SUPPORTING INFORMATION Supplementary Table 4 - Table ... - PLOS

Recommend Documents

Supporting information Supplementary Table S1

CKW-7. Aquaspirillum delicatum strain. LMG 4328 (AF078756). 96. Proteobacteria. (Beta). 574. 146. 1. CKW-8. Acidovorax facilis strain LMG 2193. (EU024133).

Supporting Information Table S2 - PLOS

0.36. 0.35. 0.34. 0.49. 0.42. 0.78. 0.80. 0.51. 0.27. 0.41. 0.29. 0.27. 0.42. 0.32 rs4836493. Chr 5,. 129,499,621. CSS3. GWAS. A/G. 0.11/0.07. Allelic. Additive.

Supplementary Information Table S4 - PLOS

contributions, we again found significant differences in the first two stages (Z ... (Z = â1.97,P = 0.024), stage three (Z = â1.78,P = 0.038), and not in stage four (Z ...

Supplementary Information Table S2 - PLOS

decisions, earn some more money in addition to the 5 Euro, which you can ... of the 20 points you want to contribute to the project, and how many points you ...

Supplementary information Supplementary Table

Animals and Samples collection. Frozen postmortem brain tissue samples from rhesus macaque were provided by Kunming. Primate Research Center of the ...

SUPPORTING INFORMATION Supplementary Table 2 - Table S2: T ...

Supplementary Table 2 - Table S2: T-test to verify the significance of the ... Levene's Test for. Equality of Variances. T-test for Equality of Means. F. Sig. t. Df. Sig.

Supplementary Table 4

sciences. Wex, Thomas et al. (2009). Zonulin is not increased in the cardiac and esophageal mucosa of patients with gastroesophageal reflux disease. Peptides ...

Supplementary Table 4

M. 11. 44. 45. 46. 47. 1 -- 0.54. 0.85. 0.09. 0.83. 0.83. 0.59. 0.73. 0.71. 0.61. 0.69. 0.27. 0.28. 0.50. 0.80. 0.30. 0.49. 0.15. 0.85. 0.98. 0.09. 0.65. 0.07. 0.64. 0.80.

Supplementary Table 4

PSMA4. 19. 42. RAN GTPase activating protein 1. P62826. RANGAP1. 40. 40. Other. Supplementary Table 4. KEGG pathway classification of identified proteins.

Supporting Table S5 - PLOS

Table S5: The coordinates and sequences of the 20 bp sequence tags flanking each of the 114 a-right"128T repeats in strains Z2491, MC58 and FAM18.

Supporting Table 3 - Plos

Akap4 (site 1) Fw 5'- TCAGAGCCAGCAGGAAACAG -3'. Rev 5' - CCCTTTAGATGGAAGGGGGC -3'. Akap4 (site 2) Fw 5'- GAGGCGTGTGCAAGGTAGAT -3'.

Supporting Table 1 - PLOS

Bim. TGCGCCCGGAGATACGGATT. TGGTCTTCAGCCTCGCGGTA. Bmf. TGTCATGCTGCCTTGTGG. TGAGCCTGCAGGGAAACTG. NOX4.

Supplementary Table S1 - Plos

phosphatidylinositol-4-phosphate 5-kinase, type I, alpha ... coatomer protein complex, subunit alpha ... heat shock protein 90kDa beta (Grp94), member 1.

Supplementary Table 2 - PLOS

31.1 (8.6). 0.43. Age at symptoms onset. (mean years, SD). 29.0 (6.7) ... RRMS: relapsing remitting multiple sclerosis; SD: Standard deviation; GD: Gadolinium, ...

Supplementary Table 6 - PLOS

g o n is t. E s tra d io l. 0 .7. 0. 2. 2. 0 .8. 0 .0. 0. 4. 0 .8. 5. 2. 2 .7. 0. 0 .0. 2. 0. P ro g e s te ro n e. 0 .8. 1. 2. 1. 2 .7. 0 .0. 0. 5. 0 .8. 6. 6. 0 .2. 4. 0 .0. 1. 6. C o rtic o s te.

