2006 •

www.ajpheart.org


H2717

trations were measured by the bicinchoninic acid protein assay (BioRad), with BSA as standard. Citrate synthase activity. Citrate synthase (CS) serves as a mitochondrial marker enzyme (2). Total and free CS activities were measured and used to calculate latent CS activity (CStotal ⫺ CSfree), which is the fraction of total CS activity that is contained within the mitochondria and not readily accessible by substrate. The CS ratio (CSR) represents the relation of latent to free CS activity and serves as an index of structural integrity of the mitochondrial preparation (2). CS activity was determined at 25°C using a modification of the procedure of Srere (25). Total CS activity was determined by preincubation of samples with 2.5% Triton X-100, and free CS activity was measured after preincubation in 0.9% NaCl. Mitochondrial respiration. Oxygen consumption of isolated mitochondria was measured at 25°C with a Clark-type oxygen electrode fitted to a 1-ml water-jacketed reaction chamber (1). Mitochondrial preparations were added to respiration medium (210 mM mannitol, 70 mM sucrose, 5 mM KH2PO4, and 10 mM Tris 䡠 HCl, pH 7.4) to a final concentration of 1 U CS/ml in the reaction chamber. With glutamate or succinate as a substrate (10 mM), maximal oxygen consumption (state 3 respiration) was stimulated by addition of 20 ␮l of 1 mM ADP. State 4 respiration was measured as the rate of oxygen consumption after total phosphorylation of added ADP. The respiratory control ratio was calculated as the ratio of state 3 to state 4 respiration, as defined by Chance and Williams (1). The ADP-to-O ratio was calculated as described by Estabrook (11). Statistical analysis. Values are means ⫾ SE. Data were analyzed using Student’s t-test. Differences among groups were considered statistically significant at P ⬍ 0.05. RESULTS

Effects of mechanical unloading on cardiac mass. Hearts were explanted from donor rats, transplanted into the abdomen of recipient rats (see METHODS), and excised for experiments after 8 days of unloading. As shown in Table 2, heart weights were significantly reduced after 8 days of unloading (recipient rat), indicating significant heart atrophy. Hearts from nonoperated animals were used for comparison and are referred to as controls. Screening for differentially expressed genes. Screening for differential expression of subtracted clones from the forward run on spot-blot membranes is shown in Fig. 3. The subtracted clones were blotted on two different membranes with equal loading and distribution of samples. In an identical manner, screening for differential expression of subtracted clones from the reverse run was performed to reveal upregulated gene expression. Procedure for selection and identification of differentially expressed genes. Table 3 shows the numbers of clones used from subtractive hybridization for the screening procedures and the following identification and verification of differentially expressed genes. On the first screen, investigation of 940 arbitrarily selected single colonies of forward and reverse runs on spot-blot membranes revealed markedly increased signals Table 2. Body and heart weights of donor and recipient rats, after 8 days of unloading

Body wt, g Heart wt, mg

Donor Rat

Recipient Rat

297⫾16 1.25⫾0.05

286⫾15 0.48⫾0.05*

Values are means ⫾ SE. *P ⬍ 0.001 vs. donor rat. AJP-Heart Circ Physiol • VOL

Fig. 3. Verification of differentially expressed subtracted clones by spot blotting of clones from the forward run with radioactive markers and comparison of signals on the X-ray screen. Subtracted clones were blotted on 2 different membranes (A and B), with equal loading and distribution of samples. Signals of single clones after hybridization with labeled probes from atrophied hearts (A) are compared with signals of single clones after hybridization with labeled probes from control hearts (B). Arrows, clones demonstrating less signal in atrophied than in control hearts, which indicates downregulation.

of 465 colonies of the forward run and 140 colonies of the reverse run. On the second screen, cDNAs were separated by gel electrophoresis before blotting to exclude contaminations producing additional signals (not shown). The second screen confirmed 67 of 236 tested clones of the forward run and 30 of 140 tested clones of the reverse run. Twenty-four clones of the forward and 23 clones of the reverse run displaying marked differences between atrophied and control cDNA were arbitrarily selected for sequencing and analyzed for homologies to known genes in a gene data bank (BCM Search Launcher: Nucleic Acid Sequence Searches). Sequence analysis revealed homologies to known genes for 9 forward and 14 reverse subtracted clones. Identified and verified differentially expressed genes. Table 4 shows upregulated and downregulated genes of atrophied hearts as identified by subtractive hybridization. Four genes of the forward run and five genes of the reverse run were arbi-

