Suppression of Leptin Receptor Messenger Ribonucleic Acid and ...

0013-7227/05/$15.00/0 Printed in U.S.A.

Endocrinology 146(9):3868 –3874 Copyright © 2005 by The Endocrine Society doi: 10.1210/en.2005-0194

Suppression of Leptin Receptor Messenger Ribonucleic Acid and Leptin Responsiveness in the Ventromedial Nucleus of the Hypothalamus during Pregnancy in the Rat S. R. Ladyman and D. R. Grattan Centre for Neuroendocrinology and Department of Anatomy and Structural Biology, School of Medical Sciences, University of Otago, Dunedin 9001, New Zealand Pregnancy in the rat is a state of leptin resistance associated with impaired leptin signal transduction in the hypothalamus. The aim of this study was to determine whether this leptin-resistant state is mediated by a change in the level of leptin receptors in the hypothalamus. Real-time RT-PCR was used to determine levels of mRNA for the various leptin receptor isoforms in a number of microdissected hypothalamic nuclei and the choroid plexus. To investigate the functional activation of the leptin receptor, immunohistochemistry for phosphorylated signal transducer and activator of transcription 3 (pSTAT3) was examined in the arcuate nucleus and the ventromedial nucleus of the hypothalamus (VMH) of fasted diestrous and d-14 pregnant rats after an intracerebroventricular (i.c.v.) injection of either leptin (4 ␮g) or vehicle. A significant reduction of Ob-Rb mRNA levels was observed in

T

HE HORMONE LEPTIN is primarily synthesized and secreted from adipose tissue and acts in the hypothalamus to decrease food intake and increase energy expenditure (1). The actions of leptin are mediated through the leptin receptor (Ob-R), which belongs to the class 1 cytokine receptor family (2). Multiple splice variants of the leptin receptor exist, including Ob-Rb, which has a long intracellular domain, and several forms with short intracellular domains (2, 3). A soluble form of the receptor, Ob-Re, which lacks the transmembrane region, has also been detected and may act as a binding protein (4, 5). The long form of the receptor is essential for the appetitesuppressing effects of leptin (3, 6) and is highly expressed in the rat hypothalamus, specifically the arcuate nucleus, dorsomedial hypothalamic nucleus, and ventromedial hypothalamic nucleus (VMH) (7, 8). Ob-Rb is the only receptor isoform with full intracellular signal transduction capacity and, like other members of the class 1 cytokine receptor family, the predominant signaling mechanism involves a Janus kinase (JAK)/signal transducer and acFirst Published Online May 19, 2005 Abbreviations: CT, Cycle threshold; i.c.v., intracerebroventricular; JAK, Janus kinase; Ob-R, leptin receptor; pSTAT3, phosphorylated STAT3; STAT, signal transducer and activator of transcription; VMH, ventromedial nucleus of the hypothalamus. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

the VMH during pregnancy compared with the nonpregnant controls. Furthermore, in pregnant rats the number of cells positive for leptin-induced pSTAT3 in the VMH was greatly reduced during pregnancy compared with nonpregnant rats. There were no differences in the level of Ob-Rb mRNA or in the number of leptin-induced pSTAT3-positive cells in the arcuate nucleus of nonpregnant and pregnant rats. These data implicate the VMH as a key hypothalamic site involved in pregnancy-induced leptin resistance. There were also reduced levels of mRNA for Ob-Ra, a proposed leptin transporter molecule, in the choroid plexus on d 7 and 21 of pregnancy. Hence, diminished transport of leptin into the brain may also contribute to pregnancy-induced leptin resistance. (Endocrinology 146: 3868 –3874, 2005)

tivator of transcription (STAT) pathway. In response to leptin, Ob-Rb undergoes JAK2-mediated phosphorylation, creating docking sites for cytoplasmic STAT3 molecules. Once recruited to the docking sites, STAT3 molecules become phosphorylated, form dimers, and then translocate to the nucleus where they modify gene transcription. Accumulating evidence indicates that a state of leptin resistance develops during pregnancy. Pregnancy is characterized by increased food intake to meet the metabolic demands of the conceptus and increased deposition of fat to prepare for the demands of late pregnancy and lactation (9, 10). Pregnancy is also associated with elevated leptin concentrations (5, 11, 12), resulting in the paradoxical state of hyperleptinemia and hyperphagia. Furthermore, in the rat, central leptin administration is unable to suppress food intake during pregnancy, indicating a state of hypothalamic leptin resistance (12). One mechanism by which leptin sensitivity may be modulated is through regulation of the leptin receptor. The aim of this study was to determine whether pregnancy induces changes in the level of leptin receptors in discrete nuclei of the hypothalamus that may contribute to the state of pregnancy-induced leptin resistance. To determine whether changes in Ob-Rb mRNA were associated with region-specific changes in leptin responsiveness, immunohistochemistry for leptin-induced phosphorylation of STAT3 was used as a functional marker of leptin activation of Ob-Rb, providing anatomical resolution of the distribution of leptinresponsive cells during pregnancy.

