oligonucleotide targeting mouse and human Smurf1 (Wang et al., 2003) was used. A control siRNA targeting both mouse and human FoxO4 has been described ...
Molecular Cell, Volume 25
Supplemental Data Balancing BMP Signaling through Integrated Inputs into the Smad1 Linker Gopal Sapkota, Claudio Alarcón, Francesca M. Spagnoli, Ali H. Brivanlou, and Joan Massagué
Supplemental Experimental Procedures Plasmids and siRNA Oligonucleotides The construction of pCMV5 N-terminal Flag-tagged Smad1 and the EPSM mutant, and pGex3X-GST-tagged Smad1 have been described previously (Kretzschmar et al., 1997). PCR-based site directed mutagenesis was employed to generate all the other mutants of Smad1 used for the study. pCMV5-Flag-Smad2 and pCMV5-Flag-Smad3 and the respective EPSM mutants have been described (Kretzschmar et al., 1999). Full length human Smurf1 cDNA (NP_851994) was generated and cloned into KpnI and XbaI sites of the cytomegalovirus promoter-driven mammalian expression plasmid pCMV5 encoding N-terminal HA or Flag- tags. In order to generate the degradation-deficient mutant of Smurf1 (Smurf1[DD] mutant), cysteine 699 was mutated to alanine by site directed mutagenesis. The HA-Fyn-Smur1[DD] construct was generated by introducing nucleotides encoding the first 10 amino acids of Fyn (ATGGGTTGTGTACAGTGTAAAGATAAAGAA) at the N-terminus of Smurf1[DD] mutant by PCR and subcloning the product into HindIII and SalI sites of a N-HA-pCMV5 vector. Mammalian plasmids expressing N-terminal Flag-tagged SARA and SMAD4 and HAtagged E2F4, Nup214 and FoxO3 have been described previously (Chen et al., 2002; Seoane et al., 2002; Xu et al., 2002). Sequences of all constructs generated and used in this study were verified by DNA sequencing. A previously characterized siRNA oligonucleotide targeting mouse and human Smurf1 (Wang et al., 2003) was used. A control siRNA targeting both mouse and human FoxO4 has been described previously (Seoane et al., 2002). The following primers were used to detect the expression of endogenous mouse genes: ID1 (gtacttggtctgtcggagcaa, catgtcgtagagcaggacgtt), SNON
(ggaagacgtgatgagaacctatg, ctcagcatctccacctccat), FoxO4 (aaggacaagggtgacagcaa, ctgtgcaaggacaggttgtg), SMURF1 (gtcagtggtggactgcagag, cagggcctgagtcttcataca). Antibodies and Reagents The antibodies recognizing P-ERK, P-JNK, P-p38 MAPK, PXS*P, Smad1-TP, Smad2TP, P-GSK-3α/β and immunostaining HA-epitope tag antibody were purchased from Cell Signaling. Antibody against Histone 1B was purchased from Upstate Biotechnology. The Flag-HRP and α-Tubulin antibodies and Flag- and HA-agarose beads were purchased from Sigma. HA-HRP antibody was from Roche, and all HRP-conjugated secondary antibodies were purchased from Pierce. The antibodies against Smad1 and Smad2/3 have been described previously (Knockaert et al., 2006). The Smad1-S206-P and Smad1-T202-P antibodies were generated by immunizing rabbits with phospho-peptides corresponding to sequences surrounding the indicated phosphorylation residues of Smad1 linker region. Nuclear and cytosolic fractionations were performed using a Nuclear and Cytoplasmic Extraction Kit (Pierce). Cells were lysed in lysis buffer containing 50 mM Tris-HCl (pH 7.5), 1 mM EGTA, 1 mM EDTA, 1% (by mass) Triton X-100, 1 mM sodium orthovanadate, 50 mM sodium fluoride, 5 mM sodium pyrophosphate, 0.27 M sucrose, 0.1% (by volume) 2-mercaptoethanol, and complete proteinase inhibitor mixture (one tablet/10ml). For immunoblot analysis, immunoprecipitates or lysates were boiled for 5 min in SDS sample buffer (50 mM