291 • DECEMBER 2006 •

www.ajpheart.org

H2718


Table 3. Clones selected for verification by two screens, identification of homologies to known genes, and verification by Northern blot analysis Subtracted Clones Forward run

Reverse run

Clones 1st screen No. selected No. positive 2nd screen No. selected No. positive No. sequenced

940 465

940 140

236 67 24

140 30 23 Genes

No. No. No. No.

with homologeous sequences known unknown verified by Northern blot analysis

10 9 1 4

14 14 0 5

was significantly decreased in homogenates of atrophied hearts. Maximal oxygen consumption was also markedly reduced in isolated mitochondria of atrophied hearts with both substrates. This reduction could be a consequence of the reduced CS activity that we observed in these hearts. We therefore related state 3 respiration to CS activity. State 3 respiration was still markedly reduced in isolated mitochondria of atrophied hearts. The respiratory control ratio, which is the ratio of state 3 to state 4 respiration, was significantly reduced in isolated mitochondria of atrophied hearts when glutamate was used as substrate (3.5 ⫾ 0.7 vs. 6.2 ⫾ 0.9 for atrophy vs. control, P ⬍ 0.05) but was not different when succinate was used as substrate. The ADP-to-O ratio, which is an indirect measure of coupling of oxygen consumption to ATP production, was not different in isolated mitochondria from atrophied hearts with glutamate (2.0 ⫾ 0.4 vs. 2.0 ⫾ 0.1 for atrophy vs. control, not significant) or succinate (1.4 ⫾ 0.2 vs. 1.5 ⫾ 0.1 for atrophy vs. control, not significant) as substrate. DISCUSSION

trarily selected for verification by Northern blot analysis in two additional unloaded hearts. Figure 4 shows representative Northern blot analysis for each of the selected genes, confirming the differential expression in atrophied hearts as found by subtractive hybridization. Expression of respiratory chain genes in atrophied hearts. Using subtractive hybridization, we identified differences in the expression of respiratory chain genes. For further confirmation and accurate quantification, we investigated the mRNA expression of NADH dehydrogenase subunit 2 and cytochrome c oxidase subunit IV by RT-PCR. We found a 49% reduction of complex I mRNA content and a trend toward reduced expression of complex IV mRNA (⫺35%; Fig. 5). In addition, we investigated the expression of succinate dehydrogenase subunit b mRNA, which was reduced by 61% in atrophied hearts. Expression of respiratory chain proteins in atrophied hearts. We also investigated protein expression of complexes I, II, and IV in atrophied hearts. As demonstrated in Fig. 6, protein levels of each of the complexes were significantly reduced in unloaded hearts: ⫺42% for complex I, ⫺57% for complex II, and ⫺65% for complex IV. Mitochondrial respiratory function of atrophied hearts and CS activity. To determine whether the identified changes in respiratory chain gene and protein expression are accompanied by functional changes, we isolated mitochondria and assessed their respiratory activity. We used CS activity to characterize the isolated mitochondria and their structural integrity. Table 5 shows total, free, and latent CS activity and CSR (i.e., ratio of latent to free CS) of whole heart homogenates and isolated mitochondria of atrophied and control hearts. Total CS activity was significantly decreased in homogenates and isolated mitochondria of atrophied hearts compared with controls. Mean values of CSR, an index of structural integrity, were 15.2–17.1, which indicate a high degree of structural integrity in isolated mitochondria of atrophied and control hearts (93.5–94% of the total CS activity was latent CS activity). State 3 respiration of whole heart homogenates and isolated mitochondria of atrophied and control hearts is shown in Fig. 7. With glutamate and succinate as substrate, state 3 respiration AJP-Heart Circ Physiol • VOL

We have demonstrated that suppression subtractive hybridization indicates major changes in overall gene expression by mechanical unloading and specifically identifies downregulation of respiratory chain genes. This observation is functionally relevant and provides a mechanism for the regulation of respiratory capacity in response to chronic mechanical unloading. Mechanical unloading of the heart results in changes of gene expression (5). We previously demonstrated a switch in iso-

Table 4. Genes identified by subtractive hybridization as differentially expressed in unloaded rat hearts Gene

Accession No.

