Several recent surveillance studies have shown that resistance to trimethoprim-sulfamethoxazole is frequent among H. influenzae isolates worldwide (19, 21).
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2002, p. 1934–1939 0066-4804/02/$04.00⫹0 DOI: 10.1128/AAC.46.6.1934–1939.2002 Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Vol. 46, No. 6
Sulfonamide Resistance in Haemophilus influenzae Mediated by Acquisition of sul2 or a Short Insertion in Chromosomal folP Virve I. Enne,1† Anna King,2 David M. Livermore,3 and Lucinda M. C. Hall1* Department of Medical Microbiology, Barts and The London School of Medicine and Dentistry, Queen Mary, University of London, London E1 2AD,1 Department of Infection, KCL, St. Thomas’ Hospital Campus, London SE1 7EH,2 and Antibiotic Resistance Monitoring and Reference Laboratory, Central Public Health Laboratory, London NW9 5HT,3 United Kingdom Received 6 August 2001/Returned for modification 23 November 2001/Accepted 16 March 2002
Determinants of sulfonamide resistance were investigated in clinical isolates of Haemophilus influenzae from the United Kingdom and Kenya. The mechanism of sulfonamide resistance in H. influenzae has not previously been reported. Eight isolates requiring at least 1,024 g of sulfamethoxazole per ml for inhibition carried the sul2 gene, a common mediator of acquired sulfonamide resistance in enteric bacteria. In other isolates with similarly high levels of resistance, the chromosomal gene encoding dihydropteroate synthase, folP, was found to carry an insertion of 15 bp together with other missense mutations relative to folP of H. influenzae strain Rd RM118 (MIC, 8 g/ml); the folP sequence was identical in all seven such isolates investigated, although they represented three different strains by restriction pattern analysis. The 15-bp insertion was absent in isolates inhibited by sulfamethoxazole at 2 to 64 g/ml (although these exhibited considerable divergence in folP sequence) and in highly resistant isolates carrying sul2. Transformation with a 599-bp fragment of folP containing the insertion but no other differences conferred high-level resistance on a recipient strain, confirming the role of the insertion. Other amino acid substitutions in dihydropteroate synthase may modulate the level of sulfonamide inhibition in susceptible isolates and those with more moderate levels of resistance. The two mechanisms of resistance, mediated by sul2 and modified folP, were detected in isolates from both the United Kingdom and Kenya. Streptococcus pneumoniae and Neisseria meningitidis, is mediated by mutation of the chromosomal gene encoding DHPS (13, 16). Here, we present evidence that either acquisition of sul2 or an insertion in the chromosomal gene encoding DHPS, folP, can mediate sulfonamide resistance in H. influenzae. Both mechanisms were found among recent clinical isolates from two continents.
Haemophilus influenzae is a common cause of communityacquired respiratory tract infections, including otitis media, sinusitis, and pneumonia. Several recent surveillance studies have shown that resistance to trimethoprim-sulfamethoxazole is frequent among H. influenzae isolates worldwide (19, 21). Trimethoprim resistance in H. influenzae has been demonstrated to involve mutations of the chromosomal dihydrofolate reductase gene (4–6), but the mechanisms of sulfonamide resistance in H. influenzae have not been characterized. Sulfonamide antimicrobial agents inhibit the formation of dihydropteroic acid by competing with p-amino benzoic acid for condensation with 7,8-pterin pyrophosphate, a reaction catalyzed by dihydropteroate synthase (DHPS). Inhibition results in the cells becoming depleted of tetrahydrofolate (3). Sulfonamide resistance is commonly mediated by alternative, drug-resistant forms of DHPS. In enteric bacteria two plasmid-borne genes, sul1 (or sulI) (23) and sul2 (or sulII) (17), encode resistant enzymes. sul1 forms part of the conserved region at the 3⬘ end of most class 1 integrons (18). sul2 was originally found to be carried predominantly on small nonconjugative plasmids (17, 18) but in recent United Kingdom isolates was mainly on larger plasmids (7); sul2 is usually linked to the streptomycin resistance genes strA and strB. By contrast, sulfonamide resistance in a number of other species, including
