fivefold in transfected Schneider cells and increases eye pigmentation in dR1* flies. U1-9G ..... (P[dR"]) were identified by eye color, and chromo- somes carrying ...
Copyright 0 1994 by the Genetics Society of America
Suppressor U1 snRNAs in Drosophila Patrick C. H. Lo', Debjani Roy2 and Stephen M.Mount' Department of BiologicalSciences,ColumbiaUniversity,New York, New York 10027 Manuscript received April 25, 1994 Accepted for publication June 29, 1994 ABSTRACT Although the role of U1 small nuclear RNAs (snRNAs) in 5' splice site recognitionis well established, suppressor U1 snRNAs active in intact multicellular animals have been lacking. Here we describe suppression of a 5' splice site mutation inthe Drosophila melanogaster white gene ( dR18) by compensatory changesin U1 snRNA.Mutation of positions -I and +6 of the 5' splicesiteof the second intron (ACG I GTGACT to ACC I GTGAGC) results in the accumulation of RNA retaining this 74nucleotide intron in both transfected cells and transgenic flies.U1-3G, a suppressor U1 snRNA which restores basepairing at position +6 of the mutant intron, increases the ratioof spliced to unspliced dR1* RNA up to fivefold in transfected Schneider cells and increases eye pigmentation in dR1* flies. U1-9G, which targets position -1, suppresses dR1* in transfected cells less well. UI-3G,9G has the same effect as U1-3G although it accumulates to lower levels. Suppression of dR'* has revealed that the U l b embryonic variant (GI34 to U) is active in Schneider cells and pupal eye discs. However, the combination of9G with 134U leads to reduced accumulation of both Ulb-9G and UIb3C,9G, possibly because nucleotides 9 and 134 both participate in a potential long-range intramolecular base-pairing interaction. High levels of functional U1-3G suppressor reduce both viability and fertility in transformed flies. These results show that, despite the difficultiesinherent in stably altering splicesite selection in multicellular organisms,it is possible to obtain suppressor U1 snRNAs in flies. "
PLICING of messenger RNA precursors in higher
S
eukaryotes is a complex process that results in the precise removal of introns fromprimary transcripts [see GREEN(1991),MOOREet al. (1993) and WISE(1993) for reviews]. Splicing involves two transesterification reactions thatare preceded by formation of the spliceosome, a large dynamic structurecontaining many factors. Among these factors are small nuclear ribonucleoprotein particles (snRNPs) containing the U snRNAs, including U1, U2, U4, U5and U6. Numerous studies have identified sequences at the two splice sites and at the lariat site as critical for the specification of splicing. At 5' splice sites there is a nine nucleotide consensus sequence, MAGI GTRAGT, which is highly conserved (MOUNT1982;SENAPATHY~~ al. 1990;MOUNTet al. 1992). The 5' end of U1 RNA and this nine nucleotide consensus are perfectly complementary (LERNER et al. 1980; ROGERSand WALL1980),and base-pairing with Ul RNA contributes to 5' splice site recognition. Genetic evidence forthis interaction between U1 and 5' splice sites has been provided by the demonstration that a compensatory change in the5' end of U1 RNA can suppress a 5' splice site mutation. Thiswas first shown by transient transfections in HeLa cells (ZHUANGand WEINER 1986) and later by stable transformation in yeast (SERAPHIN et
' Present address: Brookdale Center, Mt.Sinai School of Medicine, One Gustav L. Levy Place, New York, New York 10029. Present address: Department of Biology, New York University, Washington Square, New York, New York 10003. 'To whom correspondence should be addressed. Genetics 138 365-378 (October, 1994)
al. 1988; SILICIANO and GUTHRIE 1988) and in mammalian cells (COHENet al. 1993). However, base-pairing between U1 RNA and the 5' splice site is not thesole determinant of 5' splice site use (SILICIANO and GUTHRIE 1988; SERAPHIN and ROSBASH 1990). For example, mutation of yeast U1 so that it is capable of pairing with a G to A mutation in the invariant position 1 of the intron allowed efficient suppression of the first step of splicing, but not the second (SILICIANO and GUTHRIE 1988).This result implies that atleast some nucleotides, including the invariant G at position +1, are recognized twice in thepathway towardproper splicing. Furthermore, there is genetic (NEWMAN and NORMAN 1991) and in vitro (NELSON and GREEN 1988; ZAPP and BERGET 1989) data indicating thateven the first step of RNA splicing involves recognition of the 5' splice site by factors in addition to the U1 snRNP. Specifically, genetic suppression experiments in yeast indicate interactions between U5 and exon sequences immediately and NORMAN 1991, flanking both splice sites (NEWMAN 1992). These studies have been directly confirmed by cross-linking studies in mammalian splicing extracts (WYATTet al. 1992; SONTHEIMER and STEITZ 1993) that have identified an interaction between U5 and the 5' splice site that is maintained through bothsteps of splicing. A role forU6 snRNA in 5' splice site choice has also been indicatedby cross-linking ( SAWA and ABELSON 1992; SAWAand SHIMURA 1992; WASSARMAN and STEITZ 1992), and confirmed by suppression studies that support a 3-base pair interaction between a conserved region of
