Supplemental Information A Competitive Transcription Factor Binding ...

Download PDF
2 downloads 0 Views 1MB Size Report
Comment
(white arrow) and Yox1p alone (grey arrow) are indicated. ... corresponding to Mcm1p alone (black arrow), and Yox1p-Mcm1p complexes (white arrow).
Molecular Cell, Volume 38

Supplemental Information A Competitive Transcription Factor Binding Mechanism Determines the Timing of Late Cell Cycle-Dependent Gene Expression Zoulfia Darieva, Anne Clancy, Richard Bulmer, Emma Williams, Aline Pic-Taylor, Brian A. Morgan, and Andrew D. Sharrocks Supplemental Experimental Procedures Plasmid construction and mutagenesis The following bacterial expression vectors were used for Mcm1p: pAS799 [encoding MAL-Mcm1p(1-96)] was kindly provided by Cynthia Wolberger. pAS2188 [encoding MALMcm1p(1-96)(V69E)] was created by Quikchange mutagenesis (Stratagene) using the primer pair ADS502/ADS1454 and pAS799 as a template. pAS1965 [encoding His-tagged Mcm1p(1-98)] was created by cloning the fragment encoding Mcm1p amino acids 1-98 into the NcoI-XhoI sites in pET21d (created by Makoto Morimoto). The following His-tagged versions of Yox1p were created in bacterial expression vectors; pAS2163 (Yox1p amino acids 1-385), pAS2164 (Yox1p amino acids 151-274), pAS2168 (Yox1p amino acids 151-235), pAS2169 (Yox1p amino acids 176-235), pAS2170 (Yox1p amino acids 176-274), were made by inserting NcoI/XhoI-cleaved PCR products generated using the template pAS1889 (pRS416-Yox1-385)(Pramila et al, 2002; kindly provided by Linda Breeden), and primer pairs ADS1231/ADS1232, ADS1234/ADS1233, ADS1234/ADS1388, ADS 1387/ADS1388 and ADS1387/ADS1233 respectively, into the same sites of pAS154(pETHnefPFH). pAS2178 [encoding Yox1p(151-235)(F153A)], pAS2179

[encoding

Yox1p(151-235)(F155A)],

pAS2180

[encoding

Yox1p(151-

235)(F163A)], pAS2181 [encoding Yox1p(151-274)(E196H)] and pAS2182 [encoding Yox1p(151-274)(N226Q)] were created by inserting NcoI/XhoI-digested fragments from pAS2175, pAS2176, pAS2177, pAS2172 and pAS2171 respectively into the same sites in pAS154(pETHnefPFH). pAS1964 encodes His-tagged Fkh2p(312-458) and was created by ligation of a NcoIXhoI fragment from pAS1829 (Boros et al., 2003) into the same sites of pET21d (created by Makoto Morimoto). pAS2587 and pAS2585 [encoding His-tagged Fkh2p(325-458) and Histagged Fkh2p(1-458)] were created by ligation of NcoI-XhoI fragments from pAS1247 and pAS1243 (Boros et al., 2003) into the same sites of pET21d.

For in vitro transcription and translation, the following pBluescript-KS+-derived plasmids were used; pAS2161 (encoding Yox1p amino acids 1-385), pAS2162 (encoding Yox1p amino acids 151-274), pAS2165 (encoding Yox1p amino acids 151-235), pAS2166 (encoding Yox1p amino acids 176-235), and pAS2167 (encoding Yox1p amino acids 176274), were made by inserting NcoI/XhoI-cleaved PCR products generated using the template pAS1889 (pRS416-Yox1-385)(Pramila et al, 2002; kindly provided by Linda Breeden), and primer

pairs

ADS1231/ADS1232,

ADS1234/ADS1233,

ADS1234/ADS1388,

ADS1387/ADS1388 and ADS1387/ADS1233, respectively, into the same sites of pAS728. pAS2175

[encoding

Yox1p(151-235)(F153A)],

pAS2176

[encoding

Yox1p(151-

235)(F155A)], and pAS2177 [encoding Yox1p(151-235)(F163A)], were created by Quikchange with primers ADS1446/ADS1447, ADS1448/ADS1449 and ADS1450/1451, respectively, using pAS2165 as a template. pAS2189 [encoding Yox1p(151-274)(F153A)], pAS2190

