Subtype B and Subtype C HIV Type 1 Recombinants in the

5449_06_p152-157

2/8/05

10:17 AM

Page 152

AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 21, Number 2, 2005, pp. 152–157 © Mary Ann Liebert, Inc.

Sequence Note Subtype B and Subtype C HIV Type 1 Recombinants in the Northeastern State of Manipur, India SRIKANTH P. TRIPATHY,1 SMITA S. KULKARNI,1 SUSHAMA D. JADHAV,1 KALPANA D. AGNIHOTRI,1 ABHAY J. JERE,1 SWARALI N. KURLE,1 SUJIT K. BHATTACHARYA,2 KHOMDON SINGH,3 SRIRAM P. TRIPATHY,4 and RAMESH S. PARANJAPE1

ABSTRACT The predominant HIV-1 strain circulating in India is subtype C. However, subtype A and B strains of HIV-1 have also been reported in India. In 1999, the first A/C recombinant strain was reported from Pune in India. Intravenous drug users (IVDUs) from the northeastern region of India have a high HIV-1 seroprevalence. Studies carried out in intravenous drug users in the northeastern region of India have shown that HIV-1 subtype C is the predominant strain infecting IVDUs. Fourteen blood samples were collected from HIV-1-infected individuals from the northeastern region of India and screened by env and gag heteroduplex mobility assays (HMA). Where the env and gag HMA results from a sample yielded different subtypes, sequencing of env and gag PCR products was carried out to confirm the presence of HIV-1 recombinants. Of the 14 samples subtyped, nine samples belonged HIV-1 subtype C (gag C/env C), one to HIV-1 subtype B (gag B/env B), and the remaining were B/C recombinants (gag C/env B). This is the first report of HIV-1 B/C recombinants from India.

T

HIV-1 has been reported from many parts of the world, especially the countries in Africa. On the contrary, North America, Europe, and Australia almost exclusively have the subtype B strain of HIV-1 in circulation. The nucleotide sequence analyses have also indicated that about 10–15% of the HIV-1 strains studied are actually intersubtype recombinants.1 Many recombinant viruses have been in circulation and have now been termed circulating recombinant forms (CRF).1–3 The subtype E found in Thailand is now reclassified as CRF01-A/E.2,3 First cases of HIV infection in India were detected in 1986. Since then the epidemic has spread extensively and it is estimated that India now has up to 4.58 million HIV-infected individuals (www.naco.nic.in). The predominant strain of HIV-1 circulating in India is subtype C.4–12 Although the presence of subtypes A and B has been reported in a few patients,4–12 there has been only one report of recombinant virus from India.13 An HE PRESENCE OF MULTIPLE SUBTYPES OF

explosive epidemic driven by intravenous drug use unfolded in the state of Manipur. The state of Manipur is located in the northeastern region of India and is in the vicinity of Myanmar and China. The presence of multiple subtypes has been reported from this region.14 With multiple subtypes present in Manipur, there is the likelihood of recombinant viruses evolving in this region. Blood samples collected from nine HIV seropositive intravenous drug users (IVDUs) and five spouses of HIV-infected persons from the state of Manipur in the northeast region of India were examined for the presence of recombinant HIV-1 viruses. Except for one sample collected in 1999, all other samples were collected in the year 2002. All nine IVDUs were male and all spouses of HIV seropositive individuals were female. The mean age of the IVDUs was 37.5 years (range 27–45 years) and that of the spouses was 33.4 years (range 26–41 years). The blood samples were collected in ethylenediaminetetraacetic

1National

AIDS Research Institute, 73 G Block, MIDC, Bhosari, Pune-411026, India. Institute of Cholera and Enteric Diseases, Beliaghata, Kolkata, India. 3Manipur State AIDS Cell, Manipur, India. 4Indian Council of Medical Research, New Delhi, India. 2National

152

5449_06_p152-157

2/8/05

10:17 AM

Page 153

SUBTYPES B AND C HIV-1 RECOMBINANTS IN MANIPUR acid (EDTA)-containing vacutainer tubes (Becton Dickinson) after obtaining written informed consent and relevant demographic information. The blood samples were transported to the laboratory at NARI within 72 hr, where the lymphocytes were separated by Ficoll-Hypaque gradient centrifugation. HIV virus isolation was carried out with 5 million cells using the lymphocyte cocultivation method using phytohemagglutinin (PHA)stimulated normal uninfected lymphocytes. HIV in the cultures was detected by enzyme-linked immunosorbent assay (ELISA) for p24 antigen in the culture supernatants using a commercial kit (Coulter Corporation, Miami, FL). The DNA extracted from the cocultured lymphocytes using the QIAamp DNA Blood Mini Kit was polymerase chain reaction (PCR) amplified and subjected to the heteroduplex mobility assay (HMA) using the env and gag HMA kits from the NIH AIDS Reference and Reagent Program.

