binding adjacent to this site induced dramatic bending of Mu DNA. ... gration host factor (IHF). ... 5 Present address: Banting and Best Department of Medical Re-.
Vol. 264, No. 5. Issue of February 15,pp. 3035-3042,1989 Printed in U.S.A.
THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for Biochemistry and Molecular Biologv, Inc.
Supercoiling and IntegrationHost Factor Change theDNA Conformation and Alter the Flow of Convergent Transcription in Phage Mu* (Received for publication, July 6, 1988)
N. Patrick Higgins, David A. Collier, Michael W. Kilpatrick$, and Henry M. KrauseQ From the Department of Biochemistry, Schools of Medicine and Dentistry, University of Alabama at Birmingham, Birmingham, Alabama 35294
Transcription of bacteriophage Mu is modulated by stable DNA-binding protein with homology to HU protein its repressor, by negative supercoiling, and by the (10,11). In solution IHF is a dimer composed of two polypepEscherichia coli protein integration host factor (IHF). tides encoded by the h i d and hip genes. A mutation in either Two converging Mu promoters regulate lytic and ly- gene blocks X integration into the chromosome but does not sogenic development. The influence of IHFon these affect virus growth and DNA replication (12). convergent promoters depended on the DNA conforSupercoiling also influences X lysogeny. Mutations in DNA mation. WhenMu operator DNA changed from the gyrase that lowered DNA supercoiling levels in uiuo had a relaxed to the negative supercoiled form, IHF changed from a stimulatory factor to an inhibitor of the repres- phenotype similar to h i d and hip mutants; X integration sor promoter, and the ratio of the lytic transcript rel- was inhibited but X replication was normal (12). IHF stabiative to the repressor transcript increased by 40-fold. lized a condensed nucleosome-like structure called the “intaFlexibility in Mu operator DNA was demonstrated by some” (13,14) that was formed specifically only on supercoiled anunusualsupercoil-induced DNA conformation, DNA (15). Mutations in Int that partially relieved supercoil which was detectable by chemical modification with dependence also relieved the IHF dependence (16, 17). The bromoacetaldehyde or digestion with PI nuclease. IHF role of IHF in the bacterial cell, other than controlling probinding adjacent to this siteinduced dramatic bending phage recombination, is not known, but complex phenotypes of Mu DNA. A topological model we call a superloop is of h i d and hip mutations have been documented (18). proposed to explain the effect of IHF on Mu transcripIn Mu the effects of IHF on the lysis-lysogenydecision are tion in vitro and on the lytic-lysogeny decision of the opposite those found in X. Mu lysogenizes IHF mutants at virus grown in IHF and gyrase mutants. normal frequencies but does not produce a lytic infection (12, 19). The activities of two converging viral promoters, PE and P=M,determine whether lytic or lysogenic phage development DNA topology is important in many biological processes. occurs (20-22), and both the PE and P c promoters ~ are under The discovery that integration of phage X into the bacterial IHF influence. Mutations in gyrB block lytic growth but allow chromosome required supercoiling (1)led to the purification normal lysogenization (24). Thus, Mu is like X because the of DNA gyrase (2). More recently, a dependence on negative phenotype of gyrase mutations mimic the phenotype of IHF supercoiling was shown for resolution of transposon Tn3 from mutations, but X requires IHF as a structural cofactor for a cointegrate structure (3), for inversion of DNA sequences integration whereas Mu employs IHF to modulate transcripat the Salmonella typhimurium flagellar gene locus (4), for tion of the lytic and lysogenic geneproducts. inversion of phage Mu tail fiber DNA (5,6), and for transHere we show in vitro evidence that the influence of IHF position of Mu DNA in vitro (7). on Mu transcription is different on supercoiled and relaxed In the case of phage X, the integration reaction works in DNA. Negative supercoiling increases the transcription of vitro with supercoiled DNA and two proteins, Int and inte- mRNA for lytic growth by altering the transcription flow from gration host factor (IHF).’ X Int protein insertsDNA containMu’s converging promoters. The addition of IHF protein ing the viral attachment site( a t t P )into abacterial site (attB). amplifies this supercoiling effect. We also find that Mu opIn this process, attB and attP DNA are precisely aligned, wound around each other, and an ordered physical exchange erator DNA is similar to lambda attP in its hyperreactivity to of phosphodiester bonds results in reciprocal recombination. bromoacetaldehyde, in its binding affinity for IHF, and in its The reaction is aided by IHF binding to specific sequences IHF-mediated DNA bending behavior. However, in Mu, the near the recombination site (8, 9). IHF is a small, basic, heat- coupling of IHF and supercoiling is modified to regulate transcription. The ability of IHF to locally organize specific * This workwas supported by Grants GM33143 and GM30822 DNA sequences into stable supercoiled structures may be a from the National Institutes of Health and Grant 8607785 from the general regulatory mechanism of bacterial cells.
National Science Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. $ Present address: Dept. of Clinical Genetics, University of Birmingham, Birmingham, England. 5 Present address: Banting and Best Department of Medical Research, University of Toronto, Toronto, Ontario, Canada M5GlL6. The abbreviations used are: IHF, integration host factor; BAA, bromoacetaldehyde; bp, base pairs.