3868

Ladyman and Grattan • Leptin Resistance during Pregnancy

Endocrinology, September 2005, 146(9):3868 –3874

Materials and Methods Animals Animals were obtained from our colony at the University of Otago (Dunedin, New Zealand). Ten-week-old Sprague Dawley rats were housed under a 14-h light, 10-h dark cycle. Temperature was maintained at 22 ⫾ 1 C, and all rats had free access to food and water except during fasting, when only water was available. The estrous cycle was monitored by daily cytological examinations of vaginal smears. Proestrous females were housed overnight with a male rat, and mating was confirmed by the presence of sperm in the vaginal smear the following morning (d 0 of pregnancy). In our colony, parturition occurred on the morning of d 22 (d 0 lactation); on d 2 of lactation, litter sizes were normalized to 10 pups. All experimental protocols were approved by the University of Otago committee on the care and use of laboratory animals.

Real-time PCR Groups of rats were killed by decapitation between 0800 and 1000 h on diestrus; d 7, 14, and 21 of pregnancy; and d 7 of lactation. The brains were rapidly removed and frozen on dry ice. Coronal brain sections (300 ␮m) were cut in a cryostat at ⫺9 C, then thaw-mounted onto glass slides and refrozen. Working under a dissection microscope, the choroid plexus and six hypothalamic areas were micropunched from these sections using a blunt-ended microdissection needle (Table 1) (13). To eliminate the possibility of contamination by tissue carry-over between nuclei, separate sterile needles were used to dissect each area. After tissue collection, all dissections were validated by examination of the thawed sections under a dissecting microscope. Thawing of the sections provides clear discrimination of anatomical landmarks (e.g. fiber tracts, including the optic tract and fornix; extent of the third ventricle; and regions of gray matter), allowing confirmation of punch location. Punched tissue was placed in 995 ␮l of TRIzol (Invitrogen, Carlsbad, CA), along with 5 ␮l of glycogen (20 ␮g/␮l), and briefly sonicated. Total cellular RNA was extracted from microdissected samples using TRIzol Reagent according to the manufacturer’s protocol. Briefly, RNA was precipitated from the TRIzol solution after the addition of chloroform, followed by isopropyl alcohol, then washed in 75% ethanol in diethyl pyrocarbonate-treated water. Ethanol was then removed, and RNA pellets were briefly air-dried before the addition of 20 ␮l of RNase-free water. To denature any contaminating DNA, samples were treated with DNase I (amplification grade). Equal volumes of total RNA were transcribed into first strand cDNA for each sample using a GeneAmp Gold RNA/PCR reagents kit (PE Applied Biosystems, Foster City, CA), and subsequent assay results were analyzed relative to a housekeeping gene (␤-actin) within the same sample to normalize for possible variations in starting RNA quality and quantity, and RT efficiency. ␤-Actin levels were analyzed independently and did not vary in any of the experimental groups. Real-time PCR was completed using the TaqMan system (14), as previously described (15). Primer sets for ␤-actin and five leptin receptor isoforms (Ob-Ra, b, c, e, and f) were designed for use in TaqMan realtime PCR using Primer Express software (PE Applied Biosystems) (Table 2). Sequence-specific fluorogenic TaqMan probes were also designed (Table 2). All leptin receptor isoforms except Ob-Re shared a common forward primer and probe, directed against the extracellular segment that is common to these isoforms. Separate isoform-specific reverse

primers, directed against the intracellular domain, allowed for the specific detection of these four receptor isoforms. An ABI PRISM 7700 Sequence Detection System (Centre for Gene Research, University of Otago) was used to detect fluorescence during 40 PCR cycles. Data analysis was carried out as previously described (15). Briefly, for each of the leptin receptor isoforms, a threshold value in the exponential phase of the amplification plot was set, and the cycle number during which fluorescence first exceeded this threshold (CT) was determined for each sample. The CT value for ␤-actin was subtracted from the CT value from the corresponding leptin receptor (⌬CT) to correct for differences in starting tissue. This value was then combined to form the average ⌬CT values and sd for each animal group. Because of the exponential nature of the amplified product, comparisons of the results to the diestrous control group could be determined using the formula relative quantification ⫽ 2⫺⌬⌬CT, where ⌬⌬CT is the average diestrous ⌬CT, minus the average experimental group ⌬CT values (14). Plotting ⌬CT across a dilution series of known mRNA concentrations yielded gradients of 0.06, 0.02, 0.04, and 0.1 for Ob-Ra, Ob-Rb, Ob-Rc, and Ob-Rf, respectively, relative to ␤-actin, indicating that the efficiencies of reaction for the target and housekeeping gene were similar (a requirement for the ⌬⌬CT quantitation method). No amplification was detected in absence of template or in the no RT control.