Supplementary Table S3 + + + + + + + + + + - PLOS

Supplementary Table S3. Contigs (grouped by Oases locus) siRNA signature Vir1 blastx hits (Metavisitor settings) nr protein database hits using blastx (Word ...

Supplementary Table 1 - PLOS

Lab stock. IJ640 nod1::hphR leu1.32 h-. This study. JHS335 pom1::ura4+ leu1.32 ura4-D18 h+. Lab stock. JM569 cdr2::natR h-. P. Nurse. JM555 cdr1-kanR h-.

Supplementary table 1 - PLOS

2.2. 2.80E-02 transcription regulator, LysR family lp_2704 (purR1). 2.6. 2.71E-05 pyrimidine operon regulator. Transport and binding proteins lp_2992 (mntH2).

Supplementary Table 1 - PLOS

Supplementary Table 1 mutation pattern full model independent model. 3. Ð. (96). (6, 4, 4). ApCPA â ApCPA. (1). (1, 1, 1). ApÐ¡pÐ¡ â ÐÑÐÑÑ. (2). (1, 1, 2).

Supplementary Table S2 - PLOS

metastasis associated lung adenocarcinoma transcript 1 (non-protein coding). AW005982 chr11q13.1 ... eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa. NM_001415 .... NOL1/NOP2/Sun domain family, member 4. BC016907.

Supplementary Table S3 - PLOS

NCO5. (Region 2). 5'-TGAGTTATGCTAGGAAGGTCAGGCTTCT-3' 5'-GGCATATGGCTCTCTGAGGAAAACAC-3' 10955102 - 10958453. DDX27. (Region 3).

Supplementary Table S3 - PLOS

Ank2. FBgn0085445. CG34416. CG13532. FBgn0034788. CG13532. SP2353. FBgn0034070. CG8403. CG3703. FBgn0040348. CG3703 scrt. FBgn0004880.

Supplementary Table 2 - PLOS

Table 2: The distribution of L1 elements in mouse chromosomes and ... individual chromosome was analyzed by cross correlation coefficient test (Pearson's test). ... per chromosome, the determination coefficient (R2) test and Chi-square test.

Supplementary Table 4RevisedVersion - Plos

Parameter estimates, 95% Confidence Interval (CI) and p-values of the best Ordinary Least Square (OLS) model for the 4498 municipalities. covariates classe.

SUPPORTING INFORMATION Supplementary Table 4 - Table ... - PLOS

Download PDF

2 downloads 0 Views 20KB Size Report

Comment

Supplementary Table 4 - Table S4: Results of Mann-Whitney U test (mean rank and sum of ranks) for comparison of bacterial density (cells/mL X 108) in the ...

SUPPORTING INFORMATION

SUPPLEMENTARY TABLES

Supplementary Table 4 - Table S4: Results of Mann-Whitney U test (mean rank and sum of ranks) for comparison of bacterial density (cells/mL X 10 8) in the saliva of children and adolescents from G-DS and G-ND

Mann-Whitney U Wilcoxon W Z Asymp. Sig. (2-tailed)

CARE 281.50 0 746.50 0 -2.493

B/TAF O 413.00 0 878.00 0 -0.547

POGI 298.50 0 763.50 0 -2.241

TREII 299.50 0 764.50 0 -2.228

FUS 281.50 0 746.50 0 -2.493

PINT 228.50 0 693.50 0 -3.277

PNG 270.00 0 735.00 0 -2.664

ACAC 321.50 0 786.50 0 -1.901

DAPI 336.00 0 801.00 0 -1.685

Sum of probes 335.00 0 800.00 0 -1.700

% total 309.00 0 774.00 0 -2.085

0.013

0.584

0.025

0.026

0.013

0.001

0.008

0.057

0.092

0.089

0.037

a Grouping Variable: group