MATERIALS ANDMETHODS
Isolation and Analysis of RNAs-RNA from in vitro reactions was extracted with phenol/chloroform, ethanol precipitated, and resuspended in 60 p l of hybridization buffer containing 10 mM Tris-HCI, pH 7.5, 1 M NaCI, 1 mM EDTA. Aliquots mixed with 1 pCi of m3*Plabeled antisense RNA complementary to either PEor P ctranscripts ~ were incubated a t 90 “C for 3 min and then a t 65 “C for 60 min, diluted 10-fold,and digested as previously described (22). Bands were
3035
3036
IHFNegative and Supercoiling Transcription Effects on
visualized by autoradiography after electrophoresis through 6% sequencing gels. Reagent~-a-~~P-labelednucleoside triphosphates and Klenow fragment of DNA polymerase I were from Du Pont-New England Nuclear. Restriction enzymes were from Boehringer Mannheim, and reaction conditions were those specified by the supplier. Escherichia coli RNA polymerase, P1 nuclease, and SI nuclease were from Bethesda Research Laboratories. All other reagents were from Sigma. Bromoacetaldehyde was prepared from bromoacetaldehyde diethylacetal (25). Purified E. coli integration host factor was 95% pure as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and was a generous gift from Howard Nash of the National Institutes of Health. In Vitro Transcription and BAA Reactions-Transcription reaction mixtures (50 p1) containing 50 mM Tris-HC1, pH 8.0, 50 mM KCl, 10 mMMgC12, 1 mM dithiothreitol, 50 pg of bovine serum albumin/ml, 20 pg of yeast tRNA, 1pmol of pPHO2 DNA that contains a copy of the 5 kilobase pairs EcoRI left end fragment of Mu cloned into pBR322 (20) were assembled with RNA polymerase (and where indicated with IHF) and incubated 10 min at 37 "C. Transcription was initiated by addition of 50 p~ CTP, UTP, GTP, 100 pM ATP, and 100 pg of heparin sulfate/ml and incubated a t 37 "C for 15 min. Bromoacetaldehyde reactions in mixtures (100 p1) containing 1 pg of plasmid DNA, 10 mM Tris-HC1, pH 7.5, 0.1 mM EDTA, 2% BAA were incubated at 37 "C for indicated times. DNA recovered by ethanol precipitation was redissolved in 25 pl of restriction enzyme buffer and incubated a t 37 "C for 5 h with 5 units of the appropriate restriction enzyme. After addition of 3 pl of 0.4 M sodium acetate, pH 4.6,0.5 M NaC1.10 mM ZnS04, and2 units of S1 nuclease, incubation was continued at 37 "C for 20 min. Reactions were terminated by addition of 3 p1 of 0.5 M EDTA, pH 7.5, and the DNA was analyzed by electrophoresis through a 1%agarose gel. IHF DNA Bending Assay and Substrates-A substrate for measuring IHF bending was produced by subcloning a fragmentof the Mu operator in pUC19. pHKO9 (Fig. 1)was incubated with DraI restriction nuclease, which cleaves Mu DNA a t positions 934 and 1096 bp relative to the left end of virus DNA (Fig. 6). EcoRI linkers were joined to this 162-bp operator fragment and, after digestion with EcoRI restriction enzyme, the fragment was cloned into pUC19 a t the EcoRI site. One plasmid with the orientation that places the strong IHF-binding site nearest the body of the pUC19 polylinker wascleaved with HindIII, which cuts once at the border of the polylinker and once within the Mu operator sequence (at position 1001 bp relative to the Mu left end). The resulting 125-bp fragment was subcloned into the HindIII site of pUC19. The resulting plasmid, called pHK093, contains Mu DNA from position 934-1001 bp from the left end of the virus positioned between tandem pUC19 polylinkers. Digestion with any single restriction enzyme that cleaves the polylinker generates a unique 125-bp DNA fragment with the IHFbinding site flanked by some portion of a circularly permuted polylinker (see Fig. 7). For the DNA bending assays, plasmid pHK093 was digested with restriction enzyme, EDTA was added to 20mM, and the reactions were heated to 70 "C for 10 min. After phenol-chloroform extraction and ethanol precipitation, the DNA was resuspended in T E (10 mM Tris-HC1, pH 7.6,O.l mM EDTA). Binding reactions (10 pl) containing 0.05 pg of cleaved plasmid, 100 mM NaC1, 5 mM MgClZ,10 mM Tris-HC1, pH 7.6, and 100 pg of salmon sperm DNA/ml were incubated at 37 "C with or without purified IHF at5 pg/ml. After 10 min, 2.5 pl of loading solution (25% glycerol, 10 mM Tris-HC1, pH 7.5, 1 mM 0-mercaptoethanol, 0.05% bromphenol blue) was added, and the samples were applied to a 7% acrylamide gel (15 X 14-cm X 0.7-mm). Electrophoresis was carried out at 150 V at room temperature for 3 h, and then thegel was blotted to Zeta probe nylon membrane (BioRad)in 0.4 N NaOH. After prehybridization, the membrane was probed with a ~u-~'P-labeled synthetic 34-bp oligonucleotide homologous to theIHF-binding site (uertical lines) shown in Fig. 6 (22). The radiolabeled bands were visualized by autoradiography. RESULTS
Hind 111
*
pHKO9 I I1
(3321bp) MAJOR CRUCIFORM 1002
MIt$$
CRUCIFORM
Ava II & a
1664
IIWI
1442 1424
FIG. 1. Schematic representation of pHKO9. pHKO9 is a 3321bp plasmid harboring a 290-bp EcoRI-BamHI fragment containing the bacteriophage Mu operator cloned into EcoRI and BarnHI sites of the vector pSP65. The cloning of this 290-bp fragment derived from the SauIII-HaeIII restriction fragment spanning 838-1118 bp from the Mu left end was described previously (22). The position of the major and minor pBR322 cruciforms (44) present in this plasmid are shown, as arethe positions of sequences that exhibit IHF-induced bending behavior (*). The IHF-binding sites marked I and I I are located between sequence coordinates 2092-2251, and they represent the complex cluster of three sites called I, IIa, and IIb described by Gammas et al. (47). The restriction sites used in mapping and other coordinate positions are given with the numbering system of the pSP65 plasmid (Promega Biotec). The hatched areas denote Mu repressor-binding tracts and thesolid box indicates the IHF-binding site at theMu operator (22,45). Open boxesindicate RNA polymerasebinding limits for the converging promoters PEand P e ~ . A
B
C
D
n
E
F
G
H
" "p.M
FIG. 2. Effects of supercoiling and IHF on PEand P=M transcription in vitro. Transcripts of relaxed plasmid DNA (lanes A and E), relaxed plasmid plus 10pgof IHF/ml (lanes B and F), supercoiled plasmid (lanes C and C), or supercoiled plasmid plus 10 pg of IHF/ml (lanes D and H) were hybridized to either 32P-labeled PE-specific (lanes A-D) or P,M-specific (lanes E-H) riboprobe RNA, and then treated with S1 nuclease. The 90- and 228-nucleotide SI products, representing PE and P c mRNAs, ~ respectively, were visualized by autoradiography.