[encoding

Yox1p(151-274)(F155A)],

pAS2191

[encoding

Yox1p(151-

274)(F163A)], pAS2172 [encoding Yox1p(151-274)(E196H)], and pAS2171 [encoding Yox1p(151-274)(N226Q)] were created by Quikchange with primers ADS1446/ADS1447, ADS1448/ADS1449, ADS1450/ADS1451, ADS1390/ADS1391 and ADS1392/ADS1393, respectively, using pAS2162 as a template. All Yox1p derivatives contain a C-terminal Flag tag. pAS1242 (encoding Fkh2p amino acids 1-862) and pAS1243 (encoding Fkh2p amino acids 1-458) were described previously (Boros et al., 2003). For yeast expression, pAS2563 (encoding Myc epitope-tagged full-length Yox1p controlled by its own promoter: -675 to +820) was constructed by inserting SacI/XbaI-cleaved PCR products [obtained using primer pair ADS1702/1703 and S. cerevisiae genomic DNA isolated from a strain expressing Myc epitope-tagged Yox1p from its normal locus (W303 background - kindly provided by Linda Breeden)] into the same sites in YCplac22 (Gietz and Sugino, 1988). pAS2568 [encoding full-length Myc epitope-tagged Yox1p(F155A) controlled by its own promoter] was created by Quikchange mutagenesis using primer pair ADS1448/ADS1449 and pAS2563 as a template. pAS2573 and pAS2574 [encoding fulllength Myc epitope-tagged wild-type Yox1p and Yox1p(F155A) respectively controlled by the GAL1 promoter] were constructed by inserting SacI/XbaI-cleaved PCR products (obtained using primer pair YOX1START1/ADS1702 and either pAS2563 or pAS2568 respectively as a template) into the same sites in pMW20. pAS2002 (YCplac22Yox1-PK) was constructed by excising a BamHI/XbaI fragment containing the Myc-tag and downstream region from pAS2563 and replacing this with a BglII/XbaI PCR product containing the Pk-tag (obtained using primer pair ADS2611/ADS2612 and pAS2003 [pRIP42-Pk-c] template).

pLacSpo12 (pAS2000) was created by inserting a HindIII/XhoI-cleaved PCR product extending from -440 bp to -80 bp upstream from the SPO12 transcriptional start site (using primers ADS2319/ADS2320 and yeast genomic DNA as template), into the same sites of pLacZi (Clontech). pLacSpo12QC (pAS2001), containing the SPO12 promoter with a mutated Yox1p binding site, was created by Quikchange site-directed mutagenesis using the primer pair ADS2325/ADS2326 on the template pAS2000. DNA binding sites used in gel retardation assays The following oligonucleotide pairs were used in generating doubled-stranded DNA binding sites for gel retardation analysis: Wild-type (WT) SPO12 promoter (ADS1236 5’TCGAGGTTAATATCTTTTCCTAATTTGGAAATATGTAAACAGGGC-3’ and ADS1235 5’-TCGAGCCCTGTTTACATATTTCCAAATTAGGAAAAGATATTAACC-3’),

the

mutant SPO12 promoter with a defective Yox1p binding site (ADS1585 5’TCGAGGTTAGGATCTTTTCCTAATTTGGAAATATGTAAACAGGGC-3’ and ADS1586 5’-

TCGAGCCCTGTTTACATATTTCCAAATTAGGAAAAGATCCTAACC-3’),

mutant

SPO12+2

promoter

the

(ADS2327

5’-

TCGAGGTTAATATCTCTTTTCCTAATTTGGAAATATGTAAACAGGGC-3’

and

ADS2328 5’-TCGAGCCCTGTTTACATATTTCCAAATTAGGAAAAGAGATATTAACC3’), the mutant SPO12+5 promoter (ADS2329 5’TCGAGGTTAATATCTCTCTTTTTCCTAATTTGGAAATATGTAAACAGGGC-3’ and ADS2330 5’TCGAGCCCTGTTTACATATTTCCAAATTAGGAAAAAGAGAGATATTAACC-3’), and the MCM3 promoter (ADS1707, 5’TCGAAAACAATTACTTTTCCTAAATGGGTAAAAACT-3’ and ADS1706 5’TCGAAGTTTTTACCCATTTAGGAAAAGTAATTGTTT-3’). The binding sites for immobilised template binding assays were made using a sequence

