(Saint Quentin-en-Yvelines). The elastase inhibitor N-(Methoxysuccinyl)-Ala-Ala-Pro-Val- chloromethyl ketone (MeOSuc-AAPV-CMK or NEI) was purchased ...
Supplementary Material Supplemental Experimental Procedures Patients and methods Reagents. Four antibodies directed against gp91phox were used amongst which 3 from Santa Cruz (Heidelberg, German) i.e. mouse anti-gp91phox (54.1) sc-130543 ; goat anti-gp91phox(C15) sc-5827; rabbit anti-gp91phox (H-60): sc-20782, and the mouse anti-flavocytochrome b, FITC (Clone: 7D5) from MBL (CliniScience, France). The rabbit anti-p22phox (FC-195): sc20781 was from Santa Cruz (Heidelberg, German) and the rabbit anti-p67phox, and rabbit antip47phox were produced by Dang PMC as reported1. The rabbit anti-mTOR (7C10) mAb 2983 was from Cell Signaling (Leiden, The Netherlands) and the anti-actin was from Millipore (Saint Quentin-en-Yvelines). The elastase inhibitor N-(Methoxysuccinyl)-Ala-Ala-Pro-Valchloromethyl ketone (MeOSuc-AAPV-CMK or NEI) was purchased from Sigma-Aldrich (Poole, Dorset, UK). The protease inhibitor cocktail was from Roche and the Restore westernblot stripping buffer was from Pierce. SDS-PAGE, western-blotting reagents were from BioRad (Marnes la Coquette, France) and Iblot nitrocellulose stacks from Life Technologies (Saint Aubin, France). CL097 and R848 were from InvivoGen (San Diego, USA). All other reagents were from Sigma Aldrich. Patients. Blood samples were obtained as previously described1 from patients hospitalized in the Liver Unit of Beaujon Hospital (Clichy, France). Inclusion criteria were age over 18 years, biopsy-proven cirrhosis and Child-Pugh class B or C cirrhosis. Patients were negative for hepatitis B virus and hepatitis C virus infections. At the time blood collection, alcohol consumption was stopped for at least one week. Clinical characteristics of patients are indicated in Table 1. Patients with untreated or recently treated (less than one week) bacterial infection or gastrointestinal hemorrhage were not included. Cultures of ascites, urine and blood performed at the time of inclusion were all negative. Other exclusion criteria were treatment with corticosteroids, pentoxifylline or other immunosuppressive drugs in the past 30 days, and presence of hepatocellular carcinoma, other cancer, or human immunodeficiency virus infection. Healthy subjects (controls) were volunteers obtained from the national blood bank (Etablissement Français du Sang, EFS, Paris, France) according to the locally agreed protocol. This study was approved by our institutional review board, and written informed consent was obtained from all patients.
1
Purification of neutrophils. Peripheral blood from healthy volunteers or cirrhotic patients was collected in Acid Citrate Dextrose (ACD)-containing tubes. Neutrophils were purified by a first step sedimentation with 1% Dextran in saline followed by centrifugation on a cushion of Ficoll-Hypaque (400g-30 min)1. Mononuclear cells were aspirated and the wall of the tubes was wiped to further remove adherent mononuclear cells. Contaminating red cells were lysed under hypotonic conditions (30sec) and the purified neutrophils (97-98%) were washed twice and suspended in Hank’s balanced salt solution (HBSS) at pH 7.4 and containing 0.90 mM Mg2+ and 1.2 mM Ca2+. Preparation
of
neutrophil
membrane
fractions.
