www.sciencemag.org/cgi/content/full/316/5824/604/DC1
Supporting Online Material for Regulation of the Germinal Center Response by MicroRNA-155 To-Ha Thai, Dinis Pedro Calado, Stefano Casola, K. Mark Ansel, Changchun Xiao, Yingzi Xue, Andrew Murphy, David Frendewey, David Valenzuela, Jeffery L. Kutok, Marc Schmidt-Supprian, Nikolaus Rajewsky, George Yancopoulos, Anjana Rao, Klaus Rajewsky* *To whom correspondence should be addressed. E-mail:
[email protected]
Published 27 April 2007, Science 316, 604 (2007) DOI: 10.1126/science.1141229
This PDF file includes: Materials and Methods Figs. S1 to S9 References
Thai et. al. (SOM)
Supporting Online Material for Regulation of the Germinal Center Response by microRNA-155
To-Ha Thai, Dinis Pedro Calado, K. Mark Ansel, Stefano Casola, Changchun Xiao, Yingzi Xue, Andrew Murphy, David Frendewey, David Valenzuela, Jeffery L. Kutok, Marc Schmidt-Supprian, Nikolaus Rajewsky, George Yancopoulos, Anjana Rao and Klaus Rajewsky*
*
To whom correspondence should be addressed. E-mail:
[email protected]
This PDF file includes Materials and methods Figures S1 to S9 References
1
Thai et. al. (SOM)
Supporting Online Materials Materials and Methods Generation of mutant mice Knockout mice: bic/miR-155 knockout/lacZ reporter mice were generated using the BAC-based targeting vector technology (Velocigene) (S1). Briefly, 0.97 kb of bic exon 2 was replaced by an in frame linear reporter cassette in which the lacZ reporter gene was in tandem with the NeoR gene flanked by loxP sites, allowing bic promoter to control lacZ gene expression (Fig. S1A). Screening of ES cell clones was done using loss-of-native-allele assay as described (S1). Knockout mice were on mixed 129SV X C57BL/6 genetic background. Knock-in mice: Conditional mir-155 transgenic mice were generated by knocking the bic gene, preceded by the CAG promoter and a transcriptional STOP cassette, into the Rosa26 locus (Fig. S2A), as previously described (S2). An frt-flanked IRES-EGFP cassette was placed downstream of the miR-155 gene before and upstream a polyadenylation signal (pA). Mice were generated using the tetraploid embryo complementation technology (S3, S4). Knock-in mice were on a mixed BALB/c X C57BL/6 genetic background. Homozygous mutant of both strains were born at Mendelian ratios, were fertile and had no obvious aberrant phenotype. All mice were bred and maintained in specific pathogen-free conditions; all mouse protocols were approved by the Harvard University Institutional Animal Care and Use Committee and by the CBR Institute for Biomedical Research.
2
Thai et. al. (SOM)
RT-PCR Total RNA, from FACS sorted progenitor B-cells or MACS purified mature spleen B-cells, activated and unactivated, was prepared with Trizol (Invitrogen, Carlsbad, CA), treated with DNaseI (New England Biolabs, Ipswich, MA) and reverse-transcribed, according to manufacturer’s recommendations, with oligo-(dT)20 and cloned AMV Reverse Transcriptase (Invitrogen). Transcripts were amplified from cDNA with the following primers:
for bic
forward, 5′−cctcatgaaaccagctcatctg−3′, reverse 5′−ctggttgaatcattgaagatgg−3′; for β-actin forward, 5′−cctaaggccaaccgtgaaaag−3′, reverse 5′−tcttcatggtgctaggagcca−3′. bic PCR was done under the following conditions in 25 µl volume: 0.2 mM dNTPs, 0.1 µM primers, 1.25 U Eppendorf taq polymerase (Eppendorf, Westbury, NY) in PCR buffer (10X 100mM Tris, pH 8.3, 35 mM MgCl2 and 750 mM KCl); 94°C for 2 min, then 30 cycles of 94°C for 1 min, 65°C for 1 min, 72°C for 30 sec, followed by 72°C extension for 10 min. For calcineurin inactivation, cells were pre-treated with 2µM cyclosporine A (CSA, Calbiochem, San Diego, CA) in culture medium for 15 mins before stimulation and PCR. TNF, LT-α and LT-β messages were amplified from cDNA with the following primers: TNFforward 5′−aaagcatgatccgcgacgtggaac−3′, TNF-reverse 5′−ctgggagtagacaaggtacaacccatcg−3′; LT-α-forward 5′−acactgctcggccgtctccacctct−3′, LTα-reverse 5′−gaaaagagctggacctcgtgtgcc−3′; LT-β-forward 5′−tgcctatcactgtcctggctgtgc−3′, LTβ-reverse 5′−aacgcttcttcttggctcgcctcc−3′. PCR conditions were 35 cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 1 min. Northern blots Total RNA (5 to 20 µg) was loaded and separated on a denaturing 12-15% polyacrylamide gel and transferred electrophoretically to a GeneScreen Plus or Nytran SuPerCharge membrane (Schleicher and Schuell, Keene, NH). Membranes were UV-crosslinked. Probes were prepared