153

For the env HMA, about 1
g of the extracted DNA was used for PCR amplification with primers ED3 (5
TTAGGCATCTCCTATGGCAGGAAGAAGCGG) and ED14 (5
TCTTGCCTGGAGCTG-TTTGATGCCCCAGAC). PCR amplification was carried out in a 100
l reaction containing 1.25 mM MgCl2, a 200
M concentration each of dATP, dCTP, dGTP, and dTTP, 20 pmol of each primer, and 2.5 units of Taq DNA polymerase. The PCR reaction tube was subjected to three cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min and subsequently to 32 cycles of 94°C for 15 sec, 55°C for 45 sec, and 72°C for 1 min, with a final extension for 10 min at 72°C. Five microliters of first-round PCR reaction was further amplified to generate a final 0.7 kb amplified product (V3–V5 region of env) using primers ES7 (5
TGTAAAACGA-CGGCCAGTCTGTTAAATGGCAGTCTAGC) and ES8 (5
CAGGAAACAGCTATGACCCACTTCTCCAATTGTCCCTCAC) using reaction

FIG. 1. Sequence alignment of HIV-1 gag sequences was obtained from samples from the northeastern region of India. Sequences obtained from clones NARIGAG-7-1 to -3, NARIGAG-8-1 to -3, NARIGAG-9-1 to -3, and NARIGAG-10-1 to -3 were aligned using the ClustalX Version 1.81 software. Each of these sets of three clones was obtained from proviral DNA from HIV1 isolates INDNARI-0218437, INDNARI-0218440, INDNARI-0218436, and INDNARI-9917796. A “–” in the consensus represents a deletion in the majority of the sequences analyzed.

5449_06_p152-157

2/8/05

10:17 AM

Page 154

154

TRIPATHY ET AL.

FIG. 2. Sequence alignment of HIV-1 env sequences was obtained from samples from the northeastern region of India. Sequences obtained from clones NARIENV-7-1 to -3, NARIENV-8-1 to -3, NARIENV-9-1 to -3, and NARIENV-10-1 and -3 were aligned using the ClustalX Version 1.81 software. Each of these sets of two or three clones was obtained from proviral DNA from HIV-1 isolates INDNARI-0218437, INDNARI-0218440, INDNARI-0218436, and INDNARI-9917796. A “–” in the consensus represents a deletion in the majority of the sequences analyzed.

conditions identical to those used for the first-round PCR reaction. For the HMA, equal amounts of the sample PCR product were mixed with standard plasmid amplicons in 0.5-ml tubes and the tubes were heated at 95°C for 2 min and then quick chilled on ice to enable formation of heteroduplexes. The heteroduplexes were detected by running the samples on acrylamide gels at constant voltage and the subtype of HIV-1 detected using the mobility pattern of the heteroduplexes.

For the gag HMA, about 1
g of the extracted DNA was used for PCR amplification with primers H1G777 (5
TCACCTAGAACTTTGAATGCATGGG) and H1P202 (5
CTAATACTGTATCATCTGCTCCTGT). PCR amplification was carried out in a 100
l reaction containing 1.5 mM MgCl2, a 200
M concentration each of dATP, dCTP, dGTP, and dTTP, 20 pmol of each primer, and 2.5 units of Taq DNA polymerase. The PCR reaction tube was subjected to 94°C for 2 min, fol-

5449_06_p152-157

2/8/05

10:17 AM

Page 155

SUBTYPES B AND C HIV-1 RECOMBINANTS IN MANIPUR

155

FIG. 3. Phylogenetic tree of the gag gene sequences was obtained using the Molecular Evolutionary Genetic Analysis (MEGA) software, Version 2.1 using the neighbor–joining method (Jukes Cantor) and bootstrap values of 500. The bootstrap values are displayed as percent values on the tree generated. The standard sequences for different subtypes used for generating the tree were A1.KE.94.Q2317 and .CY.94.94CY01741 (subtype A), B.FR.83.HXB2 and B.US.83.RF (subtype B), C.IN.95.95IN21068, C.BR.92.92BR025, and C.ET.86.ETH2220 (subtype C), D.CD.83.NDK and D.CD.84.84ZR085 (subtype D), H93TH293 and HIV1CM240 (subtype E), F1.BR.93.93BR020.1 (subtype F), G.SE.93.SE6165 (subtype G), H.BE.93.VI1991 (subtype H), J.SE.94.SE7022 (subtype J), and K.CM.96.MP535 (subtype K). Except for clones NARIGAG-10 to -3, which showed maximum homology to subtype B sequences, all other gag clone sequences showed maximum homology to subtype C.