Supercoiling Reverses Transcription at the Mu OperatorMu has converging promoters that control lytic and lysogenic ~ gene expression (Fig. 1).Transcription from the P c promoter regulates the repressor gene, whereas transcription from the PEpromoter governs production of the transposase and replication proteins (20-22). In order to assess the combined
effects of IHF binding and supercoiling on Mu transcription, single round in vitro transcription products from supercoiled and relaxed plasmids were analyzed by hybridization to radioactive antisense RNA (22) (Fig. 2). In this method, the RNA from a single transcription reaction can be probed for products
IHF Negative and Supercoiling Transcription Effects on
3037
of each convergent promoter independently (RNA inlanes A and E are from the same reaction). Transcription of PE was stimulated 2-fold by negative supercoiling and stimulated 3fold by the binding of IHF. These effects were synergistic so that incubation of supercoiled DNA with IHF prior to transcription gave 8-fold stimulation (Fig. 2, lanes A-D and Table I). Transcriptionfrom PcMon relaxed templates was enhanced nearly 3-fold by binding of IHF (Fig. 2, lanes E and F ) . Surprisingly, PcMtranscription was reduced by 60% on supercoiled plasmid relative to the relaxed plasmid, and addition of IHF to thesupercoiled substrate led to another50% reduction (Fig. 2, lanes E , G, H , and TableI). These resultsshowed, first, that that transcription patterns FIG. 3. IHF organizes supercoiled pHKO9 plasmid DNA. ~ in opposite fashions to negative IHF binding reactions containing 10 mM Tris-HC1, pH 7.5, 50 mM of PE and P c responded supercoiling; the relative abundance of the two transcripts NaCl, 10 mM MgCl,, and indicated amounts of IHF in 10 p1 were changed by a factor of 5 when the template changed from incubated at 37 "C for 20 min. After addition of 3 pl of dye solution relaxed to supercoiled form (compare lanes A and E and C containing 25% glycerol, 10 mM Tris-HC1, pH 7.5, 1 mM P-mercapand G). Second, the IHF protein amplified the supercoil- toethanol, and 0.038% bromphenol blue, the reactions were loaded 16 X 14 X 0.15-cm composite 1.8% acrylamide, 0.9% agarose induced discrimination between the two promoters 5-10-fold onto gels (26), and electrophoretic separation was carried out at 80 V for (compare lanes B and F and D and H ) . When the substrate 40 h at 23 "C. Bands visualized by staining with 1 pg/ml ethidium was changed from relaxed to supercoiled form in thepresence were photographed. Purified IHF was added a t concentrations of: 0, of IHF protein, a 40-fold change in relative abundance of PE lane A ; 0.19 pglml, lane B ; 0,lane C ; 0.38 pg/ml, lane D ;0,lane E ; and P c transcripts ~ occurred, even though the protein com- 0.75 pg/ml, lane F ; 0, lane G; 1.5 pg/ml, lane H ;0, lane I; 3 pg/ml, positions of the reaction mixtures were identical! Thus, the lane J ;0, lane K ; 6 pg/ml, lane L;0, lane M. In decreasing order the bands are: nicked DNA, Rel; IHF complexes 3, 2, and 1, and superregulation was clearly controlled by DNA conformation, and coiled forms of pHKO9 DNA, Sc. some signal in the DNA structure was enhanced into 40-fold regulation by IHF protein. IHF Organizes Supercoiled Plasmids Containing M u Oper- when incubated with these levels of IHF. Higher concentraator DNA-Since the transcriptional influence of IHF was tions of protein retarded all DNA; at IHFlevels near 50 pg/ dependent on the DNA conformation (Fig. 2), we analyzed ml, smears streaked back to thewell. With the vector plasmid, IHF at 6 pg/ml formed a single IHF-supercoiled DNA complexes by gel electrophoresis. The composite agarose-acrylamide gel system of Mukherjee et al. retarded band; thus the Mu operator insert resulted in the (26) proved to have exceptional resolution for plasmids in the production of two new species in this gel system. Two-dimenrange of2-6 kilobases. An ideal mixture of acrylamide and sional gel analysis showed that at 6 pg/ml IHF and at0.3 pg of pHKO9, DNA complex formation occurred with a plasmid agarose for pHKO9 was found to be 0.9% agarose and 1.8% having a superhelix density of approximately -0.03 (data not acrylamide composites (Fig. 3). Supercoiled pHKO9 ran in shown). This level of torsional strain has been shown by this gel system as two bands (both labeled Sc), while nicked several methods to be the effective supercoiling level in uiuo and relaxed DNAs ran asa single band at theposition marked (27-30). Rel. The parentplasmid (pSP65) also showed two supercoiled Supercoil-dependent Features of Naked M u Operator bands in this gel system. The reason for this behavior is DNA-With the knowledge that supercoiled Mu DNA formed unknown. Analysis of pSP65 with chemical probes and by a special complex with IHF, we searched for probes that could electrophoresis in two-dimensional agarose gels with chloro- detect conformational changes in supercoiled Mu operator quine in the second dimension did not reveal any unusual DNA (23). The DNA near IHF-binding sites at thebacteriofeatures of this plasmid, other than thecruciform region that phage lambda attachment site (attP) exhibited supercoilhas been characterized as part of all pBR322-related vectors dependent reaction with bromoacetaldehyde (BAA) (31). BAA (see Fig. 1). reacts with unpaired adeninesand cytosines, prohibiting base Incubation with IHF produced three discrete complexes pairing at thesites of adduct formation (32). The locations of labeled I, 2, and 3 in order of their appearance with increasing adducts can be mapped by SI nuclease after linearization of amounts of IHF. Formation of these complexes required neg- the DNA. ative supercoiling. In lane L, all supercoiled DNA was reWhen Mu operator DNA was placed under torsional strain tarded, whereas the nicked DNA was unmoved by IHF. Re- it was hyperreactive to BAA. Fig. 4 shows the BAA sensitivity laxed and linear DNAs were not retarded in this gel system ofpHKO9, which containsa 300-bp fragment of the Mu operator cloned in the pSP65 plasmid. Lanes with no BAA TABLE I reaction showed only bands from restriction nuclease cleavQuantitation of convergent in vitro M u transcription age. After BAA reaction, several pairs of BAA-specific bands The gel shown in Fig. 2 was scanned with a Bio-Rad video densi- (at 1750 and 1550 bp for BglI mapping, and 1600 and 1500 bp ~ the integrated peak values for AvaII mapping) were observed for pHKO9 that were absent tometer. The numbers for P E and P e are (in arbitrary units) for the respective transcripts made on plasmids in the control reaction with pSP65. This BAA reaction site containing either the negative supercoil density of the native plasmids (average supercoil density = -0.06) or plasmids relaxed with calf mapped within about 20 bp of the Hind111 site in 02 (Fig. 1). Close examination revealed multiple fragments rather than thymus topoisomerase I (average supercoil density = 0). single bands, suggesting that more than one site ofBAA Relaxed DNA Supercoiled DNA Transcripts sensitivity existed within the region. Negative supercoiling -1HF +IHF -1HF +IHF was required for all BAA specific reactions. Fig. 4 showed that 5 15 10 40 PE when Mu repressor was bound to DNA prior to BAA reaction, 10 25 4 2 PcM thebands corresponding to reaction at the Mu operator Ratio 0.5 20 0.6 2.5 (bracketed) disappeared, whereas the bands indicating reac-