TrisHCl (pH 6.8), 2% (by mass) SDS, 10% (by volume) glycerol, and 1% (by volume) 2mercaptoethanol). Expression of GST-Smad1 Mutants in E. coli The pGEX-3X constructs encoding GST-Smad1 or the indicated mutants of Smad1 and were transformed into E. coli BL21 cells, and a 0.5-liter culture was grown at 37 °C in Luria Broth containing 100 µg/ml ampicillin until the absorbance at 600 nm was 0.6. Isopropyl- -D-galactosidase (250 µM) was added, and the cells were cultured for a further 16 h at 26 °C. The cells were resuspended in 25 ml of ice-cold Lysis Buffer and lysed by sonication to fragment the DNA. The lysates were centrifuged at 4 °C for 30 min at 20,000 × g, and the supernatant was filtered through a 0.44-µm filter and incubated for 60 min on a rotating platform with 1 ml of Glutathione-Sepharose (GSH) beads previously equilibrated in Lysis Buffer. The suspension was centrifuged for 1 min at 3000 × g, and the beads washed three times with 15 ml of Buffer C containing 0.5 M
NaCl and then a further 4 times with 15 ml of Buffer A containing 0.27M sucrose. The beads were reconstituted in 2 ml (final volume) Buffer A containing 0.27 M sucrose, divided into aliquots, snap-frozen in liquid nitrogen, and stored at -80 °C. Where necessary the protein was eluted from the resin at ambient temperature by incubation with 20 mM glutathione, and the beads were removed by filtration through a 0.44-µm filter. The eluates were also divided into aliquots, snap-frozen in liquid nitrogen, and stored at -80 °C.
Supplemental Results Analysis of the P-PXS*P Antibody It has been reported previously that ERK phosphorylates Smad1 at Ser187, Ser195, Ser206 and Ser214, residues that lie in the linker region of Smad1 that links the conserved globular domains, namely MH1 and MH2 (Kretzschmar et al., 1997). In the absence of any phospho-specific antibodies to detect the ERK phosphorylated Smad1, we tested a commercially available antibody that recognizes global ERK substrates phosphorylated at serine residue in the PXS*P motif (P-PXS*P; Cell Signaling) for its efficacy at recognizing ERK phosphorylated Smad1. The P-PXS*P antibody recognized recombinant GST-Smad1 fusion protein that was phosphorylated in vitro by purified ERK but not unphosphorylated GST-Smad1. The PXS*P antibody did not recognize the ERKphosphorylated GST-Smad1[EPSM] mutant, in which ERK phosphorylation residues, Ser187, Ser195, Ser206 and Ser214 were mutated to alanine (Supplementary Figure 1). The antibody recognized ERK phosphorylated Smad1 mutants in which phosphorylation Serine residues were individually mutated to Alanine residues (i.e. S187A or S195A or S206A or S214A) (Supplementary Figure 1A, B), indicating that the antibody recognized multiple phospho-residues among the four ERK-phosphorylated sites. Further analysis on this antibody revealed that it recognized ERK phosphorylated Smad1[EPSM] mutants in which Ala187, Ala195 or Ala206 were individually mutated back to wild type Serine residues, but not Smad1[EPSM] in which Ala214 was mutated back to wild type Ser214 (Supplementary Figure 1C). This indicates that the antibody recognizes Smad1 phosphorylated at Ser187, Ser195 and/or Ser206. Even though ERK phosphorylates Smad2 and Smad3 in vitro, the P-PXS*P antibody does not recognize ERK-phosphorylated Samd2/3 (Supplementary Figure 1D). The antibody does not the
recognize Smad1[EPSM] mutant expressed in EGF-stimulated 293 cells, indicating that the antibody is only sensitive to the phospho-linker region of Smad1 (refer to Figure 4B).