lowed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 90 sec, with a final extension for 7 min at 72°C. Five microliters of first-round PCR reaction was further amplified by primers H1Gag1584 (5
AAAGATGGATAATCCTGGG) and g17 (5
TCCACATTTCCAACAGCCCTTTTT) using 2.5 mM MgCl2 for the PCR reaction. The thermal cycling conditions were 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 60 sec, with a final extension for 7 min at 72°C. The second-round PCR reaction generated a final amplified product that was 0.45 kb in size. The HMA gel run was carried out using a polyacrylamide gel containing 20% urea, at 250 V for 3 hr. The gag and env HMA revealed that in 10 (eight IVDUs and two spouses of HIV-infected individuals) out of 14 samples gag and env genes belonged to subtype C and in one, both gag and env belonged to subtype B. The remaining three samples showed recombination with envB/gagC. Three gag and env clones obtained from each of these three samples were se-

quenced using the ABI Prism 310 automated sequencer (Applied Biosystems). The gag and env sequences were aligned separately using the ClustalX Version 1.81 software and the sequences are shown in Figs. 1 and 2. Alignments of the sequences obtained from the clones together with representative sequences from other clades for the gag and env genes were also prepared using the ClustalX Version 1.81 software. Phylogenetic analysis was carried out by using the neighbor-joining method (Jukes Cantor) with a bootstrap value of 500 on aligned sequences using MEGA Version 2.1 software (Figs. 3 and 4). The results obtained by sequencing of the clones confirmed the HMA findings that the three samples belonged to B/C recombinants. Of these three samples with discordant gag/env genes, two were obtained from spouses of HIV-infected individuals and one was from an IVDU. Further analysis of the three env gene sequences obtained from the samples containing the discordant gag/env HMA results revealed that the sequences were most closely related to the Thai B
se-

5449_06_p152-157

2/8/05

10:17 AM

Page 156

156

TRIPATHY ET AL.

FIG. 4. Phylogenetic tree of the env gene sequences was obtained using the Molecular Evolutionary Genetic Analysis (MEGA) software, Version 2.1 using the neighbor-joining method (Jukes Cantor) and bootstrap values of 500. All the env clone sequences from northeastern region of India showed maximum homology with the Thai B
strains HIV1CM237X and HIV92TH14.

quences available in the Los Alamos database as shown by carrying out an online blast search. Even for the single sample where both the gag and env sequences belonged to subtype B, the env gene sequences were most closely related to the Thai B
subtype of HIV-1. All env clones obtained had the GPGR amino acid sequence at the tip of the V3 loop. Of the 11 env clones sequenced, 7 had the N-linked glycosylation site at the amino-terminal end of the V3 loop. In the gag clones obtained from one sample, there was a five amino acid deletion (aa 105–109 in the consensus sequence) and in those from another sample, there was a three amino acid insertion (aa 112–114 in the consensus sequence). Using the RIP 1.9 Beta software available online at the Los Alamos website (www.hiv.lanl.gov), no intersubtype recombination within the gag or env gene sequences was detected. The gag clones obtained from the three samples discordant for gag/env genes and with subtype B env (i.e., clones from NARIGAG-7, -8, and -9) belonged to subtype C, while the gag clones obtained from one sample with env subtype B (NARIGAG-10) belonged to subtype B, with maximum homology to gag sequences reported from Thailand, China, and Myanmar. There have not been attempts to conduct surveillance for recombinant HIV viruses circulating in India. After the first report of an A/C recombinant virus from India, we here report the

presence of envB/gagC recombinants in the samples obtained from the northeastern region of India. Surveillance in other parts of the country is likely to yield more recombinant strains. Such a surveillance is essential as the presence of circulating recombinants in a region may influence the strategies for preventive vaccines. Although there are no specific biological characteristics of the recombinant viruses, they may exhibit different genotypic resistance patterns. This may be important in light of the 3 by 5 initiative for access to antiretroviral therapy. The GenBank nucleotide sequence accession numbers for the gag clones NARIGAG-7-1, NARIGAG-7-2, NARIGAG-7-3, NARIGAG-8-1, NARIGAG-8-2, NARIGAG-8-3, NARIGAG9-1, NARIGAG-9-2, NARIGAG-9-3, NARIGAG-10-1, NARIGAG-10-2, and NARIGAG-10-3 are AY612439, AY612440, AY612441, AY612442, AY612443, AY612444, AY612445, AY612446, AY612447, AY612448, AY612449, and AY612450, respectively. The GenBank nucleotide sequence accession numbers for the env clones NARIENV-7-1, NARIENV-7-2, NARIENV-7-3, NARIENV-8-1, NARIENV-8-2, NARIENV-8-3, NARIENV9-1, NARIENV-9-2, NARIENV-9-3, NARIENV-10-1, and NARIENV-10-3 are AY615286, AY615287, AY615288, AY615289, AY615290, AY615291, AY615292, AY615293, AY615294, AY615295, and AY615296, respectively.