derived

from

the

SPO12

promoter

(biotin-labelled

ADS1389

5’-

TCGAGGTTAATATCTTTTCCTAATTTGGAAATATGTAAACAGGGC-3’ and unlabelled ADS1235). Yeast strains All yeast strains were haploids derived from the W303-1a genetic background. AP16 (MATa ade2-1 trp1-1 leu2-3,112 his3-11 ura3 FKH2-13Myc KanR) was described previously (Pic et al., 2000). The ESW3 strain (MATa ade2-1 trp1-1 leu2-3,112 his3-11 ura3 yox1::LEU2

yhp1::HIS3) was obtained from a heterozygous diploid containing deletions of the YOX1 and YHP1 genes. The gene deletions were made in the W303 strain background by replacing the wild-type gene with either a LEU2 or a HIS3 deletion cassette obtained by PCR using either pYDp-L or pYDp-H as template (Berben et al., 1991) and primer pairs YOX1-KO1/YOX1KO2 and YHP-F/YHP-R, respectively. ESW13 (MATa ade2-1 trp1-1 leu2-3,112 his3-11 ura3 yox1::LEU2 yhp1::HIS3 FKH2-13Myc KanR) was obtained from a diploid heterozygous for deletions of the YOX1 and YHP1 genes and for FKH2-13Myc KanR. To construct AP180 (MATa ade+ trp1-1 leu2-3,112 his3-11 ura3 FKH2-13Myc KanR NDD1-Pk::LEU2) a PstI/BamHI-digested PCR product encoding the C-terminal region of Ndd1p, obtained using primer pair Ndd1PstI/Ndd1BamHI and W303 genomic DNA as template, was ligated into a PstI/BamHI-digested derivative of pREP41-Pk C (Craven et al., 1998), in which the ars1 replication origin had been removed, to create pRIP41-Pk-Ndd1. This construct was then linearised at a unique BglII restriction site located towards the 3’ end of the NDD1 gene and used to create AP180 which expresses Pk epitope-tagged Ndd1p from its normal promoter and with the S. pombe nmt1 terminator. Strains containing integrated versions of the SPO12 promoter linked to LacZ were created in the AP16 or AP180 strains by introducing ApaIlinearised pAS2000 (wild-type SPO12 promoter) or pAS2001 (mutant SPO12 promoter). Integrants were isolated as Ura+ transformants.

Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) assays were done according to the protocol described at http://www.fhcrc.org/labs/breeden/Methods/chromatinIP.html followed by detection by real-time PCR (Darieva et al., 2006) using anti-Mcm1p (Santa Cruz , sc-12026), anti-myc (Santa Cruz) or anti-Pk antibodies (mouse anti V5-tag; Serotec) and the following primer pairs; ADS1930/1931 (SPO12), ADS1197/1198 (CLB2), ADS1928/1929 (MCM3) and ADS2323/2324 (PSPO12-LACZ) (details available on request). For re-ChIP assays, the reChIP experiment was performed essentially as described previously (Reid et al., 2003). After washing the protein-G–conjugated magnetic beads (Dynal) from the primary IP, the complexes were eluted from the beads by incubation with 10 mM DTT at 37°C for 30 min. The eluates were diluted 10 times with 1 × sonication buffer and subjected to IP with the second antibody. ChIP experiments were performed in ESW13 cells (with chromosomally Myc tagged Fkh2p) containing pYCPlac-YCplac22Yox1-PK. Anti-Myc (for Myc-Fkh2p) or anti-PK (for PK-Yox1p) antibodies were used for the first round of immunoprecipitation (IP),

and reciprocal antibodies were used for the second round of ChIP, along with anti-Mcm1p and control IgG. For re-ChIP experiments, the data were normalised against non-specific antibody controls for each antibody (taken as 1). The non-specific antibody controls were calculated; for anti-PK, from the signal achieved in the re-ChIP from an IgG-precipitated sample in the first round of IP; for anti-Myc, from the signal achieved in the re-ChIP from an Pkprecipitated sample in the first round of IP from W303 cells; for anti-Mcm1, from the average signal achieved in the re-ChIP from an Pk-precipitated sample in the first round of IP from W303 cells and an IgG precipitated sample.