+
366
P. C. H. Lo,and D. Roy
U6 and nucleotides +4 to +6 of the 5‘ splice site (KANDELS-LEWIS and SERAPHIN 1993; LESSER and GUTHRXE 1993). This interaction follows recognition by U1, suggesting that U6 has a role in proofreading during 5’ splice site selection. Finally, protein factors that influence which of two competing 5’ splice siteswill be used have been described (Fu and MANIATIS 1990; GE and MANLEY 1990; KRAINER et al. 1990; HARPER and MANLEY 1991; MAYEDA and KRAINER 1992; MAYEDA et al. 1992). Although many, if not all, of these proteins containRNA binding domains, it remains unclear whether they interact directly with the 5’ splice site. Rather, their effect may be mediated through the U1 snRNP, as there is evidence that the SR proteins ASF/SF2 and SC35 interact directly with the U1 snRNP (Wuand ~ ~ A N I A T I1993; S KOHTZet al. 1994). Not only is 5’ splice site selection dependent on factors other than U1, but the U1 snRNP also has other roles in splicing. Genetic suppression studies in Schizosacchromycespombe have revealed that U1 snRNAiscritical for 3’ splice site recognition via base-pairing (REICH et al. 1992), althoughthis appears not to be the case in Saccharomyces cerevisiae (SERAPHIN and KANDELS-LEWIS 1993).Furthermore, U1snRNPs incapable ofbasepairing with the 5’ splice site can still contribute tosplicing, as indicated by stabilization of complexes containing U2 snRNP (BARABINO et al. 1990) and the observation that the splicing of certain substrates requires the U1 snRNP but notbase-pairing (SEIWERT and STEITZ 1993). In view of the complexity of 5’ splice site recognition, genetic suppression in Drosophila melanogaster is potentially useful in clarifymg the role of U1 snRNA in splicing and in identifylng other factors that interact with U1in splice site choice. However, suppression of 5’ splice site mutations by compensatory mutations in U1 had notpreviously been demonstratedin any intact multicellular organism, and was potentially impossible. Expression of U1 RNAs with altered 5’ termini in mammalian cellsaffects 5’ splicesite selection (YUO and WEINER 1989a; COHEN et al. 1993). Thus, we were concerned that suppressor U1 R N A s , by altering the efficiency or fidelity of splicing, would have deleterious effects in a complex organism such as the fruit fly whose development depends on the proper expression, and splicing, of many genes. In order to minimize problems of this sort, we have examined suppression of mutations in positions within the 5‘ splice site consensus that are only moderately conserved (-lG and +6T are present in 71 and 68% of Drosophila 5‘ splice sites, respectively) (MOUNTet al. 1992). We also placed these mutations in the Drosophila white gene because differences in eye pigmentation thatresult from twofold differences in the expression of white are easily recognized over a large range of expression (between 1 and 50% of wild-type levels). Because of this sensitivity, suppression of white
S. M. Mount
alleles can be easily observed (LINDSLEY and ZIMM1992) and has proven useful in numerous studies (for example, RABINOW and BIRCHLER 1989; PENGand MOUNT 1990; KURKULOS et al. 1991). Drosophila possesses an embryonic U1 sequence variant that differs from the predominantform (Ula) by a single nucleotide change,G134 to U, located at thevery 3’ border of the consensus Drosophila Sm binding site (LO and MOUNT1990). As with numerous highermetazoan species, this sequence variant (Ulb) is primarily expressed during embryogenesis. Although embryonic U1 variants are also found in sea urchin (SANTIAGO and MARZLUFF 1989),Xenopus (FORBES et al. 1984; LUND and DAHLBERG 1987), and mouse (LUNDet al. 1985), there have been no studies of the functionof these embryonic variants in any of these species. Thus, our first use of suppression by U1 RNAs has been to determine if the Drosophila embryonic Ulb sequence variant is functional. In this study we demonstrate that mutation of positions -1 and +6 at the5’ splice site of the second intron of the Drosophila white gene leads to theaccumulation of unspliced RNA in both transfected Drosophila cells and transformed flies. Compensatory