Real-time PCR statistical analysis For each brain region, the nonparametric Kruskal-Wallis test was used to determine significant differences in average ⌬CT values for the experimental groups. If a significant H-statistic was detected, the MannWhitney U test was applied to compare each group with diestrus. The significance level was set at P ⬍ 0.05. Error bars are uneven, as they represent exponential variation plotted on a linear scale.

Immunohistochemistry Intracerebroventricular cannulae (Plastics One, Roanoke, VA) were surgically implanted into diestrous and d-7 pregnant rats. Animals were anesthetized with ip injections of xylazine hydrochloride (4 mg/kg) and ketamine hydrochloride (80 mg/kg) and placed in a stereotaxic frame. A 23-gauge stainless steel guide cannula was implanted 1.3 mm lateral to the midline at bregma (0.0 anterior/posterior position) and 3 mm below the level of the skull. Cannulae were fixed to the skull with stainless steel screws and dental cement. The open end of the cannula was sealed with a plastic cap until the time of injection. After surgery, rats were housed individually, and water intake and weight gain were monitored daily. On d 13 of pregnancy, and on metestrus for the nonpregnant rats, food was removed from the cages 1 h before the start of the dark phase. Rats were fasted to reduce endogenous leptin concentrations (12). Approximately 16 h later (between 0800 and 1100 h), rats received a 2 ␮l-injection of either 4 ␮g leptin (recombinant mouse leptin obtained from Dr. A. F. Parlow, National Hormone and Pituitary Program, NIDDK, Torrance, CA) diluted in artificial CSF (aCSF) or vehicle (aCSF without leptin) into the left lateral ventricle using a Hamilton syringe (Reno, NV) connected to a stainless steel injection cannula. The injection cannula was designed to protrude 2 mm beyond the tip of the guide cannula. Animals were then left 30 min before being deeply anesthetized with sodium pentobarbital (17 mg/100 g body weight for pregnant rats

TABLE 1. Microdissection of discrete hypothalamic regions Brain regions

Choroid plexus Arcuate nucleus Dorsomedial hypothalamic nucleus Paraventricular nucleus Supraoptic nucleus VMH a

Section coordinates relative to bregmaa

⫺0.1, ⫺2.5, ⫺2.5, ⫺1.9, ⫺1.0, ⫺2.5,

Based on the atlas of Paxinos and Watson (43). Single punch per section, centered on the third ventricle. c Two overlapping punches on each side. b

⫺0.4, ⫺2.8, ⫺2.8, ⫺2.2 ⫺1.3, ⫺2.8,

3869

⫺0.7 ⫺3.1 ⫺3.1 ⫺1.6 ⫺3.1

Size of punch (␮m)

Number of punches per brain

300 500 500 500 500 500

6 3b 6 4 6 12c

3870



TABLE 2. Oligonucleotides used for RT-PCR Primers/probes

Leptin receptor Common (forward) Ob-Ra (reverse) Ob-Rb (reverse) Ob-Rc (reverse) Ob-Rf (reverse) Common (probe) Ob-Re (forward) Ob-Re (reverse) Ob-Re (probe) ␤-Actin Forward Reverse Probe

Oligonuncleotide sequence (5⬘–3⬘)

Nucleotide number (accession no.)

CTCTCCAGAGAATGAAAAAGTTGTTT CTCTTTGAAGTATCTCATGACCACTACA TTTGAGCATCTTTTTACCAAGCAT AAGGTCACTTTTTAAGTATTACCCAAGATATC AGGATATAGAGTGGATGCCGTCA ACGATGTTCCAAACCCCAAGAATTGTTCC TTGGCAATCCTGATAATAAAGCATT TATAATCTTCTTGCCTGGTCAGAATG TCAAGCAAGGATGTCAACCTTCCAACTGAA

2582–2607 (U60151) 245–218 (AF304191) 2700 –2677 (U60151) 170 –139 (AF007818) 2828 –2806 (U53144) 2612–2640 (U60151) 765–789 (AF007819) 857– 832 (AF007819) 801– 830 (AF007819)

AGATGACCCAGATCATGTTTGAGA ACCAGAGGCATACAGGGACAA TCAACACCCCAGCCATCTACGTAGCC

152–175 (AF122902) 237–217 (AF122902) 179 –204 (AF122902)