IHFNegative and Supercoiling Transcription Effects on
3038
+
pHKO9pSP65pHKO9pSP65 M
"+-+
"+ - +
1
+
1
m m m m
" "
b D b b
M
I1,: "l
G
b D b b
IHF
-(I 600) 41500)
FIG. 4. BAA sensitivity of pHKO9 DNA. Panel a, incubations in the presence (+) or absence (-) of BAA were followedby restriction digestion with BglI or AuaII. The size of fragments are indicated in bp with the BAA-specific fragments denoted in parentheses. Panel b, plasmid pHKO9 (5 pg) was incubated at 37 "C in the presence (R+) or absence (R-) of 0.55 pg Mu repressor in 10 mM Tris-HC1, pH 7.5, 50 mM NaCl, 0.1 mM EDTA. A portion was diluted 10-fold into 10 mM Tris-HCI, pH 7.5,0.1 mM EDTA, 2% BAA and incubated at 37 "C for 1 h. The DNA recovered by ethanolprecipitation was extracted with phenol/chloroform, treated with BglI and then SI nuclease, and subjected to electrophoresis on a 1%agarose gel. (+) denotes reaction with BAA and (-) denotes the minus BAA control. The expected 3321-bp linear plasmid and, in parentheses, the 3000bp BAA-specific band resulting from reaction at the pBR322 cruciforms are identified. The Mu repressor was purified as previously described (45) and was >95% pure as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
T A C C A A A
A A
G C A
FIG. 5. High resolution mappingof bromoacetaldehyde and P1-sensitive sites in supercoiled Mu operator DNA. Lane 1, reaction mixtures (50 pl) containing 3pg of supercoiled pHKO9 DNA were incubated with 1 unit of P1 nuclease for 10 min in medium salt restriction buffer. Reactions were quenched by addition of EDTA to tion at the cruciforms in the vector DNA remained. Hence, 50 mM and dialyzed against 10 mM Tris-HC1, pH 7.5, 1 mM EDTA Mu repressor, which selectively binds three sites in pHKO9 for 3 h. The DNAwas digested with EcoRI and PstI restriction (Fig. 1)specifically blocked BAA reaction in theMu operator. enzymes, labeled with [CY-~'P]~ATP by filling in the EcoRI end with To precisely map the BAA modification sites in the Mu the Klenow fragment of DNA polymerase I , and displayed on a 6% operator, supercoiled pHKO9 DNA was treated with BAA, the strand separating sequencing gel next to a Maxam-gilbert sequencing DNA was linearized with either BamHI or EcoRI, and the ladder of the same fragment treated for cleavages at C, C+T, G+A, and G, which wererun in lanes 2-5. Lane 6, reaction mixtures (50 pl) ends were labeled with DNA polymerase and [O-~'P]~ATP.containing 3 pg of supercoiled pHKO9 plasmid DNA and 12 mM BAA After a very brief incubation with SI nuclease, the products were incubated 2 h in 10 mM Tris-HC1, pH 7.5,l mM EDTA a t 37 "C. were run on a sequencing gel next to a Maxam-Gilbert se- DNA was ether extracted, ethanol precipitated, washed with 70% quencing ladder of the same fragment. NumerousBAA mod- ethanol, resuspended in EcoRI restriction enzyme buffer, and digested ification sites were detected within the RNA polymerase and with EcoRI and PstI restriction enzymes. After labeling with ["PI IHF binding domains (Fig. 5). The most reactive position dATP by filling in the EcoRI end with the Klenow fragment of DNA polymerase I, DNAwas resuspended in SI nuclease buffer, and corresponded to an AT base pair near the boundary of the incubated with 21 units of SI nuclease for 90 s at 37 "C. The DNA IHF footprint. This site was located just inside the sequence was then precipitated and applied to thegel.
previously shown to be protected from DNase I digestion by RNA polymerase bound to the PE promoter (22). This site was also detected by a second structure probe, P1 nuclease (Fig. 5). PI nuclease cleaved precisely the same phosphodiester bond in native supercoiled Mu operatorDNA that was cleaved by S1 nuclease after BAA treatment. Therefore, these two different probesboth monitor astructural feature at thesame position in supercoiled Mu DNA. Mu operator DNA contains a sequence-directed bend that mapped close to thesites of the strongest BAA and P1nuclease reaction. Digestion of pHKO9 with HinfI and EcoRI yielded nine fragments with the Mu operator contained in a 300-bp fragment stretching from the unique EcoRI site to theHinfI site at coordinate 38 (see Fig. 1). Electrophoresison 2% agarose yielded a pattern of mobility expected from the size of each fragment,but duringelectrophoresis on6% polyacrylamide gels at 4 "C, the mobility of the 300-bp Mu operatorcontaining fragment was retarded such that it comigrated with a 354-bp vector DNA fragment (data not shown). The gel mobility of the operator fragment was corrected if the 6% polyacrylamide gelwas run at 55 "C, and it was partially corrected at 21 "C; similar behavior has been used to diagnose the presence of a bend in DNA fragments (34).Both theApA
wedge model of Ulanovsky and Trifinov (33)and thejunction model of Wu and Crothers(34) predicted asequence-induced bend near the P1hypersensitive site.' These results suggested that the structure in the tract of Mu DNA that was hyperreactive to BAA and PI nuclease might be an abrupt bend that was stabilized by negative supercoiling. Similar structures have been visualized by electron microscopy of supercoiled plasmids with bent DNA cloned at unique positions (39). The naturalbend was near the strong IHF-binding site, so we asked whether IHF binding could stabilize bent structures in the Mu operator as it stabilizes bent structures in other molecules (35-37). Fig. 6 shows the position of two potential IHF-binding sites. The strongbinding site with a good fit to ' repressor site, but a potential weaker consensus is near the0 IHF-binding site thatoverlaps the -35 sequence exists within the P,M promoter.Protein-induced DNA bending can be determined in a number of ways, but the most convenient method is to measure DNA mobility in acrylamide gels. Migration of bent molecules is retarded relative to unbent mol-
' D. Collier, and S. Harvey, unpublished results.