mutations in the 5’ end of U1 are able to suppress this defect in both co-transfected cells and in transformed flies. Both Ula and Ulb can act as efficient suppressors, indicating that the embryonic form can function in developing pigment cells. There are inherent difficulties in stably altering splice site selection in multicellular organisms, and we have indeed observed deleterious effects on viability and fertility. Nevertheless, by demonstrating thatsuppressor U1 snRNAs can hnction in flies, we have shown that suppression studies designed to clarify the roleof the U1 snRNP and identify additional key factors in splicing are possible. MATERIALS ANDMETHODS Construction of d R I 8 : Mutations atpositions -1 and +6 of the 5’ splice siteof the white second intron were generated by in vitro mutagenesisusingthe polymerasechain reaction (PCR) (SAIKIet ul. 1988). A degenerate oligonucleotide (5‘-
TACCGGCGCCCAGGAAACATITGCTCAAGAACNGTGAGNTTCTAT-3’) spanning the NurI restriction site at11127 and the 5’ splice site at 11156 was used in combination with an oligonucleotide (MG5: 5’CCAGGGTCGTCTTTCCGGCACCGGAACTGCCC-3‘) inthedownstream exon togenerate PCR products with mutations at these two positions. These mutagenized PCR products were then cloned into M13mp19 for sequencing, and 13 of the16possible combinations of nucleotides at positions -1 and +6 were obtained. Selected mutations, including the-1C, +6C double mutation (DR18) were then cloned as a PvuI/NurI fragment into P[B4hsfi-ulI which consistsof a functional white gene under the control of the hsp70 promoter, in a P element transformationvector (STELLER and PIRRO~TA 1985). Constructionof U1 suppressors: The 3A to G (UI-3G) and 9 c to G (U1-9G) single site compensatory mutations and the double mutant suppressor with both compensatory mutations
snRNAs Suppressor U1 in U1 (U1-3G,9G) were generated in vitro byPCR using the Drosophila Ula geneof the clonepDmU1.4b. The pDmU1.4b construct consists of a l-kb EcoRI/BumHI fragment from the Drosophila U1-21.1 gene including 430 bp of 5"flanking sequence and 400 bp of 3"flanking sequence (MOUNT 1983). A 50-mer oligonucleotide complementary to the 5'end of the U1 coding sequence and part of its immediately 5"flanking sequence (PL15: 5'-CGCCTTCGTGATCACGGTTAACCTCTACGCCX3GTAAGYATGCTITCCTC-3';S = G or C; Y = A or G) was used in combination with oligonucleotide PL14 (5'CAACCCAACTGCAGATGTAAC-3'), a 21-mer that hybridized in the U1 5"flanking sequence about 120 bp upstream of the U1 coding sequence. PCR products were digested with PstI and BclI and replaced the same PstI-BcZI fragment of pDmU1.4b. Clones were sequenced to identify the desired mutations in the 5' end of the U1 coding sequence. The Ula suppressors obtained were named pPL25 (Ula-3G), pPL24 (Ula-SG), and pPL23 (Ula-3G,9G). Chimeric Ulb constructs possessing the Ulb sequence variation (G134 to U) and 1.1 kb of Ulb 3"flanking sequences with a Ula promoter were constructed by substituting a 1.2-kb BamHI/BcZI fragment (derived from the U1-82.1 gene in the clone pPL6) (Lo and MOUNT1990) for the equivalent fragment in each of the Ula suppressor constructs and pDmUl.4b. This resulted in the creation of hybrid U1 suppressor genes. These plasmids were named pPL33 (Ulb-wt), pPL32 (Ulb3G), pPL3l (Ulb-SG), and pPL30 (Ulb3G,9G). For the Pelement-mediatedtransformation offlies, all eight U1 suppressor genes were cloned into theuermilion-Pelement transformation vector pYC1.8 (FRIDELL and SEARLES 1991).The EcoRI/SaZI fragment containing the U1 gene with all its associated 5'- and 3"flanking sequence from each U1 suppressor construct was end-filled and ligated into SalISut and end-filled pYC1.8 to generate vermilion-Pelement transformation clones of each of the eight suppressor genes. These clones were designated as follows: Ula-wt= pPL29; Ula-3G = pPL28; Ula-9G = pPL27; Ula-3G,9G = pPL26; Ulb-wt = pPL37; Ulb3G = pPL36; Ulb-9G = pPL35; and Ulb-3G,9G = pPL34. Transformation of flies: Microinjection and P elementmediated transformation were carried out as described (SPRADLING and RUBIN1982),using P [ 1\2-31(99B) as a stable genomic source of P transposase (ROBERTSON et al. 1988). Expression of P[ dR18]in a w- background was used to identify transformants of this transgene. The -1 alteration also changes the codon at the splice site from GUU (Val) to CUU (Leu). Although this position is a hydrophobic amino acid conserved among related proteins, many proteins in this family(ABC transporters) have leucine in this position (HIGGINS 1992).Furthermore, the ability of P [ d R f 8 to ] confer some pigmentation is evidence that the valine to leucine substitution does not affect protein function, as does agreement between the