or 6 mg/100 g body weight for diestrous rats) and intracardiacally perfused with heparinized saline (4 C), followed by 2% paraformaldehyde in 0.1 m phosphate buffer (4 C, pH 7.3). Brains were removed and postfixed in the same fixative overnight at room temperature, then soaked in sucrose solution (30% sucrose in 0.1 m phosphate buffer) until the brain had sunk. Brains were then frozen in isopentane cooled by liquid nitrogen and stored at ⫺80 C until further processing. Coronal sections (35 ␮m) were cut through frozen brains in a cryostat at ⫺20 C, and approximately six sections 210 ␮m apart through the arcuate nucleus and VMH were collected from each brain. Sections were stored in cryoprotectant at ⫺20 C until further processing. Sections were processed for phosphorylated STAT3 (pSTAT3) immunohistochemsity. Sections were pretreated with 1% NaOH and 1% H2O2 in H2O for 20 min, 0.3% glycine for 10 min, and finally 0.03% sodium dodecyl sulfate for 10 min, all at room temperature. Sections were incubated in blocking solution (3% normal goat serum in PBS/ 0.25% Triton X-100/0.02% sodium azide) for 1 h at room temperature, and then incubated overnight at 4 C in blocking solution containing the pSTAT3 antibody (1:1000 dilution; Cell Signaling Technology, Inc., Beverly, MA). This antibody detects a single band in Western blotting of hypothalamic tissues and does not cross-react with the nonphosphorylated form of STAT3 (12). On the following day, sections were washed, incubated with a biotinylated secondary goat antirabbit antibody for 1 h (1:1000, in blocking solution without sodium azide), and then treated with Vector Elite ABC solution (Vector Laboratories, Burlingame, CA) for 1 h. After washing, the sections were incubated in 0.05 m Tris-HCl (pH 7.3), then the signal was developed by DAB solution with the addition of 0.1% nickel sulfate, resulting in a purple/black precipitate. This reaction was stopped by two incubations in PBS for 10 min. Sections were then mounted on ATS [(3-aminopropyl)triethoxysilane; Sigma (St. Louis, MO)]-coated slides and left to dry. Slides were then dehydrated through an alcohol series ending with two 20-min xylene incubations. Slides were then coverslipped with DPX mountant [BDH, Merck (NZ) Ltd., Palmerston North, New Zealand] and left to air-dry in a fume hood.

Immunohistochemistry analysis Slides were examined on an Olympus BX51 microscope (Olympus, Tokyo, Japan) and photographed using a digital camera attached to the microscope. The number of pSTAT3-positive cells in the arcuate nucleus and in the dorsal medial region of the VMH were counted using NIH Image computer software (version 1.63). To define the area of interest, the boundary of the selected nucleus was drawn, creating an enclosed area. This image was then converted to binary, and a standard threshold was set. An appropriate threshold had been determined before analysis, such that only dark stained nuclei were detected. The number of nuclei within this enclosed area was automatically counted. After counting, the procedure was checked manually, and cell counts were corrected for overlapping nuclei identified on the basis of size (indicated by the computer program) and visual shape of the counted objects. For each brain region, at least three sections were analyzed per rat. For each rat, the average number of cells counted in each area was used for statistical comparisons. Differences between groups were analyzed by two-way

ANOVA followed by Fisher’s protected least significant difference post hoc test. The significance level for all statistics was set at P ⬍ 0.05. All data are presented as the mean ⫾ sem.

Results Levels of leptin receptor mRNA in the hypothalamus and choroid plexus during pregnancy

Ob-Re mRNA was not detected in any of the brain areas examined although it could be detected in placenta tissue that was used as a positive control (data not shown) (16). The other four isoforms of the leptin receptor that were examined (Ob-Ra, b, c, and f) were detected at varying levels in all areas. On d 7, 14, and 21 during pregnancy, Ob-Rb mRNA levels in the VMH were decreased 3.1-, 2.4-, and 2.0-fold, respectively, compared with diestrus (Fig. 1). By d 7 of lactation, Ob-Rb mRNA expression in the VMH had returned to levels not significantly different from diestrus. Levels of mRNA for Ob-Rb remained relatively stable throughout pregnancy and lactation in the other areas examined (Fig. 1). No significant changes in the level of mRNA for the other leptin receptor isoforms (Ob-Ra, c, and f) were observed in any of the hypothalamic areas examined during pregnancy and lactation (data not shown). In the choroid plexus, there were significant changes in the level of Ob-Ra mRNA during pregnancy, compared with diestrus (Fig. 2). On d 7 and 21, Ob-Ra mRNA was significantly decreased by 2.8- and 2.0-fold, respectively, compared with diestrus. On d 14 of pregnancy and 7 of lactation, there was a 1.8-fold reduction in Ob-Ra mRNA levels, but this was not significant. Compared with diestrus, there were no significant changes in mRNA levels for Ob-Rb (Fig. 2) or the other receptor isoforms (data not shown) during pregnancy or lactation in the choroid plexus. Number of leptin-responsive cells in the arcuate nucleus and VMH during pregnancy

Leptin-responsive cells, as measured by leptin-induced pSTAT3 staining, were observed in the arcuate nucleus, VMH, dorsomedial nucleus, lateral hypothalamus, and paraventricular nucleus, similar to previous studies (17–19). To determine whether the decrease in Ob-Rb mRNA in the VMH during pregnancy was associated with a loss of functional receptors, the number of leptin-responsive cells in the



3871

FIG. 1. Bars represent mean (⫾ SEM) levels of Ob-Rb mRNA normalized to ␤-actin in the ventromedial nucleus (VMH), arcuate nucleus (Arc), dorsomedial nucleus (DMH), supraoptic nucleus (SON), and paraventricular nucleus (PVN) of the hypothalamus on d (D) 7, 14, and 21 of pregnancy and d 7 of lactation (Lact). All values are expressed relative to levels of mRNA measured during diestrus (Di), n ⫽ 5– 8. *, Significant with respect to diestrus (P ⬍ 0.05).

