Supplementary Materials: Spatial Temporal Dynamics and ... - MDPI
Recommend Documents
May 31, 2016 - We consider it cryptogenic south of Cape Hatteras, North Carolina, but non- .... Chesapeake Science 7: 223-224 ... Cohen CS, McCann L, Davis T, Shaw L, Ruiz G (2011) Discovery and significance of the colonial tunicate.
Not Energy. Y. Y. Neutral. Tobias et al. 2012 [33] ..... read English, delivered at specified hospitals. Exclusion: ... spoke/read English, to deliver at either of 2 study.
concentration of 0.8 OD600 was found to be optimal for C43 by comparing the expression level of different host strain concentrations by adding inducer IPTG.
Pre-testing step: RT-qPCR analyses with the LightCycler 480 . .... 4364343) and nuclease-free water (5Prime ... Cq values were generated by the SDS software v2.3 and were exported for further calculations. ...... Remove the cartridge from the Droplet
Have you ever used an e-cigarette or other vaping device, even one or two times? 0 = No. 1 = Yes. Past month e-cigarette use. In the last 4 weeks, on how many ...
Mixed Gas Diffusion in the Polymer of Intrinsic Microporosity PIM-SBF-1. 21. (a). (b). SI Figure 4. Comparison of the increasing feed pressure as a function of time ...
Cesare Montecucco, Aram Megighian, and Ornella Rossetto. Figure S1. Paired pulse facilitation. Example of paired pulse facilitation following paired stimulation.
My knowledge about healthy eating comes from: (check all that apply). â¡ Nutrition education programs at school. â¡ From what I see on TV. â¡ Nutrition ...
Indole-Trimethoxyphenyl Conjugates. Michael M. Cahill, Kevin D. O'Shea, Larry T. Pierce,Hannah J. Winfield, Kevin S. Eccles, Simon E. Lawrence and Florence ...
loadings for all the intermediates of the catalyst synthesis. .... Bond, G.C. Heterogeneous Catalysis, Principles and Applications, 2nd ed.; Oxford University.
UV-Vis Spectroscopy. UV-Vis spectra of AgNWs dissolved in ethanol (PVP) and chloroform (C8-C18) have been recorded using a Shimadzu UV-2401PC ...
Nucleotide sequence of 16S RNA of Citrobacter freundii. TGCAAGTCGAACGGTAGCACAGAGGAGCTTGCTCCTTGGGTGACGAGTGGCGGACGG.
Aldrich) and stored at â80 °C until sequencing. Pyrosequencing .... Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput.
The mean registration error of the inspections of SB is slightly higher (around 0.25 ... geometric mean is slightly ahead of harmonic mean and product, in SB the ...
Figure S2. Distribution of various geometries of the inosineâuracil (IâU) base pair observed in the single IâU systems as a result of correlation between ...
Rabies Virus Glycoprotein Gene Country Country Code Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH Philippines PH China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN Myanmar MM Thailand TH China CN Thailand TH China CN Indonesia ID Indonesia ID China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN
Host Species Dog Dog Dog Human Dog Dog Dog Dog Dog Dog Dog Vaccine Dog Dog Dog Dog Dog Human Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Dog Human Dog Dog Dog Dog Dog Dog Dog Dog Dog Dog Dog Dog Dog Dog Donkey Buffalo Dog Dog Ferret Badger Dog Ferret Badger
S2 of S4 China CN China CN China CN China CN China CN China CN China CN China CN China CN Korea KR Korea KR Korea KR China CN India IN USA US Brazil BR Brazil BR Japan JP China CN Japan JP France FR USA US USA US China CN China CN USA US USA US USA US USA US Mexico MX Brazil BR Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Rabies Virus Nucleoprotein Gene Country Country Code China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN
Dog Dog Dog Dog Dog Dog Human Equine Dog Cattle Raccoon dog Raccoon dog Raccoon dog Human Human Human Dog Vaccine Rat Vaccine Vaccine Vaccine Vaccine Human Vaccine Gray fox Bat Bat Bat Human Human Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger
Host Species Dog Dog Dog Human Dog Dog Dog Dog Dog Human Dog Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Vaccine
S3 of S4 China CN China CN Philippines PH Philippines PH China CN China CN Thailand TH Thailand TH Cambodia KH Viet Nam VN Viet Nam VN Indonesia ID China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN China CN USA US USA US USA US USA US USA US Mexico MX USA US Mexico MX Korea KR Korea KR Korea KR India IN India IN Canada CA Russian RU Russian RU Guinea GN Mexico MX Japan JP Japan JP USA US USA US France FR France FR Japan JP China CN Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Taiwan TW Rabies Virus Matrix Protein Gene Country Country Code China CN China CN China CN China CN
Dog Vaccine Dog Human Dog Dog Dog Human Dog Dog Dog Dog Dog Dog Dog Donkey Buffalo Ferret Badger Dog Dog Dog Human Human Gray fox Bat Bat Bat Bat Human Bat Bat Raccoon dog Cattle Dog Human Human Ontario fox Wolf Human Dog skunk Vaccine Vaccine Vaccine Vaccine Vaccine Vaccine Vaccine Rat Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Host Species Dog Pig Dog Human
S4 of S4 China China China China China China China China China China China China Thailand Thailand Thailand Bangladesh India India Korea Korea Brazil Japan China Russian India France USA China Japan Japan USA Mexico USA USA USA Taiwan Taiwan Taiwan Taiwan Taiwan Taiwan Taiwan Taiwan Taiwan Taiwan
CN CN CN CN CN CN CN CN CN CN CN CN TH TH TH BD IN IN KR KR BR JP CN RU IN FR US CN JP JP US MX US US US TW TW TW TW TW TW TW TW TW TW
Vaccine Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Ferret Badger Donkey Ferret Badger Dog Dog Dog Human Human Dog Goat Human Human Raccoon dog Raccoon dog Gray fox Vaccine Rat Dog Dog Vaccine Vaccine Ferret Badger Vaccine Vaccine Procyon lotor Human Gray Fox Bat Bat Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger Formosan Ferret Badger