3039
IHF and Negative Supercoiling Effects on Transcription I HF
01
I I I I I I I I I I ~ I I I I ~ I I CACCA~~ATTGRCTTTTCAGTRTTATTCTTTTCTATAAAGTTACTTTTCAAAATTTA~ACTCCTT~~TTTATCAACGCGTTAA
960
FIG. 6. The position of unusual secondary structure in supercoiled Mu operator DNA (arrow with star) relative to sites for protein binding. Matches to the IHF consensus sequences
(c/TAANNNNTTGATA/Tor A/TATC AANNNNTTA/G)(46) are indicated as bold overline, Mu repressor-binding sequences are shown as open boxes, and RNA polymerase-binding sequences are shown as filled boxes. The vertical marks spanning the IHF-bindingsite represent the sequence previously reported t o be protected by DNase I footprinting (22) and the syntheticoligonucleotide used for probing in Fig. 7.
P1 BAA
02
B
I IIIIIIIIIII TCAGTRATCRAAGGFIFITTTACCAAARACCAGCAGC~~~~~~AGCTTTTCAGTAATT~TCTTTTTRGT~~GCTAGCTAAGT 1040 """"-+""""-+""""-+"35 "+"""""+"-"" -10 + 1 +--"-----+ " " "
RNA POL
03
I HF
L
I
TTTTACACTTAGTTAAATTGCTAAC~TTTATRGFITTACAAAACTTAGGAGGGTT~~TGTG~CC~ACGAAAAGGCCC +
I
ecules during electrophoresis. The EcoRI and BamHI fragment containing Mu operator DNA from pHKO9 (Fig. 1)was significantly retarded in 7% polyacrylamide gels after incubation with purified IHF (data not shown). Cleavage of this fragment with Hind111 showed that only the half fragment containing the strong IHF-binding site (andthe BAA and PI nuclease hypersensitive site) was retarded. Thus, no binding was detectable at theweaker site on linear DNA, giving results that were consistent with previous footprinting data (22). To test whether the slow migration wasdue in part to bending, a permuted substratewas constructed. The plasmid pHK093 was generated with MuDNA from position 9341001(Figs. 6and 7) sandwiched between tandem pUC19 polylinker sequences. Cleavage of pHK093 with an enzyme that recognizes the polylinker releases a 125-bp fragment. During electrophoresis the complexes of protein-induced bent DNA move more slowly through acrylamide gels when the apex of bending is at thecenter of the fragment. This is due to the fact that mobility is primarily determined by end-toend distanceof the DNA rather thanby the frictional drag of protein on the DNA (38). The migration of the Mu operator fragment clearly was retarded when bound to IHF, and the rate of migration was dramatically affected by changing the location of IHF. The EcoRI-cleaved fragment placed the IHFbinding site only 11bp from the right end of the 125-bp linear fragment, and thisDNA was retarded relative to theunbound fragment by a distance of 1.37 cm. The IHF-binding site was positioned at differentdistances from the ends by using different enzymes (Fig. 7). Cleavage with Sad, BamHI, XbaI, HincII, AccII, and PstI, respectively, placed the IHF-binding site incrementally nearer the center of the molecule, and retardation increased accordingly to a maximum of 3.8 cm (for the PstI cut fragment) which was nearly 3 times that of the EcoRI-cleaved molecule. The apparentcenter of the IHF-induced bending was within the IHFfootprint region and about 20 bp away from the BAA and PI nuclease hyperactive site. Therefore, IHF changed the molecular shape of the DNA. Also, it seems probable that the weak natural bend near the BAA site was incorporated into the more dramatically bent IHF-DNA structure and into the supercoil-dependent IHF. DNA complexes (Fig.3). DISCUSSION
Lytic-lysogeny Decisions in Mu-The lysis-lysogeny decision of Mu is sensitive to variations in host protein IHF and
,."