VMH was quantified. Although there were no changes in Ob-Rb mRNA levels in the arcuate nucleus, our previous data indicated that the arcuate nucleus had impaired leptininduced activation of STAT3 during pregnancy (12); therefore, the number of leptin-responsive cells in this area was also evaluated. In both nonpregnant and pregnant rats, leptin induced a robust increase in STAT3 phosphorylation in the dorsomedial region of the VMH and the arcuate nucleus (Fig. 3). In the pregnant rats, however, the number of pSTAT3positive cells in the leptin-treated pregnant rats was greatly reduced compared with that observed in the leptin-treated nonpregnant rats (Fig. 4). In the arcuate nucleus, the number of pSTAT3-positive cells was not different between pregnant and nonpregnant rats (Fig. 4). The number of pSTAT3-positive cells in the arcuate nucleus of vehicle-treated animals tended to be elevated in pregnant rats compared with nonpregnant rats, but this difference was not significant. Discussion

FIG. 2. Bars represent mean (⫾ SEM) levels of Ob-Ra mRNA and Ob-Rb mRNA normalized to ␤-actin in the choroid plexus on d (D) 7, 14, and 21 of pregnancy and d 7 of lactation (Lact). All values are expressed relative to levels of mRNA measured during diestrus (Di), n ⫽ 5– 8. *, Significant with respect to diestrus (P ⬍ 0.05).

The appetite suppressing actions of the leptin are mediated through Ob-Rb, the only leptin receptor isoform with full signal transduction capacity. Previously, we have demonstrated that a state of central leptin resistance develops during pregnancy that is associated with impaired activation of the JAK/STAT3 pathway, specifically in the arcuate nucleus and the ventromedial nucleus of the hypothalamus (12). It was hypothesized that region-specific changes in receptor levels may contribute to this state of leptin resistance and attenuated leptin-induced STAT3 phosphorylation. Previous studies examining hypothalamic leptin receptor mRNA during pregnancy have found either no change in expression (20, 21) or a decrease in Ob-Rb mRNA on d 18 of pregnancy (11). These studies examined the hypothalamus as a whole, therefore limiting the ability to detect regionspecific changes in expression. The microdissection of the

3872



FIG. 4. The number of cells expressing leptin-induced pSTAT3 in the dorsomedial VMH is significantly reduced during pregnancy. A, Bars represent mean number of cells per section (⫾ SEM) expressing pSTAT3 after vehicle or leptin treatment in the dorsomedial VMH (n ⫽ 5–7 per group). B, Bars represent mean number of cells per section (⫾ SEM) expressing pSTAT3 after vehicle or leptin treatment in the arcuate nucleus (n ⫽ 5–7 per group). *, Significant with respect to vehicle-treated group of same physiological state (P ⬍ 0.05). †, Significant when leptin-induced pSTAT3 expression was compared between nonpregnant and pregnant rats (P ⬍ 0.05).

FIG. 3. Representative images of pSTAT3 immunostaining after i.c.v. vehicle or leptin treatment in nonpregnant and in d 14 pregnant rats. Rats were injected (i.c.v.) with vehicle or leptin (4 ␮g) and were killed 30 min later. Coronal sections through the arcuate nucleus and VMH were stained for pSTAT3. Black immunoreactivity indicates presence of pSTAT3 in nuclei of individual hypothalamic neurons after leptin treatment. Insets show higher magnifications of the areas used for cell count analysis depicted in Fig. 4. Scale bars indicate 500 ␮m.

hypothalamus performed in the present study allowed for the examination of specific nuclei. Thus, we were able to detect a specific decrease of Ob-Rb mRNA in the VMH during pregnancy, whereas mRNA levels remained relatively stable in the other areas of the hypothalamus examined. Furthermore, a reduced number of pSTAT3 positive neurons in the VMH of pregnant rats compared with nonpregnant rats was observed after leptin treatment, consistent with our previous results of reduced leptin activation of the JAK/ STAT3 pathway in the VMH during pregnancy (12). Chua et al. (22) demonstrated that heterozygous neuronal overexpression of Ob-Rb in db/db mice leads to partial correction of the phenotype associated with leptin receptor de-

