Supplemental Data p53-Dependent Translational

Cancer Cell, Volume 16

Supplemental Data p53-Dependent Translational Control of Senescence and Transformation via 4E-BPs Emmanuel Petroulakis, Armen Parsyan, Ryan J.O. Dowling, Olivier LeBacquer, Yvan Martineau, Michael Bidinosti, Ola Larsson, Tommy Alain, Liwei Rong, Yaël Mamane, Marilene Paquet, Luc Furic, Ivan Topisirovic, David Shahbazian, Mark Livingstone, Mauro Costa-Mattioli, Jose G. Teodoro, and Nahum Sonenberg

Supplemental Experimental Procedures

PCR conditions Cycling conditions were as follows: 95oC for 2 minutes, followed by 40 cycles of 95oC for 15s, 55oC for 15s and 68oC for 20s. Reverse and forward primers (0.5 ul of 10 uM stock solutions) and 1 ul of cDNA were used for a 10 ul PCR reaction. Primers for qPCR were as follows: β-actin primers were previously described (Martineau et al., 2008), Gas2 forward (5’ CTTGCAGCAACTGTGCAGGAGAAA 3’), Gas2 reverse (5’ GTGCACTGGCTTTGCAAGGAATCT 3’), p53 forward (5’ TGGACCCTGGCACCTACAATGAAA 3’), p53 reverse (5’ ATGCAGACAGGCTTTGCAGAATGG 3’), p19Arf forward (5’ TTCTTGGTGAAGTTCGTGCGATCC 3’), p19Arf reverse (5’ TTGAGCAGAAGAGCTGCTACGTGA 3’).

Lentivirus packaging Lentiviruses for shRNA silencing experiments were prepared as described previously with some modifications (Stewart et al., 2003). Briefly, each shRNA vector was cotransfected into 293T/17 cells (ATCC) with the lentivirus packaging plasmid, pCMVΔR8.2DVPR (Addgene Plasmid 8455) (An et al., 1999), and the vesicular stomatitis virus glycoprotein (VSVg) expression vector, pCMV-VSV-G (Addgene Plasmid 8454) (Stewart et al., 2003), using calcium phosphate co-precipitation. Viral supernatants were collected 48 and 72 hours post-transfection. Supernatants were filtered through a 0.45µm nitrocellulose filter before being applied to target cells in the presence of polybrene (5

ug/ml). As a non-silencing shRNA control, the construct SHC002 Non-Target shRNA Control was used (Sigma).

Figure S1. Survival of p53+/- and DKO/p53+/- mice. Kaplan-Meier curve showing survival of p53+/- (n=54) and DKO/p53+/- (n=60) mice. The median survival for p53+/and DKO/p53+/- mice is 56.6 and 62.3 weeks, respectively (p < 0.001).

Figure S2. Foci formation of E1A/Ras-transduced DKO MEFs overexpressing 4EBP1 or 4E-BP2. 4E-BP1 or 4E-BP2 was introduced into primary DKO MEFs (passage 2) using retroviral vectors as described in “Experimental Procedures” and GFP-positive cells were sorted by FACS. An equal number of sorted MEFs (1.5 x 105) for control (vector), 4E-BP1- or 4E-BP2-expressing MEFs was seeded in 6-well dishes. After 24 hours, MEFs were infected with the negative control retrovirus, E1A-, or E1A/Rasexpressing retroviruses. After 10 days, cells were fixed and stained with methylene blue (see “Experimental Procedures”). Figure S3. Levels of p53 mRNA in primary WT and DKO MEFs. p53 mRNA levels in primary WT and DKO MEFs were determined using quantitative RT-PCR and normalized to the level of actin mRNA (see “Experimental Procedures”). The values indicate the average level of p53 mRNA in independent MEFs cultures at passage 4 or 5 (n=7). Error bars show the standard error of the mean.