Decreased expression NADH-DH subunit 2* COX subunit 1* Acetyl-CoA synthetase* Myoglobin* Hb ␤-chain complex Voltage-dependent anion channel 3 Myomegalin Cis-golgi p28 PAC clone RP4-691F11 Guanine nucleotide-releasing protein (mss4)

NC_001665 NC_001665 NM_019811 NM_021588 NM_033234 NM_031355 NM_022382 NM_053584 AC004859 NM_001007678

Increased expression HSP70* MHC class I heavy chain* MHC class II ␣-chain* ␤2-Microglobulin* Lysozyme* Ubiquitin C ␣-Tubulin 2 Vimentin Cytoplasmic ␤-actin Cytoplasmic ␥-actin Thymosin ␤-4 Ribosomal protein S4 Eefla1 STAT1

NM_024351 NM_001008839 NM_011008847 NM_012512 NM_012771 NM_017314 XM_576339 NM_031140 NM_031144 XM_213540 NM_031136 NM_001007600 NM_175838 NM_032612

HSP70, 70-kDa heat shock proteins; MHC, major histocompatibility complex; Eef1a1, eukaryotic translation elongation factor 1␣1; STAT1, signal transducer and activator of transcription 1. * Genes confirmed by Northern blot analysis (Fig. 4).

291 • DECEMBER 2006 •

www.ajpheart.org


H2719

Fig. 4. Representative Northern blot analyses of selected genes that were found to be differentially expressed in unloaded hearts by subtractive hybridization (see Table 4). A, atrophy; C, control. Top blots: target gene expression. Bottom blots: 28S rRNA expression as a loading control. MHC, major histocompatibility complex.

Fig. 5. Real-time RT-PCR determination of mRNA expression of NADH dehydrogenase (NADH-DH) subunit 2, succinate dehydrogenase (SUC-DH) subunit b and cytochrome c oxidase IV (COX IV) of control and atrophied hearts (n ⫽ 4). *P ⬍ 0.05; ***P ⬍ 0.001 vs. control. AJP-Heart Circ Physiol • VOL

form gene expression of several proteins of unloaded hearts, leading to the hypothesis of reactivation of a fetal gene expression pattern (6). Other reports showed downregulation of mRNA expression of several different genes, including mRNA for main regulators, enzymes, and proteins of myocardial substrate metabolism [e.g., peroxisome proliferator-activated receptor-␣ (PPAR␣) and uncoupling proteins-2 and -3] (32). We now set out to systematically identify differentially expressed genes after mechanical unloading of the heart by suppression subtractive hybridization. This method allows a highly effective and simultaneous identification of downregulated and upregulated genes by normalization during the subtraction process (i.e., forward or reverse subtraction) (27, 28). A two-step screening substantially limited a possible isolation of false-positive clones (27). A total of 1,880 clones were tested for differential gene expression. Of the selected genes for analysis, we found 10 to be downregulated and 14 to be upregulated in the mechanically unloaded rat heart. We verified 9 of these 24 genes by Northern blot analysis, and all 9 genes could be confirmed to be differentially expressed. A disadvantage of the procedure is that the homologies of the differentially expressed sequences to known genes never

291 • DECEMBER 2006 •

www.ajpheart.org

H2720


Fig. 6. Representative immunoblots showing protein levels of complex I, II, and IV of control and atrophied hearts. Densitometric analysis of blots was normalized to Coomassie blue-stained total protein (n ⫽ 4). *P ⬍ 0.05; **P ⬍ 0.01 vs. control.

reach 100% because of species differences. Another shortcoming is the relatively laborious method used to select and verify clones through the screening process. This drawback has been overcome recently by the development of microarray analysis, which is now able to screen for differentially expressed genes in the entire genome (21). However, despite major advances in this technology in recent years, the difficulties derived from the myriad of potential sources of random and systematic measurement error in the microarray process and from the small Table 5. Total, free, and latent CS activity and CS ratio of whole heart homogenate and isolated mitochondria of control and unloaded hearts Control Hearts

Unloaded Hearts

Whole heart homogenate CS activity, wet wt Total Latent Free CS ratio

120⫾4 97⫾5 23⫾1 4.3⫾0.4

86⫾11* 63⫾8† 22⫾4 3.0⫾0.4*

Isolated mitochondria CS activity, U/ml Total Latent Free CS ratio Protein content, mg/ml CS total/protein, U/mg