Figure S1 (associated with Fig. 1). Mapping the Yox1p determinants for interaction with Mcm1p. (A) Schematic illustration of full-length and truncated Yox1p proteins. (B) Gel retardation analysis of the indicated recombinant Yox1p proteins binding to the SPO12 promoter fragment in the absence of recombinant Mcm1p(1-98). Increasing amounts of Yox1p proteins (1, 3, and 9 fold molar ratios) were added (indicated by a triangle above each set of lanes). The bands corresponding to complexes containing Yox1p (grey arrows) are indicated. Complexes which likely contain one (x1) or two (x2) Yox1p proteins are observed at high concentrations. (C-D) MBP-pulldown assays with MBP-Mcm1p(1-96), of in vitrotranslated (C) Yox1p(1-385) and Yox1p(151-274) or (D) Yox1p(1-385). Yox1p proteins were detected by phosphorimaging. The levels of MBP and MBP-Mcm1p(1-96) in the pulldown reactions are shown as coomassie-stained gels. Where indicated ethidium bromide was added to the binding reactions. Input lanes contain 10% total input protein.

Figure S2 (associated with Fig. 3). (A and B) Yox1p mutant proteins are defective for binding the MCM3 promoter in complex with Mcm1p. (A) Schematic representation of the SPO12 and MCM3 promoters illustrating the relative positions and sequences of the Yox1p, Mcm1p and Fkh2p binding sites. Sequences in common are highlighted in blue. Note that the MCM3 promoter does not contain a discernable Fkh2p binding site. (B) Gel retardation analysis of the indicated recombinant Yox1p proteins binding to the MCM3 promoter fragment in the presence of recombinant Mcm1p(1-96). Increasing amounts of Yox1p proteins (1, 4, and 10 fold molar ratios) were added (indicated by a triangle above each set of lanes). The bands corresponding to Mcm1p alone (black arrow), Yox1p-Mcm1p complexes (white arrow) and Yox1p alone (grey arrow) are indicated. (C-F) SRF-Phox1 and Mcm1pYox1p interactions differ. (C) Schematic illustration of Yox1p, indicating the location of the mutations introduced into the homeodomain (HD). (D and E) MBP-pulldown assays of the indicated in vitro-translated Yox1p(151-274) derivatives with MBP-Mcm1p(1-96). 10% input is shown. (F) Gel retardation analysis of the indicated in vitro-translated Yox1p proteins binding to the SPO12 promoter region in the presence of recombinant Mcm1p. The bands

corresponding to Mcm1p alone (black arrow), and Yox1p-Mcm1p complexes (white arrow) are indicated.

Figure S3 (associated with Fig. 4). (A) Cell cycle profiles of strains expressing either wildtype or the F155A mutant versions of Yox1p. DNA content analysis of yox1Δyhp1Δ cells containing plasmids encoding the indicated myc-tagged Yox1p derivatives Yox1p(WT) (pAS2563) or Yox1p(F155A) (pAS2568), following release from alpha factor block at the indicated times. The profiles are virtually identical in the first complete cell cycle following release (0-80 mins). (B) The timing of SPO12 expression is perturbed in the absence of Yox1p. Real-time RT-PCR analysis of CLB2, SWI5, CDC20 and SPO12 expression in yox1Δyhp1Δ cells containing either empty YCplac22 vector (grey lines) or the YCplac-based

plasmid pAS2563 (encoding wild-type Yox1p; black lines) following release from alpha factor block at the indicated times. Data are normalised to ACT1 levels. CLB2 and SWI5 expression is barely altered in the absence of Yox1p. However, the timing of SPO12 and CDC20 expression is clearly shifted with delayed expression apparent in the presence of Yox1p.