Figure S4. p53 protein is stabilized in primary and E1A/Ras expressing DKO MEFs. A. Western blot analysis of p53 expression in primary WT and DKO MEFs. Cell extracts were prepared from MEFs that were stimulated with 20% serum for 24 hours and treated with cycloheximide (CHX, 50ug/ml) for the indicated times. The level of p19, p16 and actin is shown. The graph shows the relative level of p53 protein in WT and DKO MEFs during cycloheximide treatment. The p53 protein level at 0 hours was set to a relative value of “1”. Depending on the MEF preparation, p53 degradation rates varied. Similar results were obtained in four independent experiments using independent MEF preparations. B. Western blot analysis of p53 protein levels in E1A/Ras-expressing WT and DKO MEFs treated with cycloheximide (50ug/ml) for the indicated times. The graph represents the average of 4 experiments and error bars indicate the standard deviation.

Figure S5. Decrease of Gas2 mRNA levels after serum stimulation. A. Gas2 mRNA levels in WT and DKO MEFs after serum stimulation for the indicated times. B. Gas2 mRNA levels in p53KO and TKO MEFs after serum stimulation for the indicated times. For both “A” and “B”, the levels of Gas2 mRNA were normalized against the level of βactin mRNA using quantitative RT-PCR analysis. The result represents the average of three independent experiments. Error bars indicate the standard deviation. Figure S6. mRNA stability in 4E-BP1/2 null MEFs. Graph showing levels of Gas2 mRNA (normalized to β-actin mRNA) as determined by RT-qPCR. The Gas2/actin mRNA ratio at 16 and 24 hours post-serum stimulation in p53KO and TKO MEFs was determined in the absence or presence of actinomycin D treatment for 2 and 8 hours, respectively. Error bars indicate the standard deviation. Figure S7. Overexpression of eIF4E increases Gas2 protein expression. Western blot analysis of Gas2, eIF4E and actin protein levels in extracts (20ug) from 3T3 cells overexpressing eIF4E (pMV7-eIF4E) or control 3T3 cells (pMV7) (Lazaris-Karatzas et al., 1990).

References An, D. S., Morizono, K., Li, Q. X., Mao, S. H., Lu, S., and Chen, I. S. (1999). An inducible human immunodeficiency virus type 1 (HIV-1) vector which effectively suppresses HIV-1 replication. J Virol 73, 7671-7677. Lazaris-Karatzas, A., Montine, K. S., and Sonenberg, N. (1990). Malignant transformation by a eukaryotic initiation factor subunit that binds to mRNA 5' cap. Nature 345, 544-547. Martineau, Y., Derry, M. C., Wang, X., Yanagiya, A., Berlanga, J. J., Shyu, A. B., Imataka, H., Gehring, K., and Sonenberg, N. (2008). The poly(A)-binding proteininteracting protein 1 binds to eIF3 to stimulate translation. Mol Cell Biol. Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., et al. (2003). Lentivirus-delivered stable gene silencing by RNAi in primary cells. Rna 9, 493-501.

Percent survival

100

p53+/DKO/p53+/-

75 50 25 0 0

10

20

30

40

50

60

70

80

90

WEEKS

Petroulakis et al

Supplementary Figure S1

control

E1A

E1A/Ras

Petroulakis et al

Supplementary Figure S2

Petroulakis et al

Supplementary Figure S3

A. Primary MEFs

Petroulakis et al

B. E1A/Ras transformed MEFs

Supplementary Figure S4

A.

Petroulakis et al

B.

Supplementary Figure S5

Gas2 / actin mRNA ratio

1.4 1.2 1

- ActD + ActD

0.8 0.6 0.4 0.2 0 16 hrs (14h+2h ActD)

24hr (16h+8h ActD) p53KO

Petroulakis et al

16 hrs (14h+2h ActD)

24hr (16h+8h ActD)

TKO

Supplementary Figure S6

Petroulakis et al

Supplementary Figure S7