3
Thai et. al. (SOM)
by T4 polynucleotide kinase labeling of antisense oligonucleotides with γ32P dATP. Hybridization was performed with UltraHyb Hybridization buffer (Ambion, Austin, TX) or Denhardt's solution at 37-42°C with the following miR-155 probe: 5′−cccctatcacaattagcattaa−3′. Blots were washed at room temperature once with 2X SSC without SDS for 30 min. Radiolabeled Decade RNA markers (Ambion) were loaded as size markers. tRNA and 5S RNA stained with ethidium bromide served as a sample loading control. For reuse, blots were stripped by boiling in 0.1 × SSC/0.1% SDS twice for 10 min and reprobed. Flow cytometry Single-cell suspensions prepared from various lymphoid organs were stained with the following monoclonal antibodies conjugated to phycoerythrin (PE), Peridin-Chlorophyll (PerCP), allophycocyanin (APC), or biotin: anti-CD19 (ID3), FAS (anti-CD95), B220/CD45R (clone RA3-6B2) (all from BD Pharmingen), and anti-CD38 (clone 90, eBioscience). All samples were acquired on a FACSCalibur (BD Biosciences, San Jose, CA), and results were analyzed with FlowJo (Tree Star, Ashland, OR) and CellQuest (BD Biosciences) software. For detection of β-galactosidase activity, cells were stained with the β-galactosidase substrate fluorescein di-β-D-galactopyranoside (FDG) using the FluoReporter® lacZ Flow Cytometry kit, according to manufacturer’s recommendations (Molecular Probes/Invitrogen). Data were acquired with the FACSCalibur cytometer, and analyzed using the CellQuest software. GC (CD19+CD38loFashi) and non-GC (CD19+CD38hiFas−) B-cells were sorted on the FACSAria BD, using the DIVA version 5.0 software.
4
Thai et. al. (SOM)
Immunization and ELISA Mice were immunized with 100 µg of T–dependent (TD) antigen NP-CCG (4-hydroxy-3nitrophenylacetyl chicken γ-globulin, BiosearchTechnologies, Novato, CA) in Imject Alum (Pierce Biotechnology, Rockford, IL) intraperitoneally. At day 7 or day 14, mice were bled or sacrificed for analyses. Serum samples were analyzed by ELISA with coating and detection antibodies generated previously in the laboratory (S5) or purchased from Southern Biotech (Birmingham, AL) and Biosearch Technologies. In vitro B-lymphocyte activation MACS-purified CD19+ B-cells were activated in vitro at a density of 5x105 cells/ml either with 20 µg/ml of LPS (Sigma), 2 µg/ml of αCD40 (1C10, eBioscience) or 10 µg/ml of goat anti-mouse IgM, µ chain specific F(ab’)2 fragment (Jackson Immunoresearch, West Grove, PA) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, L-glutamine, penicillin-streptomycin, nonessential amino acids, sodium pyruvate, HEPES and 2-mercaptoethanol (Invitrogen). Proliferation assay Purified CD19+ B-cells were labeled with 1nM CFSE for 10 min at 37°C in 5% CO2, followed by 2 washes with culture medium. Labeled cells were then activated as above for 3 days. Proliferation was monitored by FACSCalibur, and data were analyzed using FlowJo software. Intracellular cytokine staining Unstimulated or two- to three- day stimulated mature spleen CD19+ B-cells were treated with PMA (10-20 nM) and ionomycin (1 µM) for 6 h (Sigma-Aldrich, St. Louis, MO). Cytokine secretion was blocked for 4 h with 5 µg/ml brefeldin-A (Sigma). Cells were then fixed in 2% formaldehyde and permeabilized with 0.5% of saponin (Sigma). After CD16/CD32 (FcγIII/II
5
Thai et. al. (SOM)
Receptor) blockage with 2.4G2 antibody (BD Pharmigen) cells were stained with either antimouse TNF-PE (MP6-XT22) from BD Pharmigen or anti-mouse IL-10-APC (JES5-16E3) antibody (eBioscience). Data acquisition was performed on a FACSCalibur cytometer with CellQuest software, and analyzed using FlowJo software. Fluorescence intensities in one- and two-dimensional histograms were presented on a log10 scale. Cytokine detection in supernatants Cytokine quantification in supernatants of both two to three days activated or non-activated CD19+ B-lymphocytes cultures was determined using the Beadlyte® mouse multi-cytokine detection system (Upstate Biotechnology, Charlottesville, VA), according to the manufacturer’s protocols.