Neutrophils
treated
with
di-
isopropylfluorophosphate (DFP) for 15min were stimulated in HBSS with fMLP (1µM) for 2min and kept in ice. Neutrophils were sonicated (2x15 sec) in PBS containing a cocktail of antiproteases and membrane and cytosolic fractions were prepared as described previously2 by centrifuging the post nuclear supernatants (1000 g, 2 min, 4°C) over 15-35% sucrose gradient (120,000 g, 50 min, 4°C). Membranes were collected at the interface, washed by centrifugation (100,000 g, 1H, 4°C) and suspended in HBSS buffer. One volume of neutrophil membrane fraction (equivalent of 5x106 cells) was incubated with one volume of a cell-free degranulation supernatant for 1H and complemented with 1.5X Laemmli buffer for westernblot analyses. The cell-free degranulation supernatant was obtained after stimulation of healthy neutrophils with 1µM fMLP for 2 min as reported3. Respiratory burst (RB). Neutrophils (1x106 cells/ml HBSS) were incubated at 37°C for 5min before stimulation with 1µM fMLP. RB was continuously monitored by measuring the production of superoxide anion in the presence of 80 µM cytochrome c, using a Perkin-Elmer Lambda 40 spectrophotometer equipped with thermostated (37°C) cuvette holder and magnetic stirrer1. RB was also measured by the highly sensitive luminol-enhanced chemiluminescence assay1 with purified neutrophils (0.5x106 cells/450µl HBSS and with whole blood (20 µl in 450 µl PBS containing 0.120 mM calcium) and 20mM luminol. In some experiments, neutrophils (5x106 cells) were incubated overnight in 1ml RPMI containing 25% of plasma of cirrhotic patient or healthy control. Cells were washed twice with PBS and suspended in HBSS containing calcium and magnesium. Cell viability assessed the exclusion Trypan blue test was approximately 90%.
2
Quantification of messenger RNA. Total RNA was extracted from 5 x106 neutrophils or 100 µl of whole blood in 1 ml Trizol according to the manufacturer protocol and stored at -80°C until use. A quantitative real-time PCR (qPCR) was used to quantify relative messenger RNA (mRNA) of the genes of interest. Complementary cDNA was synthesized from 0.2-1µg mRNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Biosciences GmbH, St. Leon-Rot, Germany), according to the manufacturer’s protocol. The following sequence of DNA-oligos primers for qPCR were used : Gp91phox forward : TGTTCAGCTATGAGGTGGTGA, p22phox
forward :
gp91phox
reverse
TCAGATTGGTGGCGTTATTG,
ACCGCCGTGGTGAAGCT, phox
ACCGAGAGCAGGAGATGCA, p47
p22phox
reverse:
Foward : GACAGGTCCTGCCATTTCAC and
p47phox Reverse : ACCTTCATCCGTCACATCG. All real-time PCR reactions were performed using the Roche LightCycler 480 device and the CliniSciences Kapa Sybr Fast qPCR kit according to the manufacturer’s protocol. Samples were run in duplicate, and the melting curve and melting peak were controlled for each primer pair. Relative expression levels for each gene were calculated using the 2-Δct method, with normalization to GAPDH. Results are representative of 3 to 4 independent experiments. Western-blot analysis. Cells were lysed in 50 mM Tris-HCl, pH 6.8 containing 2.5 mM orthovanadate, 2.5 mM EDTA, 5 M urea, 1 mM DTT, a cocktail of antiproteases (CompleteTM, Roche) and 1X Laemmli sample buffer, and subjected to western-blotting experiments using standard protocols1. Horseradish peroxidase-conjugated secondary antibody were used and visualized with enhanced chemiluminescence (ECL). The amount of protein was quantified with the NIH Image J 1.62 software and expressed as a percentage of actin expression. In some experiments, the protein/actin ratio was presented as percentage of control values. Real time neutrophil binding 7D5 coated sensorchip (BIAcore). The time course interaction of intact neutrophils with the NOX2 specific antibody bound to the sensor chip was assessed with a BIAcore X100 (GE Healthcare, Freïburg Germany). A CM3 sensorchip was used to couple the mouse antibody directed against the external portion of NOX2 (Clone: 7D5), according to standard parameters providing by the ”Mouse antibody capture Kit”. Neutrophils suspended in PBS were injected (10, 30 and 100x103 cells in 150µl) at a flow rate of 30 µl/min. The SPR response was recorded as a function of time at 25°C and expressed in resonance unit (RU).
3
Expression of gp91phox at the surface of neutrophils. Neutrophils (0.25 x106 cells were incubated in 50 µl PBS containing sodium azide (0.05%) and the anti-gp91phox antibody coupled to FITC (2.5µg/50µl). Incubations were performed at 4°C with gentle agitation for 30 min. Cells were washed 3 times with the dilution buffer and subjected to FACScan analysis (BD FACS Canto II). Statistical analysis. Unless otherwise stated, data represent means ± SEM. Significant differences were identified using the Student's paired t-test, 1-way ANOVA followed by the Bonferroni post hoc test, by use of GraphPad software (version 6.0; La Jolla, CA, USA), and designated by *P