level of pigmentation observed and that expected from the efficiency of splicing. Transformants of the U1 clones in pYC1.8 were obtained by injection of u;P[ry+ 1\2-3](99B) embryos. The resulting Go flies were crossed to v;TMG/CxD flies and transformants among the F, were identified as vermilion+flies in a vermilion- background. Chromosomes were isolated from single transgenic males lacking P[y' 112-31(99B) by standard genetic methods (ASHBURNER 1989). Co-transfectionexperiments: Drosophila Schneider L2 cells were maintained in 1 X Schneider's Drosophila medium (Gibco) supplemented with 10% fetal bovine serum (heatinactivated; Gibco). Calcium phosphate/DNA transfection of Schneider L2 cells was carried out as described in HANet al. (1989). Cellswere exposed to the DNA-calcium phosphate precipitate (7 pg of U1 plasmid and 3.5 1-18of dR1plasmid) 8 for 18-24 hr and then washed with 1 X phosphate-buffered ry+
in Drosophila
367
saline and allowed to recover in fresh medium for 3-4 days before being harvested for total RNA isolation. Cell number and viability were assessedby counting and uypan blue staining. Isolation of total RNA by guanidinium isothiocyanate/ SDS lysis and a CsCl step gradient were as described by KING STON (1989). This total RNA was then treated with RNase-free DNase (RQl DNase, Promega Biotech Inc.) to removeany contaminating plasmid or genomic DNA. Immunoprecipitation of U1 snRNPs from nuclear extracts of co-transfected Schneider cells: Nuclear extracts from cotransfected Schneider cellswere prepared as described in DICNAM et al. (1983), with modifications for small scalepreparations (LEEand GREEN 1990). Immunoprecipitation of U1 snRNPs from these nuclear extracts using a human anti-U1 RNP antiserum (antiserum MA; a kind gift of PAUL ROTHMAN) and isolation of U1 snRNA from the immunoprecipitated U1 snRNPs were as previously described (LO and MOUNT1990). QuantitativereversetranscriptionPCR assay: Total RNA was isolated from adult flies as previously described (LO and MOUNT1990). Each sample of purified total RNA (500 ng; treated with RNase-free DNase) was first annealed (70" for 5 min; slow cool to 30") in 10 pl [20 mM Tris (pH 8.4), 25 mM KC11 with 10pmol of a 32-mer that hybridizes inthe white third exon, immediately downstream of the second intron (oligonucleotide MG5: 5'-GCAGGGTCGTCTTTCCGGCACCGGAACTGCCC-3') . The annealings were brought up to 20 pl [20 mM Tris (pH 8.4),25 mM KCl, 1.5 mM MgCl,, 0.05 mM dNTPs, 10 U RNasin (Promega)] onice and reverse transcribed with 1 unitof avianmyeloblastosisvirus ( A M V ) reverse transcriptase (Life Sciences) for 40 min at 42". These reactions were brought up to 50 pl [20 mM Tris (pH 8.4), 25 mM KCl, 1.5 mM MgCl,, 0.05 mM dNTPs, 12.5 pCi [a-32P]dCTP(3,000 Ci/mmol)] on ice and added to this were 2 units of Tug polymerase (Cetus) and 100 fmol of a 25-mer that anneals in the white second exon, immediately upstream of the second intron (oligonucleotide JW2: 5'-CGGAATTCAGCGACATACCGGCG 3'). Each PCR mixture was then aliquoted into 0.5-ml tubes and overlaid with 50 pl of water-saturated mineral oil. The tubes were quickly transferred from ice to a thermal cycler at 94" and amplified for a variable number of cycles (94" for 1 min, 60" (2 set/' ramp rate)for 1 min, 72" for 1 min); samples were separated on a 5% nondenaturing polyacrylamide gel, which was then dried and visualized by autoradiography. Radioactivity inthe gels was quantitated with a PhosphorImager (Molecular Dynamics) using ImageQuant software (v. 3.1), and the intensity of bands was reported as "pixel value." While variation between experiments in transfection studies was acceptably small (see error bars in Figure 4),unknown sources of variation between fly RNA preparations (data not shown) made it impossible to verify the suppression in transformed flies by examining RNA from d R 1 8 flies. Primer extension assays of U1 sequence variants: Primer extension assays were performed as previously described (Lo and MOUNT1990), with the following modifications. Four micrograms of total RNA (treated with RNase-free DNase) was annealed to 200 pmol of theappropriate "P-end-labeled primer and extended with AMV reverse transcriptase (Life Sciences) in the presence of the appropriate combination of three dNTPs (375 p ~ and ) one ddNTP (94 VM). Extension of a %-mer complementary to U1 positions 7-39 (PL18: S'-CCTTCGTGATCACGCTTAACCTCTACGCCAGGT-3') in the presence of ddTTP results in a 37-nucleotide extension product from U1 snRNAs witha wild-type nucleotide A at position 3 (Ul-wtor Ul-gG), and a 39 nucleotide extension product from templates with a G atthat position (Ul-3G or U1-3G, 9G). Extension of a 27-mer complementary to U1 positions
C.