Data acquisition was performed on a Luminex® 200™ IS analyzer (Luminex
Corporation, Austin, TX). TH1/TH2 differentiation and FACS analyses Purification of CD4+ T-cells from peripheral lymph nodes, induction of Th1/Th2 differentiation, and restimulation for flow cytometric analysis of intracellular cytokine staining were performed as described (S6). Briefly, CD4+ T-cells were purified (>95%) from peripheral lymph nodes by magnetic bead selection (Dynal, Invitrogen). 1x106 cells were stimulated in 12-well tissue culture plates with plate-bound anti-CD3 (2C11) and anti-CD28 (37.5, both from BD Biosciences) antibodies under Th1 (IL12, anti-IL4), Th2 (IL4, anti-IFN-γ, anti-IL-12), ThN conditions (nonpolarizing; no addition of exogenous cytokines or antibodies), or ThN with a limited quantity of IL-4 (12.5 U/ml) for 50 hours, then removed to uncoated flasks and cultured in the same cytokine conditions with the addition of recombinant human IL2 (20 U/mL; NCI Biological Resources Branch, Frederick, MD) for 3 days. For determination of cytokine production, cells were restimulated with PMA and ionomycin (Sigma-Aldrich) for 6 hours, with
6
Thai et. al. (SOM)
the addition of brefeldin-A (5 µg/mL, Sigma-Aldrich) during the final 2 hours. Restimulated cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) for 8 minutes at room temperature, stained in permeabilization buffer (PBS, 1% w/v bovine serum albumin, 0.1% w/v sodium azide, 0.5% w/v saponin), and analyzed by flow cytometry. Immunohistochemistry 4µM-thick paraffin sections from lymphoid organs of wild-type and mutant mice were placed in room temperature acetone soon after cutting and, then stored at −80°C. Before use, slides were placed in −20°C acetone for 2 minutes and left to air dry for 20 minutes at room temperature. Slides were blocked with Peroxidase block (part of the Dako Envision Kit cat # K4011) for 5 minutes. Slides were then incubated sequentially with primary Ab for 1 hour, secondary Ab for 30 minutes, and if necessary with tertiary Ab for 30 minutes. Slides were developed with DAB for 5 min. All the slides were then enhanced in a DAB enhancer (Zymed Laboratories, Carlsbad, CA.) for approximately 10 seconds and counterstained with Hemotoxylin. The following reagents were used: PNA (Vector Laboratories, Burlingame, CA) and Hemotoxylin (Sigma). The samples were analyzed using an Olympus BX41 microscope with the objective lens of 40X/0.75 Olympus UPlanFL and 2X/0.05 plan (Olympus, Melville, NY). Pictures were taken using Olympus QColor3 and analyzed with acquisition software QCapture v2.60 (QImaging, Burnaby, BC Canada) and Adobe Photoshop 6.0 (Adobe, San Jose, CA). Somatic hypermutation analysis The mutational status of the VH186.2 gene was analyzed as described (S7). Briefly, GC (CD38loFAShiCD19+) and naïve (CD38+FASloCD19+) B-cells were sorted from spleen of bic/miR-155 knock-out and wild-type littermate mice 12-14 days after immunization with 100µg
7
Thai et. al. (SOM)
NP-CGG. Genomic DNA from 104 cell equivalents was subjected to a two-round genomic PCR amplification protocol using the Expand High Fidelity PCR system (Roche, Nutley, NJ) and primers previously described (S7). PCR fragments corresponding to the VH186.2 gene were cloned into the pGEM-T easy (Promega) and sequenced. Sequence analyses were performed with the help of the DNASTAR Lasergene software. Statistics P values were determined by applying Student’s two-tailed t-test for independent samples, assuming equal variances on all experimental data sets, using the online t test calculator from GraphPad Software (http://graphpad.com/quickcalcs/ttest1.cfm). Dr. Paul Catalano provided additional advices on statistical analyses.
8
Thai et. al. (SOM)
Fig. S1. Generation of bic knock-out mice. (A) VelociGene technology was used to delete 0.97 kb of exon 2, and replace it with a cassette containing a LacZ reporter (encoding β-galactosidase) followed by a neomycin resistance gene (S1). The LacZ reporter allows the detection of the transcriptional activity of the bic promoter. (B) Staining for lacZ activity by FACS shows that bic promoter is predominantly active in mLNs GC B-cells as compared to their non-GC B-cell counterparts. (C) miR-155 is undetectable in anti-IgM activated bic/miR-155−/− spleen B-cells (lane 2) compared to wild-type controls (lane 1).