17.5⫾2.0 16.5⫾1.8 1.0⫾0.2 17.1⫾2.5 9.7⫾0.7 1.8⫾0.1

11.2⫾2.6* 10.5⫾2.4* 0.7⫾0.1 15.2⫾1.2 7.8⫾0.5* 1.4⫾0.3

Values are means ⫾ SE (n ⫽ 5). CS, citrate synthase. *P ⬍ 0.05; †P ⬍ 0.01 vs. control hearts. AJP-Heart Circ Physiol • VOL

number of samples relative to the large number of variables (probes) complicate data analysis and interpretation and can jeopardize the validity of microarray findings (19, 21). Our approach appears highly reliable, because we could verify all genes by Northern blot analysis identified as differentially expressed by suppression subtractive hybridization. The results support the notion that suppression subtractive hybridization with two-step screening is a powerful procedure for effective screening for differentially expressed genes. We have demonstrated reduced mRNA expression of respiratory chain genes. In addition, we found reduced respiratory chain protein levels. To test the functional relevance of these changes, we determined state 3 respiration of isolated mitochondria from unloaded hearts. Indeed, we found that state 3 respiration of isolated mitochondria of unloaded hearts was significantly decreased with the NADH-linked substrate glutamate and the FADH-linked substrate succinate. State 3 is a measure of maximal respiratory activity of mitochondria under conditions of substrate saturation and stimulation by ADP. Under these conditions, the respiratory chain enzymes are thought to perform maximal catalytic activity. If this is true, changes in state 3 respiration are determined by changes in respiratory chain protein levels. Indeed, we found that reduced state 3 respiration is accompanied by reduced protein expression. Although we have not determined the catalytic activity of single respiratory chain enzymes, we suggest that the downregulation of these enzymes may be responsible for the reduced state 3 respiration of isolated mitochondria of unloaded hearts. CS is a mitochondrial marker enzyme and, therefore, may reflect the amount of mitochondrial material in a mitochondrial

291 • DECEMBER 2006 •

www.ajpheart.org

H2721


Fig. 7. State 3 respiration of whole heart homogenate (A) and isolated mitochondria (B) and related to citrate synthase activity in isolated mitochondria (C) of control and atrophied hearts with glutamate (solid bars) or succinate (hatched bars) as a substrate (n ⫽ 5). *P ⬍ 0.05, **P ⬍ 0.01, ***P ⬍ 0.001; all vs. control.

preparation (2). We found that total CS activity is significantly reduced in homogenates and mitochondrial isolates of atrophied hearts. Although the results suggest that mitochondrial material is reduced in homogenates and isolated mitochondria of atrophied hearts, they do not allow us to distinguish whether the number of mitochondria is reduced and the individual mitochondrion is normal or whether all mitochondria contain less enzyme. We related CS activity to the protein content in isolated mitochondria (Table 5). The finding that the ratio was not different between the groups supports a reduction in mitochondrial number and/or volume, instead of a mitochondriaspecific downregulation of CS activity. We did not perform electron microscopic studies, which may address this issue. The reduction in CS activity may contribute to the decreased state 3 respiration. CS is a tricarboxylic acid (TCA) cycle enzyme, and both substrates used in this study are fed into the TCA cycle (glutamate) or directly converted by a TCA cycle enzyme (succinate). A reduction in TCA cycle flux may decrease state 3 respiration by limiting NADH- or FADHlinked electron transfer to the respiratory chain. To assess the contribution of the decrease in CS activity to the reduction in state 3 respiration, we related state 3 respiration to CS activity. Because state 3 respiration was still reduced by 50% with both substrates, this mechanism may be less important. The reduction in respiratory chain protein expression in response to mechanical unloading is not reduced to a single enzyme but instead involves several complexes of the respiratory chain. Also, NADH- and FADH-linked respiratory activity were reduced in mitochondria of unloaded hearts to exactly the same extent. This might suggest an adaptation via a AJP-Heart Circ Physiol • VOL

mechanism that is able to regulate components of the respiratory chain in a rather comprehensive way. In this respect, we identified a significant downregulation of PPAR␣ coactivator-1␣ (PGC-1␣; unpublished observations). PGC-1␣ is a transcriptional coactivator that is able to coactivate and/or induce the expression of nuclear respiratory factors, thereby increasing their activity and ability to increase gene expression (29). Nuclear respiratory factor recognition sites have been identified on several respiratory chain gene promoters (15). Therefore, it is tempting to speculate that the adaptive changes in respiratory chain gene and protein expression in response to a reduction in myocardial workload may involve the PGC-1␣ signaling cascade. As mentioned above, we observed no change in the CS-toprotein ratio in mitochondria of unloaded hearts, despite reduced CS activity in these hearts, suggesting that mitochondrial number and/or volume may be reduced. This result is consistent with the reduced expression of PGC-1␣ in atrophied hearts. PGC-1␣ can activate the full program of mitochondrial biogenesis, and PGC-1␣ expression in the heart is sharply increased at the time of birth (17, 23, 29). Thus mechanical unloading may also lead to a reduction in mitochondrial biogenesis, potentially mediated via reduced expression of PGC-1␣ in these hearts. Irrespective of the exact cause of the downregulation of respiratory capacity, the results may have practical relevance in the context of reloading an unloaded ventricle. It is conceivable that the sudden reloading of mechanically unloaded ventricles (as in mechanical failure of assist devices or reloading without a weaning period) cannot be met by appropriate increases in