MATERIALS AND METHODS Bacterial isolates. Ninety-six consecutive, noncopy isolates of H. influenzae from St Thomas’ Hospital were collected between November 1998 and February 1999 as part of an international surveillance study. Other United Kingdom isolates were from a national survey of H. influenzae undertaken in 1991 (14). Kenya isolates were collected in 1999 from an orphanage housing human immunodeficiency virus patients who had been receiving trimethoprim-sulfamethoxazole three times per week as prophylaxis against pneumocystis infection; the isolates were kindly made available by Robert Booy, Department of Child Health (Barts and The London School of Medicine and Dentistry). The H. influenzae isolates selected for molecular analysis are described in Table 1. H. influenzae Rd RM118 was used as a transformation recipient and was kindly provided by Nigel J. Saunders, University of Oxford, Oxford, United Kingdom. Genomic typing of H. influenzae isolates. Cells were lysed in agarose plugs, and the DNA was digested with SmaI (Promega, Southampton, United Kingdom). The resulting high-molecular-weight fragments were separated by pulsed-field gel electrophoresis (PFGE) as described by Gautom (10). Electrophoresis was carried out on a Chef DR II instrument (Bio-Rad Laboratories, Hemel Hempstead, United Kingdom) at a gradient of 6.0 V/cm and an angle of 120° for 14 h with an initial switch time of 2.2 s and a final switch time of 34.1 s. Isolates were considered to belong to the same PFGE type if they differed by no more than three bands. Susceptibility testing. Isolates were grown for 18 h at 37°C in 5% CO2 on brain heart infusion agar (Oxoid, Basingstoke, United Kingdom), supplemented with 5% horse blood heated until chocolate. Colonies were suspended in sterile saline to conform to the density of a McFarland standard 0.5. Suspensions were diluted to provide a final inoculum of 103 (for sulfonamide) or 104 (for streptomycin)
* Corresponding author. Mailing address: Department of Medical Microbiology, Barts and The London School of Medicine and Dentistry, Turner St., London E1 2AD, United Kingdom. Phone: 44 (0)20 7377 7000 (1) 3228. Fax: 44 (0)20 7375 0518. E-mail: l.m.c.hall@mds .qmw.ac.uk. † Present address: Department of Pathology and Microbiology, University of Bristol, Bristol BS8 1TD, United Kingdom. 1934
SULFONAMIDE RESISTANCE IN HAEMOPHILUS INFLUENZAE
VOL. 46, 2002
1935
TABLE 1. Characteristics of the clinical isolates of H. influenzae investigated Isolate(s)
PFGE type
Geographic origin (date)
Sourcea
Sulfamethoxazole
A12, A18
HI001
Z26, Z43, Z46, Z49 TOM36
HI002
O35
HI004
R111
HI005
R157
HI005
Z4 Z21 P95
HI005 HI006 HI007
TOM56
HI007
Z34 B98
HI008 HI009
R162
HI010
T194
HI011
O38
HI012
A101
HI013
B176
HI014
B167
HI014
K57
HI015
9 further isolates a b
HI003
b
ND
PCR result for:
MIC (g/ml) of: Streptomycin
sul1
sul2
folP 15-bp insertion
Reference
United Kingdom (1991) Kenya (1999)
Sputum
ⱖ1,024
2
⫺
⫺
⫹
14
Throat swab
ⱖ1,024
4
⫺
⫺
⫹
This study
United Kingdom (1998) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) Kenya (1999) Kenya (1999) United Kingdom (1991) United Kingdom (1999) Kenya (1999) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) United Kingdom (1991) Kenya (1999)
Sputum
ⱖ1,024
2
⫺
⫺
⫹
This study
Sinus
ⱖ1,024
32
⫺
⫹
⫺
14
Sputum
ⱖ1,024
16
⫺
⫹
⫺
14
CSF
ⱖ1,024
16
⫺
⫹
⫺
14
Throat swab Throat swab Sputum
ⱖ1,024 ⱖ1,024 1,024
32 32 32
⫺ ⫺ ⫺
⫹ ⫹ ⫹
⫺ ⫺ ⫺
This study This study 14
Sputum
1,024
16
⫺
⫹
⫺
This study
Throat swab Sputum
1,024 64
128 4
⫺ ⫺
⫹ ⫺
⫺ ⫺
This study 14
Sputum
32
1
⫺
⫺
⫺
14
Eye
32
1
⫺
⫺
⫺
14
Sputum
32
2
⫺
⫺
⫺
14
Sputum
16
2
⫺
⫺
⫺
14
Sputum
16
2
⫺
⫺
⫺
14
Sputum
4
2
⫺
⫺
⫺
14
URT
2
2
⫺
⫺
⫺
14
ⱖ1,024
4
⫺
⫺
⫹
This study
Throat swabs
CSF, cerebrospinal fluid; URT, upper respiratory tract. Not determined.
