Technical University, Ankara, Turkey; M. Trommetter, Université Pierre .... Sardina MT, Ballester M, Marmi J, Finocchiaro R, van Kaam JB, Portolano B, Folch. JM.
Supplementary Material Tracing the history of goat pastoralism in North Africa: new clues from mitochondrial and Y chromosome DNA Filipe Pereira1,2, Sara Queirós2, Leonor Gusmão1, Isäac J.Nijman3,4, Edwin Cuppen3,4, Johannes A. Lenstra3, the Econogene Consortium*, Simon J.M. Davis4, Fouad Nejmeddine5 and António Amorim1,2 1
Instituto de Patologia e Imunologia Molecular da Universidade do Porto (IPATIMUP), Portugal
2
Faculdade de Ciências da Universidade do Porto, Portugal
3
Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands
4
Hubrecht Laboratory, Utrecht, The Netherlands
5
Instituto Português de Arqueologia, Lisboa, Portugal
6
Escola Superior de Saúde Jean Piaget. Portugal
*The Econogene Consortium consists of P. Ajmone Marsan, R. Negrini, E. Milanesi, M. Pellecchia, G. Canali, Università Cattolica del S. Cuore, Piacenza, Italy; M. Abo-Shehada, Jordan University of Science and Technology, Ibid, Jordan; P. Baret, A. Fadlaoui, Université Catholique, Louvain, Belgium; M. Bruford, T. Perez, Cardiff University, U.K.; R. Caloz, S. Joost, Swiss Federal Institute of Technology, Lausanne, Switzerland; A. Carta, T. Sechi, Istituto Zootecnico e Caseario per la Sardegna, Olmedo, Italy; M. Cicogna, P. Crepaldi, F. Fornarelli, S. Giovenzana, M. Marti, Università degli Studi di Milano, Italy; P. Dobi, A. Hoda, Faculty of Agriculture, Tirana, Albania; S. Dunner, J. Canon, P. García-Atance, Universidad Complutense de Madrid, Spain; G. D'Urso, S. Bordonaro, D. Marletta Università degli Studi di Catania, Italy; M.A.A. El-Barody, Minia University, Egypt; G. Erhardt, C. Peter, K. Gutscher, S. Lipsky, Justus-Liebig University of Giessen, Germany; O. Ertugrul, Ankara University, Turkey; L. Fesus, A. Istvan, Research Institute for Animal Breeding and Nutrition, Herceghalom, Hungary; A. Georgoudis, K. Karetsou, G. Kliambas, O. Kutita, J. al Tarrayrah, Aristotle University, Thessaloniki, Greece; G. Hewitt, S. Dalamitra, M. Taylor, L. Wiskin, University of East Anglia, Norwich, U.K.; C. Ligda, National Agricultural Research Foundation, Thessaloniki, Greece; R. Niznikowski, Ewa Strzelec, D. Popielarczyk, Warsaw Agricultural University, Warshaw, Poland; L.M. Van Cann, Utrecht University, The Netherlands; G. Obexer-Ruff, M.-L. Glowatzki, Universität Bern, Switzerland; F. Pilla, A. Angiolillo, E. Pietrolà, Università del Molise, Italy; P. Taberlet, G. Luikart A. Beja-Pereira, P. England, University Joseph Fourier, Centre National de la Recherche Scientifique, Grenoble, France; J. Roosen, M. Bertaglia, University of Kiel, Germany; R. Scarpa, University of York, U.K.; I. Togan, Middle East Technical University, Ankara, Turkey; M. Trommetter, Université Pierre Mendes, Grenoble, France; and A. Valentini, L. Pariset, I. Cappuccio, Università della Tuscia, Viterbo, Italy; A. Vlaic, University of Cluj-Napoca, Romania.
Table 1 – PCR amplification and single base extension (SBE) primers sequences used to genotype three SNPs (Lenstra et al. 2005) in the goat Y chromosome SRY gene. Primer SRYF SRYR SBE1 SBE2 SBE3
Sequence (5’ - 3’) CAAAGGCACGCTTTATCTCA TGCAATTTACAAAGAGGTGGAA TTGTTAAATGTACTTATTTGCCTTAG CTGGAAATAGCCACTATAGACAATA GACCAAAGAACAGAGCTTGTA
Table 2 – Mitochondrial DNA control region sequences from domestic goats used in the present study. GenBank accession number AB004077-AB004082 AB044295-AB044304 AJ317533-AJ317863 AB110552-AB110589 AY424903-AY424949 AY155674-AY156039 AY853278-AY860942 AY918001-AY918060 DQ089106-DQ089480 AY961629-AY961916 DQ121491-DQ121618 DQ188849-DQ188903 DQ241305-DQ241371 DQ521880-DQ521886
Reference Takada et al. 1997 Mannen et al. 2001 Luikart et al. 2001 Sultana et al. 2003 Amills et al. 2004 Joshi et al. 2004 Zhang et al. 2004 (GenBank direct submission) Azor et al. 2005 Chen et al. 2005 Pereira et al. 2005 Liu et al. 2005 (GenBank direct submission) Liu et al. 2005 (GenBank direct submission) Sardina et al. 2006 Das et al. 2006 (GenBank direct submission)
Table 3 – Mitochondrial haplogroup A sequences from 20 domestic goat populations worldwide used to calculate a multidimensional scaling (MDS) plot of pairwise FST genetic distances.