ficiency, whereas homozygous overexpression results in almost complete correction of the db/db phenotype. These data suggest that the degree of Ob-Rb expression greatly influences the effectiveness of leptin in the regulation of energy balance. Therefore, the 2- to 3-fold decrease in Ob-Rb mRNA levels in the VMH during pregnancy is likely to be a major component in the mechanisms underlying pregnancy-induced leptin resistance. However, as it cannot be assumed that mRNA levels unequivocally correlate with protein levels, it is important to determine whether this significant down-regulation of Ob-Rb mRNA reflects a decrease in protein levels. Although Ob-Rb protein levels have not been measured directly, our parallel findings of reduced mRNA encoding for Ob-Rb and attenuated leptin-induced pSTAT3, a marker of functional activation of Ob-Rb, imply that Ob-Rb protein levels are highly likely to be down-regulated in the VMH during pregnancy. In the arcuate nucleus, nonpregnant and pregnant rats demonstrated a similar increase in the number of pSTAT3 positive cells after leptin treatment consistent with the observation that Ob-Rb levels did not change. In contrast to the above data, our previous Western blot analysis had indicated that leptin treatment did not increase overall phosophorylated STAT3 levels in the arcuate nucleus during pregnancy


(12). One possible explanation for these apparently conflicting results is that the Western blot analysis may reflect a change in degree of STAT3 phosphorylation during pregnancy, whereas there may be no change in the number of cells responding. In addition, due to the heterogeneity of the leptin-responsive neurons within the arcuate nucleus (23, 24), it is possible that these neuronal populations are differentially affected by pregnancy. The results from the present study suggest that neurons within the arcuate nucleus remain at least partially responsive to leptin during pregnancy. The arcuate nucleus is a primary site of the anorectic actions of leptin (25, 26). Hence, the observation of behavioral leptin resistance during pregnancy [loss of the anorectic effects of leptin (12)], despite an apparently normal arcuate nucleus response to leptin, suggests that pathways downstream of first order leptin target neurons and/or other intracellular signaling pathways in leptin-responsive neurons may be impaired during pregnancy. Whereas further studies are required to elucidate the effects of pregnancy on the leptin responsiveness of neurons within the arcuate nucleus, the differences between the arcuate nucleus and the VMH suggest that discrete hypothalamic targets of leptin are differentially regulated to allow adaptations to physiological conditions This study clearly implicates the VMH as a region where leptin signal transduction is reduced during pregnancy. The consequences of this VMH-specific decrease in responsiveness remains unknown. The VMH has long been recognized as one of the primary regions of the brain involved in energy homeostasis, but both the phenotype and the function of the leptin-responsive neurons in the dorsomedial VMH have yet to be fully elucidated. Although the majority of recent studies investigating leptin action have focused on the arcuate nucleus, leptin administration directly into the VMH provides evidence supporting a role for this area in leptin-mediated suppression of food intake (25, 27) and stimulation of the sympathetic nervous system (28). As well as pregnancyinduced hyperphagia, impaired leptin signaling in the VMH may be involved in other metabolic adaptations of the maternal body to pregnancy. The VMH has previously been implicated as a central site involved in the regulation of glucose uptake by peripheral tissues (29 –31) and may mediate leptin-induced increases in glucose uptake via the activation of the sympathetic nervous system (32–34). Unlike leptin-induced suppression of feeding, leptin stimulation of the sympathetic nervous system appears to be specific to the VMH (28). Interestingly, a key metabolic adaptation that develops during pregnancy is the reduced uptake of glucose by peripheral maternal tissue and redirection to the fetus (35). Previously, the limiting of glucose uptake by maternal tissues has been attributed to peripheral insulin resistance (36, 37). Considering that central leptin can increase glucose uptake independent of insulin and that the actions of both central leptin and peripheral insulin can synergistically increase glucose uptake (34), it is possible that impaired leptin signaling in the VMH during pregnancy may contribute to the reduction of glucose uptake by peripheral tissues in the maternal body. In the choroid plexus, Ob-Ra mRNA was significantly reduced on d 7 and 21 of pregnancy compared with diestrous


3873

rats. The choroid plexus has been proposed as a site for leptin entry into the brain (38). The affinity of leptin binding in the choroid plexus is similar to the affinity of binding to Ob-Ra (39), and the high expression levels of Ob-Ra in the choroid plexus (2, 7) has lead to speculation that leptin transport into the brain could be mediated by Ob-Ra. This proposed function of the short form of the receptor is supported by studies using Madin-Darby canine kidney epithelial cells transfected with Ob-Ra. The presence of the short form of the leptin receptor results in the unidirectional transport of intact leptin across the epithelial monolayer, a function that is not normally present (40). Hence, a decrease in the proposed mediator of leptin transport, Ob-Ra, in the choroid plexus may be associated with reduced leptin entry into the brain during pregnancy. While unlikely to be involved in the loss of response to i.c.v. leptin, this result suggests that diminished transport may also contribute to the state of pregnancyinduced leptin resistance. In other models of leptin resistance, such as diet-induced obesity, leptin transport into the brain has been defective, contributing to the state of leptin resistance (19, 41, 42). In conclusion, these results further implicate the VMH as a key site involved in pregnancy-induced leptin resistance. The impaired activation of pSTAT3 after leptin treatment in the VMH is associated with reduced mRNA for Ob-Rb, raising the possibility that other signaling pathways mediated through the leptin receptor are likely to also be impaired in this hypothalamic area during pregnancy. The response to leptin and the levels of receptor mRNA in the arcuate nucleus was similar in pregnancy to the nonpregnant state. The present data suggests that different hypothalamic target areas of leptin may be differentially regulated to allow adaptation of the brain to the unique physiological conditions of pregnancy. Acknowledgments Received February 15, 2005. Accepted May 12, 2005. Address all correspondence and requests for reprints to: Dr. David Grattan, Department of Anatomy and Structural Biology, University of Otago, P.O. Box 913, Dunedin 9001, New Zealand. E-mail: dave.grattan@ anatomy.otago.ac.nz. This work was supported by a grant from the Marsden Fund (Royal Society of New Zealand). S.R.L. was supported by a University of Otago Postgraduate Scholarship.