CFU when spotted on Iso-Sensitest agar (Oxoid) supplemented with 5% lysed defibrinated horse blood and 15 g of NAD (Sigma Aldrich, Poole, United Kingdom) per ml containing doubling dilutions of sulfamethoxazole (0.5 to 1,024 g/ml; Sigma Aldrich) or streptomycin (0.5 to 128 g/ml; Sigma Aldrich). Plates were incubated at 37°C for 18 h in 5% CO2. Escherichia coli NCTC 10418 was included in each set as an MIC control, and Enterococcus faecalis NCIB 127556 was used to check the suitability of each batch of medium for sulfamethoxazole susceptibility testing (2). PCR amplification. Primers to amplify sul1, sul2, folP, strA, and strB were designed with the Oligo-4 program (National Biosciences Inc., Plymouth, Minn.) and are described in Table 2. Primers were supplied by Amersham Pharmacia (St. Albans, United Kingdom). All PCRs were performed in reaction mixtures containing 10 mM Tris-HCl, 50 mM KCl, 200 M concentrations each of dATP, dCTP, dGTP, and dTTP, MgCl2 as specified in Table 2, 20 pmol of each primer, 2.5 U of Taq polymerase, and 1 l of template per 100 l of reaction mixture. All reagents were supplied by PE Biosystems (Warrington, United Kingdom). The template comprised total DNA prepared by a guanidium thiocyanate method as described previously (13). Amplification was carried out in a PE Biosystems 2400 thermal cycler and consisted of 3 min of initial denaturation at 95°C, 30 cycles of denaturation at 95°C for 1 min, annealing at the temperature specified in Table 2 for 1 min, and extension at 72°C for 1 min, followed by a final extension at 72°C for 4 min. Products of primers DHPS5F and DHPS5R were separated on 4% polyacrylamide gels to differentiate fragments with small length differences. Other products were separated on 1% agarose gels.
DNA sequence determination. PCR amplification products purified with a QIAquick gel extraction kit (Qiagen, Crawley, United Kingdom) were used for DNA sequencing. DNA sequences were determined by the dideoxy chain termination method using a DYEnamic ET terminator cycle sequencing kit (Amersham Pharmacia) and an ABI 377 automated sequencer (PE Biosystems). The oligonucleotide pairs DHPS1F/R and DHPS2F/R were used both to amplify fragments for sequencing and as sequencing primers. The sequence of each fragment was determined from at least three independently amplified PCR products. Sequences were analyzed using the Sequence Navigator and Autoassembler programs (PE Biosystems). Determination of folP copy number. In order to determine whether isolates had one or two copies of folP, total DNA was digested with EcoRV or SnaBI (Promega) and separated on 0.9% agarose gels. Gels were stained in ethidium bromide, visualized under UV, and blotted using a Posiblotter (Stratagene, Amsterdam, The Netherlands) as recommended by the manufacturer. Blots were hybridized by standard methods (20) with digoxigenin-labeled probes made from a PCR amplification product of DHPS1F and DHPS2R, and hybridization was detected via antibody-conjugated alkaline phosphatase with a DNA labeling and detection kit (Roche Diagnostics, Lewes, United Kingdom) according to the manufacturer’s instructions. Transformation. H. influenzae Rd RM118 and clinical isolate R162 (Table 1) were transformed with total DNA or purified PCR amplification products, using the M-IV method of Herriot et al. (12). Transformants were selected on triplicate plates of Iso-Sensitest agar supplemented with 5% lysed horse blood, 15 g
1936
ENNE ET AL.
