Supplemental table 1: Blood parameters before and at ... - MDPI

Recommend Documents

SUPPLEMENTAL INFORMATION: Supplemental Table 1. Diet ... - MDPI

t-Butylhydroquinone. 0.008. 0.008. 0.008. Mineral Mix S10022M 35. 35. 35. Vitamin Mix V10037 10. 10. 10. Choline Bitartrate. 2.5. 2.5. 2.5. Fresh corn powder. 0.

Supplemental Tables Supplemental Table 1

Supplemental Table 1: Summary of the properties of periodic travelling waves in the single cells. ... separate two states of actin organization in living cells.

1 Supplemental Data Supplemental Table 1: snRNA

green, primates in red, rodentia in orange). ... Depending on the results, a maximum of 9 files compiling the results can be ... Lindblad-Toh K Wade CM Mikkelsen TS Karlsson EK Jaffe DB Kamal M Clamp M Chang .... Tasmanian devil. 3170.

Supplemental Table 1 Univariable and

artemether-lumefantrine*. Variable. No. Univariate analysis. Multivariate analysis. Population attributable riskâ . Crude HR (95% CI). P. Adjusted HR (95% CI). P.

Supplemental Table 1 - PLOS

Slc2a3. +. NM_133753. Errfi1. BE691546. C030046G05. NM_011607. Tnc. +. +. NM_133919. Aff1. BE956940. Lonrf3. NM_011627. Tpbg. +. NM_144549. Trib1.

Supplemental Table 1.xlsx

Gm7628. Olfr834. Gm7638. Olfr835. Gm7643. Olfr836. Gm765. Olfr837. Gm7665. Olfr843. Gm7670. Olfr844. Gm7671. Olfr845. Gm7676. Olfr846. Gm7698.

supplemental table 1

0.85. 1.29. 0.81. 0.97. 1.01. Os11g0135900|AK072447. OsTOM3. 0.90. 0.85. 1.26. 0.87. 1.01. 1.12. Os11g0151500|AK102457. OsENA1. 0.85. 0.83. 1.10. 0.98.

Supplemental Table 1: NHANES

Supplemental Table 1: NHANES (2011-2012) weighted means and (in parentheses) 95% confidence intervals around key risk factors for. CVD after adjustment ...

Supplemental Table 1

Supplemental Table 1. Agilent probes used for CIN70 analysis. Probe ID. Gene. Probe ID. Gene. A_23_P131865. AURKA. NM_014791_1_2145. MELK.

Supplemental Table 1

b) General characteristics of malignant NK cell lines. Cell line Gender. Age. Ethinicity Original diagnosis. CD56. CD3. EBV. IL2 dependency. NK92. M. 50.

Supplemental Table 1 - PLOS

Specific for D3-7, used for BAC library screening. 8. A3-1f. A3-1r. ATTGCGCAGATGGATACTAGCTG. GCTGCAAAAAGGTACCCTGTT. Specific for A3-1, used in ...

Supplemental Table 1

CCAAT/Enhancer Binding Protein Zeta. Transcription regulators. Creb1. BC021649. CAMP responsive element binding protein 1. Transcription regulators.

Supplemental Table 1 - PLOS

0, 0.5, 1, 1.5, 2, 4, 9, 12, 24, 48. Primary Human Macrophages. Clone cs. Mock. 0, 1, 2, 6, 12, 24. Primary Human Macrophages. Clone cs. Killed MPX. 0, 1, 2, 6, ...

Supplemental Table 1 - PLOS

Replicate 1 Passage 0 Passage 1 Passage 2 Passage 3 Passage 4 Passage 5 Passage 6 Passage 7 Passage 8 Passage 9. Total Reads. 41 578 802 8 425 ...

Supplemental Table 1 - Nature

Use of principal components analysis for generation of a composite RNA expression variable summarizing the coordinate expression levels of the top ten genes.

Supplemental Table 1

ICV 0.4 ug/day FGF21 WT.......... -0.7 +/- 0.3 g ...........ns. SC Vehicle WT.............. ................. -0.3 +/- 0.3 g ............ns. SC 1.6 ug/day FGF21 WT......................... .

Supplemental Table 1 - PLOS

Interleukin-4 (v1) 0.23. C-C motif chemokine 17 (v2) 0.18 8.3. Interleukin-6 0.35. C-C motif chemokine 2 0.23. Interleukin-7 0.20 26.0. C-C motif chemokine 21 ...

Supplemental Table 1

J., and Hunt, J. F. (2001) Crystal structures of the MJ1267 ATP binding ... Yuan, Y. R., Blecker, S., Martsinkevich, O., Millen, L., Thomas, P. J., and Hunt, ... Maloney, P. C., Post, K. W., Rajashankar, K. R., Rutter, M. E., Sauder, J. M., Shriver,

Supplemental table 1

Yan Xu, Thomas Gianfagna, and Bingru Huang. Supplemental table S1. Amino acid sequence of the trypsin-digested peptides (C.I. >95%) for shoot protein ...

Supplemental table 1

ACC TTT GTC TTC TGC ACG AAC CT AGT TCT TCA CTT CGC AAC GCA ifnÎ²1. GGCTTCCATCATGAACAACAGGT. AGGTGAGGTTGATCTTTCCATTCAG ifit2.

1 Supplemental Table S4 Parameters of LC-MS

with charge â¥2 from the survey scan isolation window. 1.6 m/z dissociation mode higher energy collisional dissociation (HCD) normalized collision energy. 28%.

Supplemental Table 1: Reported Appetite and Craving Visual ... - MDPI

40.2 Â± 2.7*. 40.3 Â± 2.8*. Non-Beef. 47.8 Â± 2.4. 40.7 Â± 2.6*. 43.0 Â± 2.6. 41.0 Â± 2.8*. Difference2. 3.4 Â± 3.3. -0.8 Â± 3.6. -2.9 Â± 3.7. -0.7 Â± 4.0. Fullness. Beef. 51.8 Â± 2.2.

Supplemental Table 1: Saturated, monounsaturated and n-6 ... - MDPI

6.9x10-4. 22:4 n-6. 0.47 ± 0.08. 0.45 ± 0.14. 0.69. 0.12 ± 0.04. 0.11 ± 0.03. 0.47. 0.55 ± 0.19. 0.38 ± 0.10. 0.019. 0.14 ± 0.01. 0.12 ± 0.01. 1.5x10-4. 22:5 n-6.

Supplemental materials Supplemental Table 1 ...

Orthopnea. -0.613. -0.240. -8.874.

Supplemental table 1: Blood parameters before and at ... - MDPI

Download PDF

1 downloads 0 Views 84KB Size Report

Comment

74.20 Â± 23.49. 73.79 Â± 32.74. 73.37 Â± 36.54. GGT (IU/L). 12.20 Â± 10.18. 11.43 Â± 6.82. 13.53 Â± 10.04. 14.02 Â± 11.29. Males(

Supplemental table 1: Blood parameters before and at conclusion of the last treatment phase for participants in the oligofructose (n = 45) and maltodextrin (placebo; n = 43) groups. Within group differences (before compared with after final treatment period) are marked with * (p