9
Thai et. al. (SOM)
Fig. S2. Generation of a conditional bic/miR-155 allele in the ROSA26 locus. (A) Schematic representation of the targeting strategy (S2). Probes A and B used for Southern blot analysis are represented by black bars. (B) Southern blot analyses of targeted ES clones. Genomic DNA from wild-type (lane 1) and one representative targeted ES clone (lane 2) was digested with EcoRI (left panel) or BglI (right panel) and probed with the external probe A (left panel) or with the internal probe B (right panel), Ex1-3: ROSA26 exons 1-3; SA: splice acceptor; DT: diphteria toxin gene. (C) bic/miR-155 expression is detected by EGFP expression in mLNs. (D) Resting spleen B-cells from B-cellmir155 constitutively express mir-155 in the absence of any stimulation (lane 2), while wild-type resting spleen B-cells do not (lane 1).
10
Thai et. al. (SOM)
Fig. S3. Representative analysis of GC B-cells in wild-type and bic/miR-155 mutant strains. CD19-gated B-cells were distinguished in naïve and GC cells based on Fas and CD38 expression. Percentages of GC B-cells in the indicated organs of mutant and wild-type animals are displayed. (A) mLNs, (B) PPs and (C) spleen.
11
Thai et. al. (SOM)
Fig. S4. bic/miR-155 regulates the GC response in mLNs. (A) FACS analyses show that bic/miR-155 deficient mice have a lower percentage of spontaneous GC B-cells than controls, in mLNs. In contrast, in mice expressing miR-155 constitutively in B cells, the percentage of GC B-cells is higher compared to controls. (B) Immunohistochemistry was performed on mLN sections from wild-type and knock-out mice to detect GCs (PNA+,brown; blue, hemotoxylin), n=3 mice per group. Arrows depict GCs.
12
Thai et. al. (SOM)
Fig. S5. bic/miR-155 induction through the BCR is dependent on calcineurin/NFAT signaling, while its induction through TLRs via Myd88 is dependent on NEMO signaling. (A) Splenic Bcells from normal mice were treated with 1 µM of cyclosporine A (CSA) or left untreated before activation with various stimuli. On day 2, cells were collected, and total RNA was extracted and reverse-transcribed. RT-PCR analyses were performed as in Fig. 1C. (B and C) Spleen B-cells from different mutant mice were activated with various stimuli. On day 1, cells were collected, RNAs were extracted and cDNA was prepared. RT-PCR and Northern analyses to detect bic expression were performed, as in Fig. 1C and D. Data are representative of 3 independent experiments.
13
Thai et. al. (SOM)
Fig. S6. MiR-155 is transiently induced in activated CD4+ T-cells. Wild-type peripheral lymph node CD4+ T-cells were activated in vitro with plate-bound anti-CD3 and anti-CD28 for various time points. Cells were collected, and RNA extraction and Northern blots were done as in figures 1D and S5.
14
Thai et. al. (SOM)
WT B-cellmiR-155 bic/miR-155−/−
Day 7 after NP-CGG immunization
Day 14 after NP-CGG immunization
Fig. S7. Absolute numbers of spleen GC B-cells from day-7 and -14 NP-CGG immunized mice. Numbers(±SEM) were derived from the values shown in figure 2B.
15
Thai et. al. (SOM)
Fig. S8. bic/miR-155−/− spleen B-cells proliferate normally upon activation. MACS-purified CD19+ spleen B-cells from bic/miR-155−/− mice were first stained with CFSE and then cultured in the presence of LPS, anti-IgM (Fab)’2 and CpG. After 3 days, cells were collected and analyzed by FACS. Data are representative of 4 independent experiments.
16
Thai et. al. (SOM)
Fig. S9. bic/miR-155−/− T-cells show a TH2 cytokine bias. Cells prepared as in figure 4A, were differentiated under the influence of a limited quantity of IL-4 (12.5 U/ml) (mean±SD, 4 knockouts and 3 wild-types, from 2 independent experiments).
17
Thai et. al. (SOM)
Supporting Online References S1. S2. S3. S4. S5. S6. S7.
D. M. Valenzuela et al., Nat Biotechnol 21, 652 (Jun, 2003). Y. Sasaki et al., Immunity 24, 729 (Jun, 2006). J. Seibler et al., Nucleic Acids Res 31, e12 (Feb 15, 2003). J. Wang, J. Mager, E. Schnedier, T. Magnuson, Mamm Genome 13, 493 (Sep, 2002). H. C. Patterson, M. Kraus, Y. M. Kim, H. Ploegh, K. Rajewsky, Immunity 25, 55 (Jul, 2006). K. M. Ansel et al., Nat Immunol 5, 1251 (Dec, 2004). G. Esposito et al., Proc Natl Acad Sci U S A 97, 1166 (Feb 1, 2000).
18