ANTIMICROB. AGENTS CHEMOTHER. TABLE 2. Description of oligonucleotide primers and PCR amplification conditions
Primer
Sequence (5⬘-3⬘)
Positiona (gene)
Annealing temp (°C)
[MgCl2] (mM)
SUL1F SUL1R SUL2F SUL2R DHPS1F DHPS1R DHPS2F DHPS2R DHPS3F DHPS3R DHPS4F DHPS4R DHPS5F DHPS5R STRAF STRAR STRBF STRBR
CCGATATTGCTGAGGCGGACT CCAACGCCGCTTCAGCTT TCGTCAACATAACCTCGGACAG GTTGCGTTTGATACCGGCAC CCACCAAAATCACTCTAA ATGCATAATACAAACAGG TAGAAGAGGGGGCGACAA ATAAAACCATCAGGCATT TGATAGCGGACAGTTTTT TCATTGATTTGCGAGATA CGTCCGTCATTCCTTTAT ACTGCCTATCACTCTCTG TGGAAGAAGGGGCGACAA ACTACTGGCACAACACGA CAACTGGCAGGAGGAACA CGCAGATAGAAGGCAAGG TTCTCATTGCGGACACCT GGCATTGCTCATCATTTG
⫹348 (sul1) ⫹603 (sul1) ⫹29 (sul2) ⫹507 (sul2) ⫺34 (folP in Rd) ⫹591 (folP in Rd) ⫹142 (folP in Rd) ⫹859 (folP in Rd) ⫹86 (folP in A12) ⫹708 (folP in A12) ⫹227 (folP in A12) ⫹755 (folP in A12) ⫹142 (folP in Rd) ⫹245 (folP in Rd) ⫹207 (strA) ⫹779 (strA) ⫹50 (strB) ⫹472 (strB)
58 58 55 55 52 52 50 50 50 50 52 52 55 55 55 55 57 57
2.0 2.0 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 1.5 1.5 2.5 2.5 2.5 2.5 2.5 2.5
a
Position relative to start codon.
of NAD per ml, and 256 g of sulfamethoxazole per ml. Two colonies were selected at random from each plate, and the MIC of sulfamethoxazole was determined. A parallel reaction with no added DNA was carried out for each transformation experiment to control for the selection of spontaneous resistant mutants. Nucleotide sequence accession numbers. Sequences of folP for isolates A12, Z26, TOM36, A101, K57, B167, B98, O38, R162, and T194 have been given GenBank accession numbers AF378235 to AF378244, respectively.
RESULTS Characterization of clinical isolates of H. influenzae. Testing for susceptibility to sulfonamides is complicated by the influence of growth medium and inoculum. Among the collection of 96 isolates from St Thomas’ Hospital, the MIC distribution suggested three populations: fully susceptible isolates (n ⫽ 71), for which MICs were 16 g/ml or below (under the conditions described); isolates with an intermediate level of resistance (n ⫽ 23), for which MICs were 32 to 128 g/ml; and highly resistant isolates (n ⫽ 2), for which MICs were 1,024 g/ml or above (Fig. 1). A further six highly resistant isolates, also requiring MICs of 1,024 g/ml or above, were selected from a
FIG. 1. Distribution of sulfonamide MICs in a collection of 96 H. influenzae isolates from St. Thomas’ Hospital.
1991 United Kingdom survey collection (14), together with four isolates for which MICs were in the intermediate range and four fully susceptible isolates. All 16 isolates obtained from Kenya were highly sulfamethoxazole resistant (MICs ⱖ 1,024 g/ml). Five of the eight highly sulfamethoxazole-resistant isolates from the United Kingdom were also resistant to streptomycin, as were 3 of the 16 resistant isolates from Kenya. Representative isolates with a range of susceptibilities were selected from among the United Kingdom, St Thomas’ Hospital, and Kenya collections for further study (Table 1). Restriction fragment typing by PFGE revealed eight types among 15 highly resistant isolates (Table 1): four of the seven resistant isolates selected from the Kenya collection belonged to the same type; three other types were represented by two or three isolates, including one type shared by two United Kingdom isolates isolated 8 years apart and one type shared by two United Kingdom and one Kenya isolate. In addition, one type was represented by two susceptible isolates from the same hospital. All other isolates investigated had unique patterns (Table 1). Detection of sul2 in sulfonamide-resistant isolates. PCR amplification for the detection of sul1 and sul2 was carried out on all highly sulfonamide-resistant isolates (MIC ⱖ 1,024 g/ml) described in Table 1. The sul1 gene was not detected in any isolate but sul2 was present in eight isolates, which represented five different PFGE types (Table 1). There was complete correlation between carriage of sul2 and streptomycin resistance (streptomycin MIC, ⱖ16 g/ml, compared to ⱕ4 g/ml for other isolates), and both strA and strB genes were detected by PCR in all eight sul2-positive isolates. Characterization of folP. It was postulated that in highly resistant isolates lacking both sul1 and sul2, resistance could be due to mutation in the chromosomal DHPS gene, folP. The seven highly resistant isolates investigated further comprised two isolates sharing PFGE pattern HI001 from the United Kingdom, four sharing pattern HI002 from Kenya, and the unique United Kingdom isolate TOM36 (Table 1). In the complete genome sequence of sulfonamide-suscepti-
VOL. 46, 2002
SULFONAMIDE RESISTANCE IN HAEMOPHILUS INFLUENZAE
FIG. 2. Comparison of the nucleotide sequences of highly resistant isolate A12 and recipients Rd and R162 in the region of the folP gene containing an insertion in resistant strains. Residues in A12 and R162 that differ from those in Rd are in boldface type. Nucleotide numbering is relative to the start of the coding sequence. The deduced amino acid sequence is shown at the top.
