Supplementary Materials: Enhanced Electrocatalytic Activity for ... - MDPI
Recommend Documents
Jing Li, Weijie Tang, Haidong Yang, Zhengping Dong, Jingwei Huang, Shuwen Li,. Jia Wang, Jun Jin*, and Jiantai Ma*. State Key Laboratory of Applied Organic ...
Cu2S electrodes for quantum dot-sensitized solar cells. Vu Hong ... particles electrodeposited for 10 min (FTO/Cu (10 min)) were dispersed sparsely over the FTO substrate, whereas ... SSCs), in which semiconductor quantum dots (QDs), such as CdS [2-
May 27, 2018 - sulfide electrode electrodeposited on a Ti interlayer-coated fluorine-doped tin oxide ... types of electrolyte(s) used (liquid, gel, and solid), and the counter electrode .... posited Cu films were immersed in a polysulfide aqueous sol
Experimental Section. Preparation of PS microsphere arrays: The SiO2 substrates (20 Ã 20 Ã 1.5 mm3) were ultrasonically cleaned in acetone (10 min), alcohol ...
The relationship between experimentally observed pKas and the log Pexp ... Table S1. The relationships between the independent variables (pKa, MV and log ...
Figure S1. PCR amplification of the mouse Omi/HtrA2 gene promoter. Omi/HtrA2 promoter fragments were amplified using F1âF5 as upstream primers and R as ...
Not Energy. Y. Y. Neutral. Tobias et al. 2012 [33] ..... read English, delivered at specified hospitals. Exclusion: ... spoke/read English, to deliver at either of 2 study.
concentration of 0.8 OD600 was found to be optimal for C43 by comparing the expression level of different host strain concentrations by adding inducer IPTG.
Pre-testing step: RT-qPCR analyses with the LightCycler 480 . .... 4364343) and nuclease-free water (5Prime ... Cq values were generated by the SDS software v2.3 and were exported for further calculations. ...... Remove the cartridge from the Droplet
Have you ever used an e-cigarette or other vaping device, even one or two times? 0 = No. 1 = Yes. Past month e-cigarette use. In the last 4 weeks, on how many ...
Mixed Gas Diffusion in the Polymer of Intrinsic Microporosity PIM-SBF-1. 21. (a). (b). SI Figure 4. Comparison of the increasing feed pressure as a function of time ...
Cesare Montecucco, Aram Megighian, and Ornella Rossetto. Figure S1. Paired pulse facilitation. Example of paired pulse facilitation following paired stimulation.
My knowledge about healthy eating comes from: (check all that apply). â¡ Nutrition education programs at school. â¡ From what I see on TV. â¡ Nutrition ...
Indole-Trimethoxyphenyl Conjugates. Michael M. Cahill, Kevin D. O'Shea, Larry T. Pierce,Hannah J. Winfield, Kevin S. Eccles, Simon E. Lawrence and Florence ...
loadings for all the intermediates of the catalyst synthesis. .... Bond, G.C. Heterogeneous Catalysis, Principles and Applications, 2nd ed.; Oxford University.
UV-Vis Spectroscopy. UV-Vis spectra of AgNWs dissolved in ethanol (PVP) and chloroform (C8-C18) have been recorded using a Shimadzu UV-2401PC ...
Nucleotide sequence of 16S RNA of Citrobacter freundii. TGCAAGTCGAACGGTAGCACAGAGGAGCTTGCTCCTTGGGTGACGAGTGGCGGACGG.
Aldrich) and stored at â80 °C until sequencing. Pyrosequencing .... Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput.
The mean registration error of the inspections of SB is slightly higher (around 0.25 ... geometric mean is slightly ahead of harmonic mean and product, in SB the ...
Supplementary Materials: Enhanced Electrocatalytic Activity for ... - MDPI
Supplementary Materials: Enhanced Electrocatalytic. Activity for Water Splitting on NiO/Ni/Carbon. Fiber Paper. Ruoyu Zhang, Hehe Wei, Wenjie Si, Gang Ou, ...
Materials 2017, 10, 15; doi:10.3390/ma10010015
S1 of S4
Supplementary Materials: Enhanced Electrocatalytic Activity for Water Splitting on NiO/Ni/Carbon Fiber Paper Ruoyu Zhang, Hehe Wei, Wenjie Si, Gang Ou, Chunsong Zhao, Mingjun Song, Cheng Zhang and Hui Wu
Figure S1. The photogarph of NiO loaded on carbon fiber paper after different treatment. (a) Atomic layer deposition (ALD)-NiO/C sample; (b) Ni/C sample; (c) NiO/Ni/C sample. The light color of practical carbon fiber paper is due to cover of clips during the ALD process. The alternate color of carbon fiber paper indicates changed samples after different treatment.
Figure S2. High-resolution transmission electron microscope (HRTEM) images of the ALD-NiO/C sample. (b,c) is a partially magnified section of (a).
Materials 2017, 10, 15; doi:10.3390/ma10010015
S2 of S4
Figure S3. The X-ray diffractometer (XRD) patterns of carbon paper.
Figure S4. Scanning electron microscope (SEM) images and electron dispersive X-ray spectrum (EDX) spectra of (a,d) for the ALD-NiO/C sample; (b,e) for the Ni/C sample, as well as (c,f) for the NiO/Ni/C sample.
Figure S5. X-ray photoelectron spectrometer (XPS) survey scan of NiO deposited on carbon fiber paper using the ALD technique.
Materials 2017, 10, 15; doi:10.3390/ma10010015
S3 of S4
Figure S6. The electrochemical impedance spectra (EIS) of ALD-NiO/C, Ni/C and NiO/Ni/C. Z’ represents real number and Z’’ represents imaginary number. Table S1. The resistance value of equivalent circuit. Rs represents solution resistance; Rct represents reactive resistance; CPE1 and CPE2 represent capacitance.
Sample ALD-NiO/C Ni/C NiO/Ni/C
Rs (ohm) 4.33 4.22 4.36
Rct (ohm) 42.8 15.4 17.2
CPE1 (mMho) 1.78 1.20 1.16
CPE2 (μMho) 143 176 162
Figure S7. Hydrogen evolution reaction (HER) of reduced NiO/C samples under different annealing temperatures, from 300 to 600 °C. (a) Linear Sweep Voltammetry (LSV) polarization in 1 M KOH with the scan rate of 5 mV·s−1; (b) the corresponding HER Tafel plot. All LSV curves are iR corrected. iR represents internal resistance in different solutions , it is a parameter.
Materials 2017, 10, 15; doi:10.3390/ma10010015
S4 of S4
Figure S8. SEM images of reduced NiO/C samples at (a) 300 °C; (b) 400 °C; (c) 500 °C; and (d) 600 °C H2-annealing temperature.
