Supplemental Materials and Methods: Quantitative PCR (qPCR) - PLOS
Recommend Documents
ethyl acetate (300 mL x3) and the organic was washed with saturated Na2CO3 ..... cellulose semi-permeable membrane (molecular weight cut-off of 5000 Da).
594 or 555 Click-it EdU (Invitrogen) reaction cocktail following the manufacture's instructions or with Alexa-647 anti-rabbit for 1 hour at room temperature in.
in phosphate buffered saline (PBS) pH 7.2 (Gibco). Plates were then ... O+ human erythrocytes in RPMI 1640 medium (Gibco) containing 25 mM Hepes, 2 mM L-.
Cross-modal perception of human emotion in domestic horses. 3 ... Facial expressions were validated using Facial Action Coding System (FACS) descriptives2.
CpG1826 (TCCATGACGTTCCTGACGTT) was used. MEB-CpG was synthesized using MEB and terminal thiol-modified CpG. Thiol-modified DNA was.
Apr 1, 2011 - Currently automated capillary-electrophoresis equipment (e.g. Bioanalyzer 2100, Agi- ...... synthetic wine-like medium free of phenolic compounds known to ... Cell staining with ethidium monoazide bromide (EMA) has been.Missing:
hours later on a fluorescent plate reader according to manufacturers ... gene expression was examined using a mouse cell cycle microarray plates as per.
Secondary biotin-labeled horse anti-mouse antibody or goat anti-rabbit ...... 0.00. 0.00. 3.48. TM9SF4 transmembrane 9 superfamily protein member 4. 0. 1. 0. 0.
(IECHR) of The Maharaja Sayajirao University of Baroda, Gujarat, India, and was ... For the large-scale study genotyping was performed by the University of.
diana, USA). To allow beads adsorption to the optical dish, a dilution 1: ... seD = strel('diamond',20);. somaMask = imerode(mask,seD); mask=im2bw(mask,0.5);.
One study was a mail-only study with teachers selected randomly from a database maintained ... This meant that a small number of teachers in our sample identified their primary job ... Rather, it is preferred to make direct estimates of response.
website provides service for the search engine optimization and could tell us the ... tend to search online for information on how to prevent HFMD; these types of.
Supplemental Materials and Methods: Quantitative PCR (qPCR) - PLOS
After 40 cycles of PCR amplification, the Ct values were used to evaluate the presence of absence of C. difficile in the fecal materials. Ct values and the known ...
Supplemental Materials and Methods:
Quantitative PCR (qPCR) analysis of C. difficile in fecal contents To monitor the C. difficile colonization, we started collecting fecal pellets a day after C. difficile challenge until the hamsters start developing diarrheal symptoms. Collected fecal materials were stored in -80ºC until they were processed for DNA extraction. One gram of fecal content per hamster was used to prepare bacterial DNA using PowerFecal® DNA Isolation kit (MO BIO Carlsbad, CA, USA). The DNA concentration was measured by Nanodrop and was normalized to 100 ngs/ PCR reaction. The PCR detection of C. difficile was performed using previously standardized primers specific for C. difficile 16S rRNA. The qPCR was performed using iTaq Universal SYBR Green Supermix (BIORAD, USA). After 40 cycles of PCR amplification, the Ct values were used to evaluate the presence of absence of C. difficile in the fecal materials. Ct values and the known number of JIR8094 C. difficile cells (counts determined microscopically) were determined and are presented in supplemental table 2B. Ct value of 30 and 28 correlated with ~Log103 and Log104 bacterial cells per gram of fecal pellets. Similar Ct values were obtained when DNA was isolated from the quantified purified C. difficile spores. When the Ct values of the qPCR analysis were above 35 or if the amplicons were not detected, the samples were then regarded as C. difficile negative.