ble H. influenzae strain Rd (9), the folP gene is part of a 5.4-kb segment that is duplicated in the Rd genome, the two copies being separated by 135 kb. The number of folP copies present in clinical isolates was assessed by digestion of genomic DNA with EcoRV and SnaBI followed by Southern hybridization with a folP probe. These digestions were both predicted from the published sequence to yield differently sized fragments for the two folP copies in Rd. Two folP-hybridizing EcoRV fragments were detected in strain Rd and in six of the seven sul2-negative highly resistant isolates, while only one fragment was detected in resistant isolate TOM36 and eight isolates for which MICs were in the range of 2 to 64 g/ml. Only one SnaBI fragment was detected in all isolates except Rd, which yielded two fragments as predicted. These results suggest that all of the sul2-negative highly resistant isolates except TOM36 have two copies of folP but that polymorphisms between Rd and the clinical isolates resulted in comigration of both restriction fragments or colocation of two copies of folP on the same fragment in SnaBI digests. Segments of 874 bp including the complete folP-coding region were sequenced from the seven sul2-negative isolates with high-level resistance, four isolates requiring MICs of 32 to 64 g/ml, and four isolates requiring MICs of 2 to 16 g/ml. In isolates with two chromosomal copies of folP, PCR would be predicted to amplify both copies equally; if the copies were not identical, this should be detected by the presence of two superimposed peaks at polymorphic positions, as is seen in heterozygote detection in analysis of diploid genomes. No such sequence polymorphism was seen in the clinical isolates, suggesting that when two copies were present they were identical. Among the eight clinical isolates for which MICs were 2 to 64 g/ml, A101 had the same folP sequence as K57, and B167 had the same as B176, while the folP sequences of the other isolates were all different. The folP sequences of these isolates diverged from folP of Rd by 3 to 9%, corresponding to 1.5 to 5.5% divergence in the encoded protein (see Fig. 3). Two of the least susceptible isolates among these eight, B98 and R162 (Table 1), had a 3-bp insertion resulting in an additional Asp residue after Pro-64. Sequences of folP from the seven highly resistant isolates were all identical and contained, relative to Rd, a 15-bp insertion followed by an A3G point mutation, corresponding to the addition of codons for Ser-Phe-Leu-TyrAsn after Pro-64 and replacement of Asn-65 by Asp (Fig. 2). (Alternatively, folP of highly resistant isolates could be described as having a 12-bp insertion in the sequence represented in intermediate isolates B98 and R162.) Outside the insertion, the sequence from the highly resistant isolates diverged from Rd folP by 7.9% at the nucleotide level and 4.8% at the amino
1937
acid level. Only one amino acid substitution, Ala-2433Thr, was found in the highly resistant isolates but not in any other isolates (Fig. 3). An additional pair of primers, DHPS5F and DHPS5R, was designed to amplify a 104- to 119-bp fragment which included the site of the insertion. If an isolate carried one copy of folP with an insertion and one copy without, two fragments differing in length by 12 or 15 bp would be amplified and could be distinguished by electrophoresis on 4% polyacrylamide gels. These primers were used on all clinical isolates that had been found to carry two copies of the folP gene; in no isolate were two fragments of different size detected, confirming that such isolates must have two copies of the same size variant. Transformation of susceptible strains to resistance. To determine whether the insertion of four or five amino acids in the DHPS of H. influenzae could confer resistance, transformation experiments were undertaken. Initially, H. influenzae Rd RM118 was used as a transformation recipient and was transformed with total DNA from all six representative isolates of PFGE types HI001 and HI002. DNA from each