Suppl figure 8

Recommend Documents

Page 1. suppl Fig. 2.

SUPPLEMENT Suppl. Figure S1 Suppl. Figure S2 ... - Semantic Scholar

40. ENST00000513349.1 e27-e29. 16. ELK4. - chr1. 205585606. 205593019. 7414. 1373. 11. 24. 50. ENST00000357992.4 e2-e5. 71. FAT1. - chr4. 187627717.

Suppl Figure 1.pptx

used to generate standard curves to determine the binding affinity of free RAD51 to each BRCn-DBD protein. B. Quantification of saturation binding analysis of.

Suppl Figure .tif

Suppl. Figure S2 - PLOS

Suppl. Figure S2 Final.tif

Suppl figure 3 .pptx - PLOS

Suppl Figure S3 (Arial) - PLOS

D. mulleri. D. hexastigma. D. huichole. D. hydei. D. novemaristata. D. ellisoni. D. buzzati. D. nigrospiracula. D. neorepleta. D. stalkeri. D. pachuca. D. longicornis.

Suppl. Figure S3 AB - PLOS

Suppl. Figure S1 Final.tif

Suppl figure 5.pptx - PLOS

Page 1. Dele on at nucleo de posi on G2477, A2478 and C2488 reference DNA sequences. Figure S5.

Suppl. Figure 4 ABCD - PLOS

Suppl Figure 7.pptx - PLOS

Page 1. -0.25. 0.00. 0.25. 0.50. 0.75. Log. 10. S e. L a c ta te p = 0.006 p = 0.034. 0. 5. 10. 15. 20. Log. 2. P a ra s ite s. /u. L. 4.00. 4.25. 4.50. 4.75. 5.00. 5.25. Log.

Supplementary data: Suppl. Figure 1: Spontaneous ... | ResearchGate

mitochondrial ribosomal protein L51. 13132. -0.837. -0.2181. Yes. 26 DNAJA3. DNAJA3. Entrez,. Source. DnaJ (Hsp40) homolog, subfamily A, member 3.

Suppl. Figure 1 (MiSeq alignment)

Supplementary Figure Captions Suppl. figure 1 Stem-loop ... - Hindawi

Predicted Target Genes. miRanda, miRDB,. TargetScan,. DIANA. Otx2. Fam118a. Olfr1426. Tmem131. Pnpla8. Tmpo. Pou4f1. Stau1. Erich1. miRanda, miRDB,.

Microsoft PowerPoint - 120302 suppl figure 1 ...

Suppl Figure ICP0 & Centro 03_R1 - PLOS

HeLa-TR. TR-FXE. TR-ICP0. 0. 2000000. 4000000. 6000000. 8000000. 10000000. 12000000. 14000000. 16000000. 18000000. 2. 5. 10. 30. 50. HeLa-TR.

Suppl Figure 5 revision2.cdr - PLOS

shp1 shp2 point at individual protoderm cells which are swollen and cause a slightly irregular shape of the embryo outline. (D) to (F), mutant embryos; (G) to (I),.

Figure 8.

POWERBURST FIGURE 8

For best performance use only alkaline batteries. Replace batteries if booster no longer ... service.mattel.com. ... CAU

Supplementary Figure 8

Cor= 0.65. Cor= -0.56. Cor=0.41. Cor= 0.34. Cor= 0.45. Cor= 0.35. Cor= 0.35. Cor=0.30. Cor= 0.42. Cor= 0.18. Cor= 0.11. Cor= -0.0054. Cor= -0.093. Cor= 0.53.

Supplementary Figure 8 - PLOS

eccDNA Tos17: 251 TCCACCTTGAGTGTGAAGGGGGGTGTTAAATATATATACAAGCTAATGTACTGGATAGTT 192. Read:.

abcde Supplementary Figure 8

Suppl figure 8

Download PDF

7 downloads 0 Views 376KB Size Report

Comment

AON ipsi. FC ipsi. OTu ipsi. PC ipsi. Am ipsi. Str ipsi. AON contra. FC contra. TT ipsi. GL. Mit. GCL huÎ±-syn 1.5h. Supplementary figure 8: Human-Î±-synuclein ...

Suppl figure 8 Untagged Monomers GL

huα-syn 1.5h OTu ipsi

Am ipsi

Mit

GCL

FC ipsi

TT ipsi

Str ipsi

AON contra

AON ipsi

PC ipsi

FC contra

Supplementary figure 8: Human-α-synuclein staining 1.5 h after injection of untagged α-syn monomers into the OB. Pictures of hu-α-syn staining at high magnification (scale bar represents 10 μm) in various brain areas 1.5 h after injection. Hu-α-syn-positive cells were detected in the same structures 1.5 h after the injection of monomeric untagged α-syn into the OB, as observed after injections of tagged α-syn. Hu-positive cells were present in the ipsi- and contralateral anterior olfactory nucleus (ipsi/ contra AON), in ipsi- and contralateral frontal cortex (ipsi/contra FC), in ipsilateral tenia tecta (ipsi TT), in ipsilateral olfactory tubercle (ipsi Otu), ipsilateral piriform cortex (ipsi PC), amygdala (ipsi Am) and striatum (ipsi Str). Scale bar represents 10 μm.