291 • DECEMBER 2006 •

www.ajpheart.org

H2722


ATP production, because the respiratory gene machinery is not adequately expressed. Although we do not know whether the heart may manage such situations by increasing the coupling of ATP production to oxygen consumption (e.g., by reducing uncoupling protein activity), the unchanged ADP-to-O ratios in unloaded hearts in this study may argue against it. Further studies are necessary to address this issue as well as the impact of mechanical unloading on gene expression and function of failing hearts. In conclusion, we have shown that subtractive hybridization indicates major changes in overall gene expression by mechanical unloading and specifically identifies downregulation of respiratory chain genes. We suggest that, in response to a chronic decrease in workload, the heart regulates its respiratory capacity mainly via changes in respiratory chain gene expression. ACKNOWLEDGMENTS We thank Carole Cu¨rten for editorial assistance. GRANTS T. Doenst was supported by grants from the German Research Foundation (Deutsche Forschungsgemeinschaft, Emmy Noether-Program Do602/2 and Do602/3). REFERENCES 1. Chance B and Williams G. The respiratory chain and oxidative phosphorylation. Adv Enzymol 17: 65–154, 1956. 2. Chemnitius JM, Ha¨fner P, Kreuzer H, and Zech R. Latent and free citrate synthase activity as enzymatic indicators for respiratory potential of isolated porcine heart mitochondria. J Appl Cardiol 3: 301–310, 1988. 3. Colavecchia M, Christie LN, Kanwar YS, and Hood DA. Functional consequences of thyroid hormone-induced changes in the mitochondrial protein import pathway. Am J Physiol Endocrinol Metab 284: E29 –E35, 2003. 4. Dasse K, Frazier O, Lesniak J, Myers T, Burnett C, and Poirier V. Clinical responses to ventricular assistance versus transplantation in a series of bridge to transplant patients. ASAIO J 38: M622–M626, 1992. 5. Depre C, Davies PJA, and Taegtmeyer H. Transcriptional adaptation of the heart to mechanical unloading. Am J Cardiol 83: 58H– 63H, 1999. 6. Depre C, Shipley GL, Chen W, Han Q, Doenst T, Moore ML, Stepkowski S, Davies PJA, and Taegtmeyer H. Unloaded heart in vivo replicates fetal gene expression of cardiac hypertrophy. Nat Med 4: 1269 –1275, 1998. 7. Diatchenko L, Lau YC, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, and Siebert PD. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93: 6025– 6030, 1996. 8. Dipla K, Mattiello JA, Jeevanandam V, Houser SR, and Margulies KB. Myocyte recovery after mechanical circulatory support in humans with end-stage heart failure. Circulation 97: 2316 –2322, 1998. 9. Doenst T, Schlensak C, Kobba JL, and Beyersdorf F. A technique of heterotopic, infrarenal heart transplantation with double anastomosis in mice. J Heart Lung Transplant 20: 762–765, 2001. 10. Doenst T, Goodwin GW, Cedars AM, Wang M, Stepkowski S, and Taegtmeyer H. Load-induced changes in vivo alter substrate fluxes and insulin responsiveness of rat heart in vitro. Metabolism 50: 1083–1090, 2001. 11. Estabrook R. Mitochondrial respiratory control and the polarographic measurement of ADP:O ratios. Methods Enzymol 10: 41– 47, 1967. 12. Frazier OH, Benedict CR, Radovancevic B, Bick RJ, Capek P, Springer WE, Macris MP, Delgado R, and Buja LM. Improved left ventricular function after chronic left ventricular unloading. Ann Thorac Surg 62: 675– 682, 1996.