References 1. Friedman JM, Halaas JL 1998 Leptin and the regulation of body weight in mammals. Nature 395:763–770 2. Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J 1995 Identification and expression cloning of a leptin receptor, OB-R. Cell 83:1263–1271 3. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM 1996 Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632– 635 4. Tartaglia LA 1997 The leptin receptor. J Biol Chem 272:6093– 6096 5. Gavrilova O, Barr V, Marcus-Samuels B, Reitman M 1997 Hyperleptinemia of pregnancy associated with the appearance of a circulating form of the leptin receptor. J Biol Chem 272:30546 –30551 6. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP 1996b Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491– 495 7. Guan XM, Hess JF, Yu H, Hey PJ, van der Ploeg LH 1997 Differential expression of mRNA for leptin receptor isoforms in the rat brain. Mol Cell Endocrinol 133:1–7

3874


8. Elmquist JK, Bjorbaek C, Ahima RS, Flier JS, Saper CB 1998b Distributions of leptin receptor mRNA isoforms in the rat brain. J Comp Neurol 395:535–547 9. Cripps AW, Williams VJ 1975 The effect of pregnancy and lactation on food intake, gastrointestinal anatomy and the absorptive capacity of the small intestine in the albino rat. Br J Nutr 33:17–32 10. Naismith DJ, Richardson DP, Pritchard AE 1982 The utilization of protein and energy during lactation in the rat, with particular regard to the use of fat accumulated in pregnancy. Br J Nutr 48:433– 441 11. Garcia MD, Casanueva FF, Dieguez C, Senaris RM 2000 Gestational profile of leptin messenger ribonucleic acid (mRNA) content in the placenta and adipose tissue in the rat, and regulation of the mRNA levels of the leptin receptor subtypes in the hypothalamus during pregnancy and lactation. Biol Reprod 62:698 –703 12. Ladyman SR, Grattan DR 2004 Region-specific reduction in leptin-induced phosphorylation of signal transducer and activator of transcription-3 (STAT3) in the rat hypothalamus is associated with leptin resistance during pregnancy. Endocrinology 145:3704 –3711 13. Palkovits M, Brownstein MJ 1988 Maps and guide to microdissection of the rat brain. New York: Elsevier 14. PE Applied Biosystems 1998 TaqMan cytokine gene expression plate I — protocol. Foster City, CA: The PerkinElmer Corporation 15. Augustine RA, Kokay IC, Andrews ZB, Ladyman SR, Grattan DR 2003 Quantitation of prolactin receptor mRNA in the maternal rat brain during pregnancy and lactation. J Mol Endocrinol 31:221–232 16. Smith JT, Waddell BJ 2002 Leptin receptor expression in the rat placenta: changes in ob-ra, ob-rb, and ob-re with gestational age and suppression by glucocorticoids. Biol Reprod 67:1204 –1210 17. Hubschle T, Thom E, Watson A, Roth J, Klaus S, Meyerhof W 2001 Leptininduced nuclear translocation of STAT3 immunoreactivity in hypothalamic nuclei involved in body weight regulation. J Neurosci 21:2413–2424 18. Munzberg H, Huo L, Nillni EA, Hollenberg AN, Bjorbaek C 2003 Role of signal transducer and activator of transcription 3 in regulation of hypothalamic proopiomelanocortin gene expression by leptin. Endocrinology 144:2121–2131 19. Levin BE, Dunn-Meynell AA, Banks WA 2004 Obesity-prone rats have normal blood-brain barrier transport but defective central leptin signaling before obesity onset. Am J Physiol Regul Integr Comp Physiol 286:R143–R150 20. Rocha M, Bing C, Williams G, Puerta M 2003 Pregnancy-induced hyperphagia is associated with increased gene expression of hypothalamic agoutirelated peptide in rats. Regul Pept 114:159 –165 21. Seeber RM, Smith JT, Waddell BJ 2002 Plasma leptin-binding activity and hypothalamic leptin receptor expression during pregnancy and lactation in the rat. Biol Reprod 66:1762–1767 22. Chua SC, Jr., Liu SM, Li Q, Sun A, DeNino WF, Heymsfield SB, Guo XE 2004 Transgenic complementation of leptin receptor deficiency. II. Increased leptin receptor transgene dose effects on obesity/diabetes and fertility/lactation in lepr-db/db mice. Am J Physiol Endocrinol Metab 286:E384 —E392 23. Elmquist JK, Maratos-Flier E, Saper CB, Flier JS 1998 Unraveling the central nervous system pathways underlying responses to leptin. Nat Neurosci 1:445– 450 24. Elias CF, Aschkenasi C, Lee C, Kelly J, Ahima RS, Bjorbaek C, Flier JS, Saper CB, Elmquist JK 1999 Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic area. Neuron 23:775–786 25. Satoh N, Ogawa Y, Katsuura G, Hayase M, Tsuji T, Imagawa K, Yoshimasa Y, Nishi S, Hosoda K, Nakao K 1997 The arcuate nucleus as a primary site of satiety effect of leptin in rats. Neurosci Lett 224:149 –152


26. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661– 671 27. Jacob RJ, Dziura J, Medwick MB, Leone P, Caprio S, During M, Shulman GI, Sherwin RS 1997 The effect of leptin is enhanced by microinjection into the ventromedial hypothalamus. Diabetes 46:150 –152 28. Satoh N, Ogawa Y, Katsuura G, Numata Y, Tsuji T, Hayase M, Ebihara K, Masuzaki H, Hosoda K, Yoshimasa Y, Nakao K 1999 Sympathetic activation of leptin via the ventromedial hypothalamus: leptin-induced increase in catecholamine secretion. Diabetes 48:1787–1793 29. Shimazu T, Sudo M, Minokoshi Y, Takahashi A 1991 Role of the hypothalamus in insulin-independent glucose uptake in peripheral tissues. Brain Research Bulletin 27:501–504 30. Sudo M, Minokoshi Y, Shimazu T 1991 Ventromedial hypothalamic stimulation enhances peripheral glucose uptake in anesthetized rats. Am J Physiol 261:E298 –E303 31. Minokoshi Y, Okano Y, Shimazu T 1994 Regulatory mechanism of the ventromedial hypothalamus in enhancing glucose uptake in skeletal muscles. Brain Res 649:343–347 32. Minokoshi Y, Haque MS, Shimazu T 1999 Microinjection of leptin into the ventromedial hypothalamus increases glucose uptake in peripheral tissues in rats. Diabetes 48:287–291 33. Kamohara S, Burcelin R, Halaas JL, Friedman JM, Charron MJ 1997 Acute stimulation of glucose metabolism in mice by leptin treatment. Nature 389: 374 –377 34. Haque MS, Minokoshi Y, Hamai M, Iwai M, Horiuchi M, Shimazu T 1999 Role of the sympathetic nervous system and insulin in enhancing glucose uptake in peripheral tissues after intrahypothalamic injection of leptin in rats. Diabetes 48:1706 –1712 35. Herrera E 2000 Metabolic adaptations in pregnancy and their implications for the availability of substrates to the fetus. Euro J Clin Nutr 54 (Suppl 1):S47–S51 36. Nolan CJ, Proietto J 1994 The feto-placental glucose steal phenomenon is a major cause of maternal metabolic adaptation during late pregnancy in the rat. Diabetologia 37:976 –984 37. Leturque A, Ferre P, Burnol AF, Kande J, Maulard P, Girard J 1986 Glucose utilization rates and insulin sensitivity in vivo in tissues of virgin and pregnant rats. Diabetes 35:172–177 38. Zlokovic BV, Jovanovic S, Miao W, Samara S, Verma S, Farrell CL 2000 Differential regulation of leptin transport by the choroid plexus and bloodbrain barrier and high affinity transport systems for entry into hypothalamus and across the blood-cerebrospinal fluid barrier. Endocrinology 141:1434 –1441 39. Uotani S, Bjorbaek C, Tornoe J, Flier JS 1999 Functional properties of leptin receptor isoforms: internalization and degradation of leptin and ligand-induced receptor downregulation. Diabetes 48:279 –286 40. Hileman SM, Tornoe J, Flier JS, Bjorbaek C 2000 Transcellular transport of leptin by the short leptin receptor isoform ObRa in Madin-Darby canine kidney cells. Endocrinology 141:1955–1961 41. El-Haschimi K, Pierroz DD, Hileman SM, Bjorbaek C, Flier JS 2000 Two defects contribute to hypothalamic leptin resistance in mice with diet-induced obesity. J Clin Invest 105:1827–1832 42. Van Heek M, Compton DS, France CF, Tedesco RP, Fawzi AB, Graziano MP, Sybertz EJ, Strader CD, Davis Jr HR 1997 Diet-induced obese mice develop peripheral, but not central, resistance to leptin. J Clin Invest 99:385–390 43. Paxinos G, Watson C 1997 The rat brain in stereotaxic coordinates. 3rd ed. San Diego: Academic Press

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.