+""
-+
-+"-
" " " "
-35
+""""-+""""-+
1120
RNA POL to DNA supercoiling levels. Mutations that alter genes for gyrase or either of the IHFsubunits produce a phenotype that hinders lytic growth of the virus and favors lysogenic development (19, 21, 22, 24, 43). We used transcription reactions of Mu operator DNA to examine the effects of IHF and supercoiling in vitro. When IHF was bound to sequences near the promoter PEthat regulates expression of transposase, IHF influenced the activity of both PEand theconvergent repres. of relaxed DNA to thenegative sor promoter P c ~Conversion supercoiled form changed IHF from a stimulatory factor to an inhibitor of PeM.This reversal was coupled to stimulation at PE, and the initial PE/P~M transcript ratios fluctuated 40fold (Fig. 1 and Table I). Thus, the influence of supercoiling and IHF on invitro transcription was dramatic and reflected the same bias that was observed in vivo for gene expression during viral growth in IHF andgyrase mutants. Because IHF effects and supercoiling effects have previously been linked in X integration in vivo and in vitro (12-17) and in gene expression systems involving sugar and amino acid metabolism (18), we sought a physical method to study supercoiled Mu operator DNA interactions with IHF. Composite agarose-acrylamide gel electrophoresis proved to be a sensitive indicator of IHF binding to DNA. This technique separated supercoiled molecules ofpHKO9 and the vector plasmid pSP65 into two populations, in the absence of added proteins. We have not fully explored this effect, but cruciforms extruded a t positions 1002 and 1157 (Fig. 1) could explain these results (44). BAA reactions showed that both pSP65 and pHKO9 containeda subpopulation of molecules with extruded cruciforms (Fig. 4). Cruciforms are small, stable structures that might retard slithering of the DNA during migration through a cross-linked acrylamide gel system, and their formation and maintenance is dependent on negative supercoiling (44). When bound to pHKO9, IHF organized the supercoiled plasmid molecules into structures that were selectively retarded during composite gel electrophoresis, producing three discrete bands (Fig. 3). Although IHF binds to linear pHKO9 DNA (see Fig. 7), only supercoiled species were retarded in this gel system. Webelieve IHF-mediated retardation was due to the protein's effect on DNA conformation rather than due to its contribution to the mass or frictional drag on the complex. We can exclude the possibility that the retarded species were aggregates of IHF-bound molecules for two rea-
3040
IHFNegative and Supercoiling Transcription Effects on -10
-35
IHF
FIG. 8. A model for IHF organization of local supercoiling i n the Mu operator. IHFbending is stably localized by supercoiling to the apex of a negative supercoiled loop (or half solenoid). IHF stops rotation of the DNA aroundits axis and phases the RNA polymerase contacts at -10 and -35 positions of the PEpromoter in ~ is near an ideal position for binding polymerase. The P c promoter DNA that crosses its pathin a superhelical node. In this configuration the superloop bend is an impediment to DNA rotation ahead of RNA polymerase. The IHFfootprint region is indicated as ashaded portion of the double helix and the approximate 10-bp turns of the helix are indicated by square dots. IHF is represented by a ball and theapproximate positions of the -10 and -35 contacts of RNA polymerase in the major groove are shown by stippling.
R.F. Enzyme 3.8 Hindlll Pstl 3.8 3.7 Accl 3.6 Hincll 3.25 Xbal 2.3 BamHl 1.65 Sac1 1.37 EcoRl
ification in the supercoiled form and refractory to BAA when relaxed (31). Negatively supercoiled Mu operator DNA was also hypersensitive to BAA modification; high resolution mapping showed that a single base pair adjacent to the IHFbinding site near PE was 10-fold more reactive than the neighboring base pairs. P1 nuclease also detected an anomaly and made a single strand break at precisely the same position as BAA modification followed by S1digestion. Gammas et al. (47) commented on the importance of the sequences flanking IHF-binding sites by noting examples of sites with a perfect FIG. 7. IHF-induces bending of a Mu operator fragment. match to the IHF consensus sequence that bound IHF poorly. The influence of purified IHF on the electrophoretic mobility of a IHF-binding siteswith documented biological effects are usufragment of the Mu operator was determined on a 7.5% polyacrylamide gel. The Mu fragment was cloned between tandem pUC19 ally embedded in A+T rich tracts that are known to have polylinker sequences so that cleavage with the restriction enzymes tendencies to bend (33,34). Like X attP (40), DNA fragments that recognize the polylinker yielded a unique 125-bp DNA fragment containing Mu operator exhibited anomalous mobility in polywith the IHF-binding sitea t different positions relative to themolec- acrylamide gels that was consistent with DNA bending. IHF ular ends. A diagram at thebottom illustrates the relative position of binding induced a stablebend in DNA containing Mu operator the IHF-binding site for each restriction enzyme used open segments, (Fig. 7), as well as X attP and several other DNA sequences Mu DNA; black segments, pUC19 polylinker DNA; and shaded boxes, the region of Mu DNA protected from DNase I digestion by purified (35-37). How does IHF, bentDNA, and supercoiling regulate tranIHF. The top panelshows the mobility of different fragments run on a 7.5% acrylamide gel when they are free and when they are bound scription? One simple explanation would be that IHF acts as to purified IHF protein. The identity of bands in descending order a repressor by binding to a weak IHF consensus sequence are 1)top of the gel, 2) IHF-retarded double-stranded DNA fragment, that overlaps with the -35 polymerase-binding site (Fig. 6). 3) single-stranded DNA fragment, and 4) double-stranded DNA fragThompson and Mosig (41) recently showed that IHF might ment. The single-stranded DNA fragments were generated in the 70 "C heating step that was used in preparingthe DNA substrate for act this way in another system. However, our footprinting reaction'; the mobility of the single-stranded DNA fragments were experiments (22) and binding experiments (citedabove) failed not altered by the presence of IHF. The apparent weak reactions in to detect an IHFinteraction at thissite. the lanes in which the DNA was cleaved with AccI and the bands A Model for IHF Regulation of Mu Transcription-We near the top of the gel in these lanes were due to an incomplete suggest a structure thatwe call a superloop (to distinguish it digestion of the plasmid DNA by the AccI enzyme. RF is the retarfrom a solenoidal supercoil), depicted in Fig. 8, to account dation factor of the IHF-bentfragment (measured in centimeters)on both for the physical behavior of IHF bound to supercoiled the original gel. plasmids and for the influence of IHF on supercoil-dependent transcription of Mu operator DNA. In a superloop, IHF forms sons. First, pHKO9 dimers migrated very slowly at a position a node protruding away from the plasmid body. We propose wellabove the band of the relaxed monomer plasmid. All that linear sequences stably bent by IHF form superloops three IHF-supercoiled DNA complexes migrated just slightly under negative superhelical torsional strain. pHKO9 has three behind the supercoiled forms of the pHKO9. Second, IHF regions where IHF binds and bends DNA. One is the Mu binding reactions carried out with a mixture of two different operator region. A second region is a complex cluster of three supercoiled plasmids formed only the complexes seen with sites described by Gammas et al. (47) near the ampicillin gene the individual molecules; more complex species expected of a sequences derived from pBR322 (Fig. 1).A third region is mixed aggregate were not formed (data not shown). near position 2860 in lac sequences that were introduced in Sequences flanking IHF-binding sites exhibitsome unusual the construction of pSP65 (sequence available from Promega properties, and a comparison of the physical attributes of Mu B i ~ t e c )The . ~ electrophoretic migration of IHF complexes to operator DNA with X attP showed several striking similarities. three different positions (Fig. 3) can be explained by the Plasmids containingX attP were hypersensitive to BAA mod- formation (at different protein concentrations) of superloops at three asymmetric positions in pHKO9 (Fig. 1).Laundon 'N. P. Higgins, D. A. Collier, M. Kilpatrick, and H. M. Krause, unpublished observations.