AJP-Heart Circ Physiol • VOL

13. Frazier OH, Rose EA, McCarthy P, Burton NA, Tector A, Levin H, Kayne HL, Poirier VL, and Dasse KA. Improved mortality and rehabilitation of transplant candidates treated with a long-term implantable left ventricular assist system. Ann Surg 222: 327–338, 1995. 14. Gurskaya NG, Diatchenko L, Chenchik A, Siebert PD, Khaspekov GL, Lukyanov KA, Vagner LL, Ermolaeva OD, Lukyanov SA, and Sverdlov ED. Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate. Anal Biochem 240: 90 –97, 1996. 15. Kelly DP and Scarpulla RC. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev 18: 357–368, 2004. 16. Klein I, Hong C, and Schreiber SS. Isovolumic loading prevents atrophy of the heterotopically transplanted rat heart. Circ Res 69: 1421–1425, 1991. 17. Lehman JJ, Barger PM, Kovacs A, Saffitz JE, Medeiros DM, and Kelly DP. Peroxisome proliferators-activated receptor-␥ coactivator-1 promotes cardiac mitochondrial biogenesis. J Clin Invest 106: 847– 856, 2000. 18. Mancini DM, Beniaminovitz A, Levin H, Catanese K, Flannery M, DiTullio M, Savin S, Cordisco ME, Rose E, and Oz M. Low incidence of myocardial recovery after left ventricular assist device implantation in patients with chronic heart failure. Circulation 98: 2383–2389, 1998. 19. Miller RA, Galecki A, and Shmookler-Reis RJ. Interpretation, design, and analysis of gene array expression experiments. J Gerontol A Biol Sci Med Sci 56: B52–B57, 2001. 20. Mu¨ller J, Wallukat G, Weng Y, Dandel M, Spiegelsberger S, Semrau S, Brandes K, Theodoridis V, Loebe M, Meyer R, and Hetzer R. Weaning from mechanical cardiac support in patients with idiopathic dilated cardiomyopathy. Circulation 96: 542–549, 1997. 21. Napoli C, Lerman LO, Sica V, Lerman A, Tajana G, and de Nigris F. Microarray analysis: a novel research tool for cardiovascular scientists and physicians. Heart 89: 597– 604, 2003. 22. Ono K and Lindsey ES. Improved technique of heart transplantation in rats. J Thorac Cardiovasc Surg 57: 225–229, 1969. 23. Puigserver P, Wu Z, Park CW, Graves R, Wright M, and Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92: 829 – 839, 1998. 24. Rose EA, Gelijns AC, Moskowitz AJ, Heitjan DF, Stevenson LW, Dembitsky W, Long JW, Ascheim DD, Tierney AR, Levitan RG, Watson JT, Meier P, Ronan NS, Shapiro PA, Lazar RM, Miller LW, Gupta L, Frazier OH, Desvigne-Nickens P, Oz MC, Poirier VL, and Randomized Evaluation of Mechanical Assistance for the Treatment of Congestive Heart Failure (REMATCH) Study Group. Long-term mechanical left ventricular assistance for end-stage heart failure. N Engl J Med 345: 1435–1443, 2001. 25. Srere P. Citrate synthase. Methods Enzymol 13: 3–11, 1969. 26. Tomec R and Hoppel C. Carnitine palmitoyltransferase in bovine fetal heart mitochondria. Arch Biochem Biophys 170: 716 –723, 1975. 27. Von Stein OD, Thies W, and Hofmann M. A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res 25: 2598 –2602, 1997. 28. Wu WX, Zhang Q, Ma XH, Unno N, and Nathanielsz PW. Suppression subtractive hybridization identified a marked increase in thrombospondin-1 associated with parturition in pregnant sheep myometrium. Endocrinology 140: 2364 –2371, 1999. 29. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, and Spiegelman BM. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98: 115–124, 1999. 30. Yamagishi H, Garg V, Matsuoka R, Thomas T, and Srivastava D. A molecular pathway revealing a genetic basis for human cardiac and craniofacial defects. Science 283: 1158 –1161, 1999. 31. Yokomizo T, Izumi T, Chang K, Takuwa Y, and Shimizu T. A G-protein-coupled receptor for leukotriene B4 that mediates chemotaxis. Nature 387: 620 – 624, 1997. 32. Young ME, Patil S, Ying J, Depre C, Ahuja HS, Shipley GL, Stepkowski SM, Davies PJA, and Taegtmeyer H. Uncoupling protein 3 transcription is regulated by peroxisome proliferator-activated receptor-␣ in the adult rodent heart. FASEB J 15: 833– 845, 2001.

291 • DECEMBER 2006 •

www.ajpheart.org