of the six isolates transformed the sulfamethoxazole MIC for Rd from 8 to ⱖ1,024 g/ml. Transformation was then attempted with a PCR product amplified by DHPS1F and DHPS2R encompassing the complete folP gene, including the 15-bp insertion. Again, highly resistant transformants were obtained. It was not possible to determine the folP sequence from transformants, as the sequence profiles obtained were clearly the product of more than one version of the gene. Transformation efficiencies were approximately 2.3 ⫻ 10⫺3 for total DNA and 1.6 ⫻ 10⫺4 for PCR products. Resistant colonies were not detected in controls containing no added DNA, and it was estimated that spontaneous mutation to sulfonamide resistance must therefore occur at a frequency of ⬍10⫺8. These experiments demonstrated that sequence differences in folP between resistant isolates and Rd were responsible for resistance. However, in addition to the insertion, there were 12 amino acid differences between the proteins encoded by folP of Rd and the highly resistant isolates (Fig. 3). To test whether the insertion, rather than the other differences, was critical for high-level resistance, transformation experiments were performed with isolate R162 (MIC, 32 g/ml) as a recipient. Apart from the insertion, the region of folP coding for amino acids 17 to 233 from isolate R162 was identical at the amino acid level to the folP of highly resistant isolates, despite seven nucleotide changes (Fig. 2 and Table 3). PCR primers DHPS3F and DHPS3R (Table 2) were designed to amplify a 599-bp fragment from this region. The resulting amplification product from highly resistant isolates was capable of transforming R162 to high-level resistance (MIC for transformants ⱖ 1,024 g/ml), confirming the role of the insertion (Table 3). PCR detection of the insertion in folP. To enable the convenient detection of the insertion responsible for resistance in chromosomal folP, a PCR primer specific for the insertion was designed. This primer, DHPS4F, incorporated 13 of the inserted nucleotides and was used with DHPS4R (Table 2) to test for PCR amplification in all isolates from which folP had been sequenced. A product was produced only with template DNA from isolates that were known to carry the insertion. The presence of the insertion in resistant transformants was confirmed by this method. The DHPS4F/R primer pair was further used to test for the
1938
ENNE ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 3. Alignment of the deduced DHPS amino acid sequences of the isolates described in this study with the complete FolP sequence of Rd. The isolates represented are the highly resistant isolates (A12, A18, Z26, Z43, Z46, Z49, and TOM36) (A), R162 (MIC, 32 g/ml) (B), B98 (MIC, 64 g/ml) (C), T194 (MIC, 32 g/ml) (D), O38 (MIC, 32 g/ml) (E), A101 (MIC, 16 g/ml) and K57 (MIC, 2 g/ml) (F), and B167 (MIC, 4 g/ml) and B176 (MIC, 16 g/ml) (G). Residues identical to those in Rd are indicated by dots, and spaces inserted to give alignment in the region of the insertion are indicated by dashes. Residues that were not determined in clinical isolates (due to the position of the reverse primer) are indicated by asterisks. Residues conserved in DHPSs of other species (8) are indicated (s) and are in boldface type.
sequence of chromosomal folP. The susceptible recipient strain Rd could be transformed to resistance by the transfer of folP from resistant isolates. It was further demonstrated that the insertion alone is sufficient to increase the MIC of sulfamethoxazole for clinical isolate R162 from 32 to 1,024 g/ml. R162 itself had a 3-bp insertion and several other amino acid changes relative to Rd. A number of the latter changes were shared by other isolates for which sulfamethoxazole MICs were 32 to 64 g/ml, for example, the substitution of conserved residue Gly-189 by Cys, and may be involved in raising the sulfamethoxazole MIC above the “wild-type” level of ⱕ16 g/ml. Whether any of these changes is a prerequisite for the acquisition of high-level resistance was not confirmed.