N. P. Higgins, unpublished results.
IHF and Negative SupercoilingEffects on Transcription and Griffith (39) showed electron microscopic evidence that DNA bends (even without added proteins) can be positioned near the apex of a supercoil loop domain. Molecules organized in this form have also been called plectonemic supercoil branches by Bliska and CozzareIli (27). For PEtranscription, an important consequence would follow from a superloop formation in Mu operator DNA. The twisting of the double helix about its axis would be impeded, causing a persistent face of DNA to be exposedto theoutside of the superloop. The location of the PE promoter halfway between the end of the loop and the firstsupercoil node may provide an ideal Iocation for RNA polymerase binding to occur. Moreover, the -35 and -10 contacts could be frozen on the outside of the superloop, making them optimally efficient for interactions with RNA polymerase. If a promoter’s position were moved incrementally closer to or farther away from a superloop, modulation of promoter strength with a 10bp period would bepredicted. van Rijn et al. (49) demonstrated this effect on PE i n uiuo. There are several ways the superloop could block the tran. the RNA polymerase imscriptional activity of P e ~First, mediately faces into a sharp stable bend which could pose a physical barrier to transcription. Second, recent evidence shows that rotational diffusion of positive and negative supercoiling strain is important during transcription inE. coli, at least in the elongation stages (48). If rotational diffusion steps were also importantas RNA polymerase forms an unwound open complex and then initiates and extends short RNA chains, then IHF could inhibit this reaction by blocking DNA rotation inthe forward direction. Third, theDNA might act as its own repressor if the DNA, coming off the protein surface were forced near to itsopposing strand. Formation of a superhelix node near P,M could physically obstruct the interaction of RNA polymerase. Although these are not mutually exclusive possibilities, testable distinctionsexist among the mechanisms. For example, the rotation block mechanism would be relatively unaffected by promoter position relative to the bend and insensitive to slight changes in superhelical density. Movement of the IHF-binding sitecloser to thebend should completely relieve the inhibitory effect of an IHFinduced node, which might also be extremely sensitive to supercoiling level. A node placed at a superhelix value of -0.03 would block P c ~as, indicated in Fig. 8, while a supercoiling value of -0.06 might move the node out of the way. The superloop model (a form of “DNA looping”) also suggests that IHF could exert long distance effects as well as local ones. Surette and Chaconas (50) recently showed that IHF stimulated Mu transposition reactions i n uitro by lowering the superhelical requirement for transposase cleavage. They identified the important IHF-binding sequence to be the same IHF-binding siteshown in Fig. 1, which is (in linear distance) 900 bp away from the DNA sequences involved in transposition recombination. Our results and those of a previous report (22) agree with results recently presented by van Rijn et aZ. (49) on the effect of IHF on PE. However, we disagree on the transcriptional effects of IHF on P c M . IHF inhibited P c M transcription in uitro on supercoiled plasmids (Table I and Fig. 2) and also i n vivo when Mu operator sequences were placed in single copy X phages in the bacterial chromosome.* Using multicopy plasmids that fused P c M to galactokinase, van Rijn et al. (49) found that IHF increased rather than decreased i n vivo PcM expression. This pattern implied that IHF mutations would not alter the phage lytic-lysogeny decision at the transcripJ. Vogel and N. P. Higgins, unpublished results.
304 1
tional stage, since IHF biased both PE and P c in~ the same way. We can think of several reasons for these differences. P c ~ regulation may have been changed by the increase in copy number or by the location of the Mu operator sequences in the galactokinase fusion constructions. van Rijn et al. argued that changes in mRNA stability were not likely to have influenced their results because their galactokinase fusions contained only 5“flanking Mu sequences. However, in Mu lysogens, repressor RNA isa very stable, low abundance molecule. Recent experiments showed that, when expressed at high levels, repressor mRNA stability could be changed .~ explordramatically in different E. coli ~ t r a i n sExperiments ing the possibility that different operon fusion constructions have altered mRNA stabilities in IHF mutants are needed to clarify these discrepancies. Finally, our work shows that in Mu, as in X, IHF acts on bent DNA sequences as a transducer of topological information, affecting i n uitro Mu transcription as well as X integration. Transcription controlcould be a general function of IHF in bacterial cells. A model similar to ours has been proposed to explain supercoil-dependent stimulation of catabolite activator proteinon lac transcription6 inwhich the CAP-induced bend near the lac promoter occupies a position similar to the IHF-induced bend near PE(38). In Salmonella, the hkRtRNA gene has a sequence-directed bend at approximately -75, relative to the start of transcription, that Bossi and Smith (42) showed enhanced hisR expression i n uiuo. Bent DNA sequences stabilized by proteinsand negative superhelical tension could be the punctuation necessary for efficient reading of information in a condensed and folded chromosome. If this were so, then altering the proteins that stabilize bent DNA would alter efficiency in transcription, replication, and recombination. This superloop model provides a novel explanation for the complex and interrelatedphenotypes of gyrase, IHF, and HU mutants (18,24,43,51). Acknowledgments-We are gratefulto John Thompson, Baldomero Olivera, Gisela Mosig, Robert Thompson, Nick Cozzarelli, and Don Crothersforvaluable discussions, to Deepak Bastia for suggesting composite gels, and to Howard Nash for the gift of purified IHF. We also thank Bob Wells for his comments and enthusiastic support of this work. REFERENCES 1. Mizuuchi, K., and Nash, H. (1976) Proc. Natl. Sei. U. S. A. 73, 3524-3528 2. Gellert, M., Mizuuchi, K., ODea, M. H., and Nash, H. A. (1976) Proc. Natl. Sci. U. S. A. 73,3872-3876 3. Reed, R. R. (1981) Cell 25, 713-719 4. Johnson, R. C., and Simon, M. I. (1985) Cell 41, 781-791 5. Mertens, G., Hoffmann, A., Blocker, H., Frank, R., and Kahmann, R. (1984) EMBO J. 3, 2415-2421 6. Plasterk, R. H. A., Kanaar, R., and van de Putte, P. (1984) R o c . Nutl. Sci. U. S. A. 81,2689-2692 7. Craigie, R., Arndt-Jovin, D., and Mizuuchi, K. (1985) Proc. Natl. Sci. U. S. A. 82, 7570-7574 8. Craig, N. L., and Nash, H. A. (1984) Cell 39,707-716 9. Bushman, W., Thompson, J. F., Vargas, L., and Landy, A. (1985) Science 230,906-911 10. Nash, H. A., and Robertson, C. J. (1981) J. Biol. Chem. 266, 9246-9253 11. Kikuchi, A., Flamm, E., and Weisberg, R. (1985) J. Mol. Biol. 183, 129-140 12. Miller, H. I., and Friedman, D. I. (1980) Cell 20, 711-719 13. Better, M., Lu, C., Williams, R., and Echols, H. (1982) Proc. Natl. Sci. U. S. A. 79, 5837-5841 J. Vogel, N. P. Higgins, L. Desmet, and A. Toussaint, unpublished results. D. M. Crothers, personal communication.