5449_06_p152-157

2/8/05

10:17 AM

Page 157

SUBTYPES B AND C HIV-1 RECOMBINANTS IN MANIPUR

ACKNOWLEDGMENTS This study was carried out using intramural funds of the Indian Council of Medical Research. The authors thank Ms. Varsha Kale of NARI and Mr. Shantanu Basu, Summer Trainee at NARI, for technical assistance in carrying out the serological tests and HMA for the blood samples.

REFERENCES 1. Robertson DL, Sharp PM, McCutchan FE, and Hahn BH: Recombination in HIV-1. Nature 1995;374:124–126. 2. Gao F, Robertson DL, Morrison SG, Hui H, Craig S, Decker J, Fultz PN, Girard M, Shaw GM, Hahn BH, and Sharp PM: The hterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin. J Virol 1996;70(10):7013–7029. 3. Carr JK, Salminen MO, Koch C, Gotte D, Artenstein AW, Hegerich PA, St Louis D, Burke DS, and McCutchan FE: Full-length sequence and mosaic structure of a human immunodeficiency virus type 1 isolate from Thailand. J Virol 1996;70(9):5935–5943. 4. Pfutzner A, Dietrich U, von Eichel U, et al.: HIV-1 and HIV-2 infections in a high risk population in Bombay, India: Evidence for the spread of HIV-2 and presence of a divergent HIV-1 subtype. J Acquir Immune Defic Syndr 1992;5:972–977. 5. Tsuchie H, Maniar JK, Yoshihara N, Immai M, Kurimura T, and Kitamura T: Sequence analysis of V3 loop region of HIV-1 strains prevalent in India. Jpn J Med Sci Biol 1993;46:95–100. 6. Dietrich U, Grez M, von Briesen H, et al.: HIV-1 strains from India are highly divergent from prototype African and US/European strains, but are linked to a South African isolate. AIDS 1993;7:23–27. 7. Jameel S, Zafrullah M, Ahmad M, et al.: A genetic analysis of HIV-1 from Punjab, India reveals the presence of multiple variants. AIDS 1995;9:685–690.

157

8. Bhaskar PV, Ray SC, Rao R, Quinn TC, Hildreth JEK, and Bollinger RC: Presence in India of HIV type 1 similar to North American strains but are linked to a South African isolate. AIDS Res Hum Retroviruses 1994;10:1039–1041. 9. Tripathy S, Renjifo B, Wang W-K, Mclane MF, Bollinger R, Rodrigues J, Osterman J, Tripathy SP, and Essex M: gp120 sequences of primary HIV-1 isolates from Pune and New Delhi in India. AIDS Res Hum Retroviruses 1996;12(12):1203–1206. 10. Cassol S, Weniger BG, Babu PG, Salminen MO, Zheng X, Htoon MT, Delaney A, O’Shaughnessy M, and Ou CY: Detection of HIV type 1 env subtypes A, B, C, and E in Asia using dried blood spots: A new surveillance tool for molecular epidemiology. AIDS Res Hum Retroviruses 1996;12(15):1435–1441. 11. Weniger BG, Takebe Y, Ou CY, and Yamazaki S: The molecular epidemiology of HIV in Asia AIDS 1994;8(Suppl. 2):S13–28. 12. Gadkari DA, Moore D, Sheppard HW, Kulkarni SS, Mehendale SM, and Bollinger RC: Transmission of genetically diverse strains of HIV-1 in Pune, India. Indian J Med Res 1998;107:1–9. 13. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, Novak NG, Ingersoll R, Sheppard HW, and Ray SC: Full length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India with evidence of intersubtype recombination. J Virol 1999;73:152–160. 14. Mandal D, Jana S, Bhattacharya SK, and Chakrabarti S: HIV type 1 subtypes circulating in eastern and northeastern regions of India. AIDS Res Hum Retroviruses 2002;16:1219–1227.

Address reprint requests to: S. Tripathy National AIDS Research Institute 73 G Block, MIDC Bhosari, Pune-411026, India E-mail: [email protected]