presence of the folP insertion in other highly sulfonamideresistant isolates. The insertion was present in nine additional sulfonamide resistant isolates from the orphanage in Kenya but absent in the eight sul2-positive isolates tested (Table 1). DISCUSSION The acquired sulfonamide resistance gene sul2 was identified in eight highly sulfonamide resistant isolates from the United Kingdom and Kenya; sul1 was not detected in any of the 24 highly resistant isolates investigated. Highly resistant isolates carrying neither of these genes were all found to have an insertion of 15 bp (relative to Rd) following the codon for Pro-64 in the coding
TABLE 3. Characteristics of donors, recipients, and transformants Donors
Transformantsa
Recipients
Isolates
Sulfonamide MIC (g/ml)
Isolate
Sulfonamide MIC (g/ml)
Fragment of folP transformed
Difference between donor and recipient
Sulfonamide MIC (g/ml)
A12, A18, Z26, Z43, Z46, Z49
ⱖ1,024
Rd RM118
8
ⱖ1,024
R162
5-aa insertion⫹ 12 aa changes 4-aa insertion
ⱖ1,024
A12, A18, Z26, Z43, Z46, Z49
Complete gene (aa 1–275) Fragment encoding aa 17–233
a
aa, amino acid
32
ⱖ1,024
SULFONAMIDE RESISTANCE IN HAEMOPHILUS INFLUENZAE
VOL. 46, 2002
Several highly resistant clinical isolates carried two copies of folP. It appeared that both copies of the gene were identical in all cases, as no size polymorphism was detected within PCR products and no evidence of polymorphism was found during sequence determination. Results from sequencing reactions with laboratory transformants of Rd suggested that polymorphism would have been readily detected. Pro-64 is highly conserved among DHPSs (8), and changes around this position are involved in mutation to resistance in other species. Various duplications of one or two amino acids in this region of the protein can mediate resistance in S. pneumoniae (13). In N. meningitidis a change from Pro-68 (equivalent to Pro-64 in H. influenzae) to Ser or Leu has been found to influence the level of sulfonamide resistance, although other changes were also required for resistance (15). In a laboratory mutant of E. coli, a Pro-64 to Ser substitution resulted in the development of sulfathiazole resistance (24). The crystal structures of DHPSs from E. coli (1) and Staphylococcus aureus (11) have shown that the polypeptide is folded into an eightstranded ␣/ TIM barrel (i.e., a structure with the same fold configuration as triosephosphate isomerase). In E. coli, residues 58 to 71 form an interconnecting loop between -strand 5 and ␣-helix E. Within this loop, Thr-62 is involved in the binding site for 7,8-pterin pyrophosphate and Arg-63 is involved in the binding site for sulfonamide and p-amino benzoic acid (1). Clearly, a large insertion in this region, as observed here, could significantly alter binding specificity. The insertion of extra residues in DHPS has been implicated as a resistance mechanism in a number of species (22). These insertions have mostly reflected short duplications in the DNA sequence (8, 13). However the H. influenzae insertion cannot be interpreted as a duplication and must have arisen by a different mechanism. In this context it is noted that the sequences of the folP genes from highly resistant (sul2-negative) isolates were identical, though they were collected from two different continents and some 8 years apart, whereas those from isolates without high-level resistance were variable. Nevertheless, PFGE typing showed that isolates with the folP insertion obtained from different locations were not related. It is postulated that the resistant form of the gene has arisen through a single event and then spread among the population by natural transformation. In conclusion, two distinct mechanisms can mediate highlevel sulfonamide resistance in H. influenzae: acquisition of a resistant DHPS encoded by sul2 and alteration of the chromosomal DHPS gene folP. Both mechanisms were found among isolates collected in Kenya in 1999 and among isolates collected in the United Kingdom in 1991 and 1999. ACKNOWLEDGMENTS We thank Jeffrey Maskell for assistance and discussion and Robert Booy and Nigel Saunders for provision of isolates. REFERENCES 1. Achari, A., D. O. Somers, J. N. Champness, P. K. Bryant, J. Rosemond, and D. K. Stammers. 1997. Crystal structure of the anti-bacterial sulfonamide drug target dihydropteroate synthase. Nat. Struct. Biol. 4:490–497. 2. Barry, A. L., and C. Thornsberry. 1985. Susceptibility tests: diffusion test procedures, p. 978–990. In E. H. Lennette, A. Balows, W. J. Hausler, Jr., and H. J. Shadomy (ed.), Manual of clinical microbiology, 4th ed. American Society for Microbiology, Washington, D.C.