3042
IHF and Negative SupercoilingTranscription Effects on
14. Echols, H. (1986) Science 233, 1050-1056 15. Richet, E., Abcarian, P., and Nash, H. A. (1986) Cell 46, 10111021 16. Miller, H. I., Mazola, M. A., and Friedman, D. I. (1980) Cell 20, 721-729 17. Lange-Gustafson, B. J., and Nash, H. A. (1984) J. Biol. Chem. 259,12724-12732 18. Friedman, D. I., Olson, E. J., Carver, D., and Gellert, M. (1984) J. Bacteriol. 157,484-489 19. Yoshida, R., Miller, J. L., Miller, H. I., Friedman, H. A., and Howe, M. (1982) Virology 120, 269-272 20. Krause, H. M., Rothwell, M. R., and Higgins, N. P. (1983) Nucleic Acids Res. 11,5483-5495 21. Goosen, N., van Huevel, M., Moolenaar, G. F., and van de Putte, P. (1984) Gene (Amst.) 32,419-426 22. Krause, H. M., and Higgins, N. P. (1986) J. Biol. Chem. 2 6 1 , 3744-3752 23. Wells, R. D., Amirhaeri, S., Blaho, J., Collier, D. A., Hanvey, J. C., Hsieh, W., Jaworski, A., Klysik, J., Larson, J. E., McLean, M. J., Wohlrab, F., and Zacharias, W. (1987) in Unusual DNA Structures (Wells, R. D., and Harvey, S., eds) pp. 1-21, Springer-Verlag, New York 24. Ross, W., Shore, S. H., and Howe,M.M. (1986) J. Bacteriol. 167,905-919 25. McLean, M. J., Larson, J. E., Wohlrab, F., and Wells, R. D. (1987) Nucleic Acids Res. 15,6917-6935 26. Mukherjee, S., Patel, I., and Bastia, D. (1985) Cell 43, 189-197 27. Bliska, J. B., and Cozzarelli, N. R. (1987)J. Mol. Biol. 194,205218 28. Pettijohn, D. E., and Pfenninger, 0.(1980) Proc. Natl. Sci. U. S. A . 77,1331-1335 29. Sinden, R. R., Carlson, J. O., and Pettijohn, D. E. (1980) Cell 21, 773-783 30. Zacharias, W., Jaworski, A., Larson, J. E., and Wells, R. D. (1988) Proc. Natl. Sci. U.S. A . 85, 7069-7073 31. Kitts, P., Richet, E., and Nash, H. A. (1984) Cold Spring Harbor
Symp. Qwmt. Biol. 49,735-744 32. Kusmierek, J. T., and Singer, B. (1982) Biochemistry 2 1 , 57175722 33. Ulanovsky, L. E., and Trifonov, E. N. (1987) Nature 326, 720722 34. Wu, H. M., and Crothers, D. M. (1984) Nature 308,509-513 35. Stenzel, T. T . ,Patel, P., and Bastia, D. (1987) Cell 49, 709-717 36, Prentki, P., Chandler, M., and Galas, D. J. (1987) EMBO J . 6, 2497-2487 37. Robertson, C. A., and Nash, H. A. (1988) J. Biol. Chem. 2 6 3 , 3554-3557 38. Liu-Johnson, H., Gartenberg, M. R., and Crothers, D. M. (1986) Cell 47, 995-1005 39. Laundon, C. H., and Griffith, J. D. (1988) Cell 52,545-549 40. Ross, W., and Landy, A. (1982) J. Mol. Biol. 156, 523-528 41. Thompson, R. J., and Mosig, G. (1988) Nucleic Acids Res. 1 6 , 3313-3326 42. Bossi, L., and Smith, D. M. (1984) Cell 39,643-652 43. DiNardo, S., Voekel,K., Sternglanz, R., Reynolds, A. E., and Wright, A. (1982) Cell 31,43-51 44. Kang, D. S., and Wells, R. D. (1985) J. Biol. Chem. 260, 77827790 45. Krause, H. M., and Higgins, N. P. (1984) Cold Spring Harbor Symp. Quunt. Biol. 49,827-834 46. Leong, J. M., Nunes-Duby, S., Lesser, C. F., Youderian, P., Susskind, M.M., and Landy, A. (1985) J. Biol. Chem. 260, 4468-4477 47. Gammas, P., Chandler, M. G., Prentki, P., and Galas, D. J. (1987) J. Mol. Biol. 195, 261-272 48. Wu, H.-Y., Shyy, S., Wang, J. C., and Liu, L. F. (1988) Cell 53, 433-440 49. van Rijn, P. A,, Goosen, N., and van de Putte, P. (1988) Nucleic Acids Res. 16,4595-4605 50. Surette, M. G., and Chaconas, G. (1988) J. Biol. Chem., in press 51. Higgins, N. P., and Hillyard, D. (1988) J. Bacteriol. 170, 57515758