Figure S4 (associated with Fig. 5). (A-C) Yox1p and Fkh2p interact with a common binding region on Mcm1p. (A) MBP-pulldown assays of in vitro-translated

35

S-labelled full-length

Yox1p(1-385) or Fkh2p(1-862) with either wild-type (WT) or a V69E mutant version of MBP-Mcm1p(1-96). Yox1p and Fkh2p were detected by phosphorimaging (top panels) and the levels of WT and V69E versions of MBP-Mcm1p(1-96) in the pulldown reactions are

shown as coomassie-stained gels (bottom panels). (B) Gel retardation analysis of the indicated in vitro-translated Yox1p and Fkh2p proteins binding to the SPO12 promoter fragment in the presence or absence of the indicated Mcm1p(1-96) derivatives. The bands corresponding to Mcm1p alone (black arrow), Yox1p-Mcm1p or Fkh2p-Mcm1p complexes (white arrows) and Yox1p alone (grey arrow) are indicated. (C) Yox1p binding to SRF and Mcm1p differs. Gel retardation analysis of the indicated in vitro-translated Yox1p(151-274) and Fkh2p(1-458) proteins binding to the SPO12 promoter fragment in the presence or absence of either recombinant SRF or Mcm1p(1-96). The bands corresponding to Mcm1p or SRF alone (black arrow), and Fkh2p-SRF, Yox1p-Mcm1p or Fkh2p-Mcm1p complexes (white arrows), are indicated. (D-F) Yox1p and Fkh2p binding to Mcm1p are mutually exclusive. (D) Schematic illustration of full-length and truncated Fkh2p proteins. FKH and FHA represent the forkhead and forkhead-associated domains, respectively. (E and F) Gel retardation analysis of binding to the SPO12 promoter fragment in the presence of (E) in vitro-translated Fkh2p(1-458), recombinant Mcm1p(1-96) and increasing amounts of recombinant Yox1p proteins (1, 5 and 10 molar equivalents - indicated by a triangle above the lanes) or (F) recombinant Fkh2p(1458), recombinant Mcm1p(1-96) and increasing amounts of recombinant Yox1p proteins (1 and 2 molar equivalents-indicated by a triangle above each set of lanes; lanes 6 and 9 contain the same quantity as lanes 5 and 8 respectively). The concentration of Yox1p proteins in lanes 7-9 are 5 fold less than those in lanes 4-6 (indicated by ^). The bands corresponding to Mcm1p alone (black arrows), Yox1p-Mcm1p complexes (white arrows) and Fkh2p-Mcm1p complexes (grey arrows) are indicated. Complexes containing Yox1p alone are indicated by #. The asterisk represents a non-specific band arising from the rabbit reticulocyte lysate.

Figure S5 (associated with Fig. 6). The spacing of Yox1p and Mcm1p binding sites is important for Yox1p competition with Fkh2p binding to Mcm1p. A schematic representation of the wild-type and mutant SPO12 promoters is shown at the top of the figure. Additional nucleotides in the SPO12+2 site are underlined. Gel retardation analysis was performed with recombinant Yox1p(151-274) and Fkh2p(1-458) binding to the wild-type (WT) and the SPO12+2 spacer mutant version of the SPO12 promoter in the presence of recombinant Mcm1p(1-98). The bands corresponding to Mcm1p alone (black arrow), Yox1p-Mcm1p complexes (white arrow) and Mcm1p-Fkh2p complexes (grey arrow) are indicated.

Figure S6 (associated with Fig. 7). Western analysis of Yox1p expression in logarithmicallygrowing AP180 cells containing GAL1 promoter-driven plasmids expressing myc epitope tagged versions of either wild-type (WT- pAS2573) or F155A (pAS2574) Yox1p derivatives or empty vector (-). Cells were grown in raffinose (lanes 1-3) or galactose (lanes 4-6) containing media. The loading control is tubulin (bottom panel).

Supplemental References Berben, G., Dumont, J., Gilliquet, V., Bolle, P.A., and Hilger, F. (1991) The YDp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae. Yeast. 7, 475-477. Craven, R.A., Griffiths, D.J., Sheldrick, K.S., Randall, R.E., Hagan, I.M., and Carr, A.M. (1998) Vectors for the expression of tagged proteins in Schizosaccharomyces pombe. Gene. 221, 59-68. Gietz, R.D., and Sugino, A. (1988) New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene. 74, 527534. Reid, G., Hübner, M.R., Métivier, R., Brand, H., Denger, S., Manu, D., Beaudouin, J., Ellenberg, J., and Gannon, F. (2003) Cyclic, proteasome-mediated turnover of unliganded and liganded ERalpha on responsive promoters is an integral feature of estrogen signaling. Mol. Cell. 11, 695-707.