1939
3. Brown, G. M. 1962. The biosynthesis of folic acid. II. Inhibition by sulfonamides. J. Biol. Chem. 237:536–540. 4. de Groot, R., J. Campos, S. L. Moseley, and A. L. Smith. 1988. Molecular cloning and mechanism of trimethoprim resistance in Haemophilus influenzae. Antimicrob. Agents Chemother. 32:477–484. 5. de Groot, R., D. O. Chaffin, M. Kuehn, and A. L. Smith. 1991. Trimethoprim resistance in Haemophilus influenzae is due to altered dihydrofolate reductase(s). Biochem. J. 274:657–662. 6. de Groot, R., M. Sluijter, A. de Bruyn, J. Campos, W. H. Goessens, A. L. Smith, and P. W. Hermans. 1996. Genetic characterization of trimethoprim resistance in Haemophilus influenzae. Antimicrob. Agents Chemother. 40: 2131–2136. 7. Enne, V. I., D. M. Livermore, P. Stephens, and L. M. C. Hall. 2001. Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 357:1325–1328. 8. Fermer, C., B. E. Kristiansen, O. Skold, and G. Swedberg. 1995. Sulfonamide resistance in Neisseria meningitidis as defined by site-directed mutagenesis could have its origin in other species. J. Bacteriol. 177:4669–4675. 9. Fleischmann, R. D., M. D. Adams, O. White, R. A. Clayton, E. F. Kirkness, A. R. Kerlavage, C. J. Bult, J. F. Tomb, B. A. Dougherty, J. M. Merrick, K. McKenney, G. Sutton, W. Fitzhugh, C. Fields, J. D. Gocayne, J. Scott, R. Shirley, L. I. Liu, A. Glodek, J. M. Kelley, J. F. Weidman, C. A. Phillips, T. Spriggs, E. Hedblom, M. D. Cotton, T. R. Utterback, M. C. Hanna, D. T. Nguyen, D. M. Saudek, R. C. Brandon, L. D. Fine, J. L. Fritchman, J. L. Fuhrmann, N. M. Geoghagen, C. L. Gnehm, L. A. McDonald, K. V. Small, C. M. Fraser, H. O. Smith, and J. C. Venter. 1995. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269:496– 512. 10. Gautom, R. K. 1997. Rapid pulsed-field gel electrophoresis protocol for typing of Escherichia coli O157:H7 and other gram-negative organisms in 1 day. J. Clin. Microbiol. 35:2977–2980. 11. Hampele, I. C., A. Darcy, G. E. Dale, J. Kostrewa, C. Nielsen, C. Oefner, H. J. Page, D. Schonfeld, D. Stuber, and R. L. Then. 1997. Structure and function of the dihydropteroate synthase from Staphylococcus aureus. J. Mol. Biol. 268:21–30. 12. Herriot, R. M., E. M. Meyer, M. Vogt, and M. Modan. 1970. Defined medium for growth of Haemophilus influenzae. J. Bacteriol. 101:513–516. 13. Maskell, J. P., A. M. Sefton, and L. M. C. Hall. 1997. Mechanism of sulfonamide resistance in clinical isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 41:2121–2126. 14. Powell, M., S. F. Yeo, A. Seymour, M. Yuan, J. D. Williams, and Y. S. Fah. 1992. Antimicrobial resistance in Haemophilus influenzae from England and Scotland in 1991. J. Antimicrob. Chemother. 29:547–554. 15. Qvarnstrom, Y., and G. Swedberg. 2000. Additive effects of a two-amino-acid insertion and a single-amino-acid substitution in dihydropteroate synthase for the development of sulphonamide-resistant Neisseria meningitidis. Microbiology 146:1151–1156. 16. Radstrom, P., C. Fermer, B. E. Kristiansen, A. Jenkins, O. Skold, and G. Swedberg. 1992. Transformational exchanges in the dihydropteroate synthase gene of Neisseria meningitidis: a novel mechanism for acquisition of sulfonamide resistance. J. Bacteriol. 174:6386–6393. 17. Radstrom, P., and G. Swedberg. 1988. RSF1010 and a conjugative plasmid contain sulII, one of two known genes for plasmid-borne sulfonamide resistance dihydropteroate synthase. Antimicrob. Agents Chemother. 32:1684– 1692. 18. Radstrom, P., G. Swedberg, and O. Skold. 1991. Genetic analyses of sulfonamide resistance and its dissemination in gram-negative bacteria illustrate new aspects of R plasmid evolution. Antimicrob. Agents Chemother. 35: 1840–1848. 19. Sahm, D. F., M. E. Jones, M. L. Hickey, D. R. Diakun, S. V. Mani, and C. Thornsberry. 2000. Resistance surveillance of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis isolated in Asia and Europe, 1997–1998. J. Antimicrob. Chemother. 45:457–466. 20. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning, a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 21. Schito, G. C., E. A. Debbia, and A. Marchese. 2000. The evolving threat of antibiotic resistance in Europe: new data from the Alexander Project. J. Antimicrob. Chemother. 46:3–9. 22. Skold, O. 2000. Sulfonamide resistance: mechanisms and trends. Drug Resist. Update 3:155–160. 23. Sundstrom, L., P. Radstrom, G. Swedberg, and O. Skold. 1988. Site-specific recombination promotes linkage between trimethoprim resistance and sulfonamide resistance genes–-sequence characterization of dhfrV and sulI and a recombination active locus of Tn21. Mol. Gen. Genet. 213:191–201. 24. Vedantam, G., G. G. Guay, N. E. Austria, S. Z. Doktor, and B. P. Nichols. 1998. Characterization of mutations contributing to sulfathiazole resistance in Escherichia coli. Antimicrob. Agents Chemother. 42:88–93.