Population
n
Northwest Africa
72
Egypt Turkey Near East Portugal Spain Canary Islands Sicily
11 18 22 371 80 21 63
North Europe
17
France Switzerland Greece East Europe Mozambique South Africa
13 49 12 19 56 10
China
484
Mongolia Pakistan India
13 51 357
Southeast Asia
8
Origin of samples and references Morocco (this study, Luikart el al. 2001), Algeria (Luikart el al. 2001), Tunisia (Luikart el al. 2001) Luikart el al. 2001 Luikart el al. 2001 Saudi Arabia, Jordan, Iraq, Syria (Luikart el al. 2001) Luikart el al. 2001; Pereira et al. 2005 Luikart el al. 2001; Amills et al. 2004; Azor et al. 2005 Luikart el al. 2001; Amills et al. 2004 Sardina et al. 2006 Iceland, Norway, Sweden, Ireland, United Kingdom, Denmark, Germany and Poland (Luikart el al. 2001) Luikart el al. 2001 Luikart el al. 2001 Luikart el al. 2001 Slovenia, Romania and Ukraine (Luikart el al. 2001) Authors’ unpublished results Luikart el al. 2001 Luikart el al. 2001 and Chen et al. 2005; Zhang et al. 2004; Liu et al. 2005 (GenBank direct submission) Luikart el al. 2001 Takada et al. 1997; Luikart el al. 2001; Sultana et al. 2003 Luikart el al. 2001; Joshi et al. 2004 Malaysia, Vietnam and Laos (Mannen et al. 2001; Luikart el al. 2001)
Figure 1. Mismatch distributions for the Moroccan goat population. The numbers of mismatches are given on the horizontal axis with relative frequencies represented on the vertical scale. The mismatch observed mean and the Tau value (τ) are also shown.
0,18 0,16
Mean: 9.566 Tau (τ): 9.846
Frequency
0,14 0,12 0,1 0,08 0,06 0,04 0,02 0 0
2
4
6
8
10
12
14
16
Nº of nucleotide pairwise differences
18
Figure 2. Median-joining network depicting the relationships between mitochondrial haplotypes in the goat population from Morocco. A mitochondrial DNA control region segment from positions 15707 to 16187 was used. The area of the circles is proportional to the frequency of specimens in the sample.
Figure 3. Median-joining network depicting the relationships between mitochondrial haplotypes in goat populations from the Maghreb and the Iberian Peninsula. A mitochondrial DNA control region segment from positions 15725 to 16187 was used. The area of the circles is proportional to the frequency of specimens in the sample.
I
III
II
1 mutation
Morocco Algeria Tunisia Portugal Spain
Figure 4. Median-joining network depicting the relationships between mitochondrial haplotypes in goat populations from Morocco and the Canary Islands. A mitochondrial DNA control region segment from positions 15725 to 16187 was used. The area of the circles is proportional to the frequency of specimens in the sample.
Literature Cited Amills M, Capote J, Tomas A, Kelly L, Obexer-Ruff G, Angiolillo A, Sanchez A. 2004. Strong phylogeographic relationships among three goat breeds from the Canary Islands. Journal of Dairy Research 71:257-262. Azor PJ, Monteagudo LV, Luque M, Tejedor MT, Rodero E, Sierra I, Herrera M, Rodero A, Arruga MV. 2005. Phylogenetic relationships among Spanish goats breeds. Animal Genetics 36:423-425. Joshi MB, Rout PK, Mandal AK, Tyler-Smith C, Singh L, Thangaraj K. 2004. Phylogeography and origin of Indian domestic goats. Mol Biol Evol 21:454-462. Lenstra JA. 2005. Evolutionary and demographic history of sheep and goats suggested by nuclear, mtDNA and Y-chromosome markers. International Workshop on the role of biotechnology for the characterisation and conservation of crop, forestry, animal and fishery genetic resources. Torino. Italy Luikart G, Gielly L, Excoffier L, Vigne JD, Bouvet J, Taberlet P. 2001. Multiple maternal origins and weak phylogeographic structure in domestic goats. Proc Natl Acad Sci U S A 98:5927-5932. Mannen H, Nagata Y, Tsuji S. 2001. Mitochondrial DNA reveal that domestic goat (Capra hircus) are genetically affected by two subspecies of bezoar (Capra aegagurus). Biochemical Genetics 39:145-154. Pereira F, Pereira L, Van AB, Bradley DG, Amorim A. 2005. The mtDNA catalogue of all Portuguese autochthonous goat (Capra hircus) breeds: high diversity of female lineages at the western fringe of European distribution. Mol Ecol 14:2313-2318. Sardina MT, Ballester M, Marmi J, Finocchiaro R, van Kaam JB, Portolano B, Folch JM. 2006. Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage. Anim Genet 37:376-378. Sultana S, Mannen H, Tsuji S. 2003. Mitochondrial DNA diversity of Pakistani goats. Anim Genet 34:417-421.