Supplemental References Chen, C. R., Kang, Y., Siegel, P. M., and Massague, J. (2002). E2F4/5 and p107 as Smad cofactors linking the TGFbeta receptor to c-myc repression. Cell 110, 19-32. Knockaert, M., Sapkota, G., Alarcon, C., Massague, J., and Brivanlou, A. H. (2006). Unique players in the BMP pathway: small C-terminal domain phosphatases dephosphorylate Smad1 to attenuate BMP signaling. Proc Natl Acad Sci U S A 103, 11940-11945. Kretzschmar, M., Doody, J., and Massague, J. (1997). Opposing BMP and EGF signalling pathways converge on the TGF-beta family mediator Smad1. Nature 389, 618622. Kretzschmar, M., Doody, J., Timokhina, I., and Massague, J. (1999). A mechanism of repression of TGFbeta/ Smad signaling by oncogenic Ras. Genes Dev 13, 804-816. Seoane, J., Le, H. V., and Massague, J. (2002). Myc suppression of the p21(Cip1) Cdk inhibitor influences the outcome of the p53 response to DNA damage. Nature 419, 729734. Wang, H. R., Zhang, Y., Ozdamar, B., Ogunjimi, A. A., Alexandrova, E., Thomsen, G. H., and Wrana, J. L. (2003). Regulation of cell polarity and protrusion formation by targeting RhoA for degradation. Science 302, 1775-1779. Xu, L., Kang, Y., Col, S., and Massague, J. (2002). Smad2 nucleocytoplasmic shuttling by nucleoporins CAN/Nup214 and Nup153 feeds TGFbeta signaling complexes in the cytoplasm and nucleus. Mol Cell 10, 271-282.
Figure S1. P-PXS*P Antibody Recognizes Smad1-PL In Vitro and In Vivo (A) GST-Smad1 or the indicated mutants of GST-Smad1 were incubated for 30 min at 30oC in a kinase assay with or without active His-ERK2. The assays were stopped by adding 1% SDS and the samples were boiled for 5 min. Indicated amounts of GSTSmad1 were spotted onto nitrocellulose membranes, which were subjected to immunoblotting analyses with the indicated antibodies. (B) Kinase assays were performed as in (A), except that radioactive γ32P-ATP was used. Incorporation of 32P into indicated Smad proteins was detected by running samples on SDS-PAGE and autoradiography of the dried gel. The relative amounts of Smad proteins were analyzed by staining the gel with Coomassie Blue reagent. (C) The kinase assays were performed as in A. 50ng of the ERK phosphorylated Smad1 mutants as indicated were resolved by SDS PAGE and transferred to nitrocellulose membrane, which was subjected to immunoblotting with the P-PXS*P antibody. The relative amount of Smad proteins was analyzed by SDS-PAGE and staining of the gel with Coomassie Blue reagent. (D) As in A, except that GST-Smad2 and GST-Smad3 were used as substrates for ERK.
Figure S2. The Role of the Linker Phosphorylation toward Ubiquitination of Smad1, Smad2, and Smad3 (A) HEK-293 cells were co-transfected with HA-tagged Ubiquitin and Flag-Smad1[WT] or the indicated mutants of Flag-Smad1. 36-hour post transfection, cells were lysed. The lysates or Flag-immunoprecipitates were resolved by SDS-PAGE and transferred to nitrocellulose membranes, which were analyzed by immunoblotting with HA or Flag antibodies. (B) As in (A) except that 293 cells were co-transfected with HA-Ubiquitin and WT or the EPSM mutants of Flag-Smad1, Flag-Smad2 and Flag-Smad3.
Figure S3. Smad5 Is Phosphorylated at the Linker Region and Smurf1 Mediates Degradation of Smad5 (A) HA-Smad1 and HA-Smad5 were overexpressed in 293 cells and immunoblotted with PXS*P and HA antibodies. (B) HA-Smad1 or HA-Smad5 were co-expressed in 293 cells with wild type Flag-Smurf1 or Smurf1[DD] mutant. The extracts were immunoblotted with HA and Flag antibodies.
Figure S4. Effects of Smurf1[DD] on Nuclear Translocation of Smad1[EPSM] and Smad1[GPSM] Mutants upon BMP Stimulation HEK293 cells expressing Flag-Smad1[EPSM] (A) or Flag-Smad1[GPSM] (B), alone or together with HA-Smurf1[DD], were treated with BMP. Nuclear and cytosolic fractions were separated and analyzed for the presence of Smad1-TP and Flag-Smad1 mutants. Histone H1B and α-tubulin served as cell fractionation controls.