P. 368
H. Lo, D. Roy and S. M. Mount
13-39 (oligonucleotide PL19: 5'-CCTTCGTGATCACGGTTAACCTCTACGS') inthe presence of ddGTP, results in a 31 nucleotide extension product from wild-type templates (UI-wt or U1-3G) and a 32-nucleotide product from 9G templates. Extension of a 28-mer complementary to U1 positions 137-164 (PL4: 5'-TCGGGACGGCGCGAACGCCAlTCCCGGC-3') in the presence of ddCTP, results in a 31-nucleotide extension product from Ula (134G) and a 32-nucleotide product from Ulb (134U).
tion. Its suitability and accuracy depends on the small size of the intron, and our ability to quantify the two product bands during exponentialamplification. Using this quantitative RT-PCRassay,we examined the s/u ratio of white RNAs from flies carrying either P[ dR"] orthe P[B4hsp-w] parental allele (Figure 2). It is clear that the -1C, +6C double mutation causes defects in the splicing of the second intron of dR". Although the unspliced RNA species is detectable by the RESULTS RT-PCR assay in both the dR"and wc samples (e.g., lanes 4, 5, 10 and l l ) ,the second intron of dR" is inA 5' splice site mutation leadingto accumulationof an efficiently removed (lanes 4 or lo), and the s/u ratio is unspliced intron: It is critical for this study that the 5' about one,60-fold lessthan wild type.This is optimal for splice site mutation chosen for analysis be suppressible, and that theresulting alteration in the efficiency of splic- detecting even low levels of suppression or enhancement by extragenic modifiers, including thesuppressor ingbe recognizable in the white phenotypebeing U1 RNAs described in this study. scored. We introduced mutations positions at -1 and +6 SuppressorU1 RNAs: To examine suppression of the of the 5'splice site ofthe second intron of the whitegene splicing defect of d"', we placed compensatory base of D. melanogaster, a 74nucleotide intron whose splicchanges in the 5' end of the wild-type Drosophila U1 ing has been studied in our laboratory in vitro (Guo et snRNA (designated U1-wt) that would partially or fully al. 1993). The wild-type site, ACG I GTGAGTT, has restore base-pairing of U1 withdR1' (Figure 1).An A to seven consecutive nucleotides that could potentially pair G base change atU1 position 3 would allowbase-pairing with the 5' end of U1 RNA (Figure 1A). Mutations at with the f 6 U to C mutation of dR1', while a C to G positions -1 and +6 should weaken this base-pairing change at U1 position 9 would allow base-pairing with without disrupting it by reducing the number of conthe -1G to C mutation (Figure 1A).Both single site supsecutive base pairs between the white 5' splice site and pressors (designated U1-3G and U1-9G,respectively) wild-type U1 RNA from seven to five, reducing the AG and the doubly mutant suppressor (U1-3G,9G)were of binding by approximately 4.8 kcal/mol (Figure 1A). placed in the context of a wild-type Ula gene with 1.1 The -1C, +6C double mutation (ACGIGTGAGT to kb of upstream, and 0.2 kb of downstream, flanking seACC I GTGAGC) and each of the two component single quences. Based on analyses of the control of U1 tranmutations were obtained, and each was placed in the scription in Drosophila and other species (HERNANDEZ context of a functionalwhite allele in aP element trans and LUCITO 1988; VANKAN and FILIPOWICZ 1989; ZAMROD formation vector (P[B4hsp-w]) (STELLER and PIRROTTA et al. 1993), and the pattern of interspecific conserva1985).Transformants carrying the -1C, +6C allele tion of U1 flanking sequence elements (LO and MOUNT (P[dR"]) were identified byeye color, and chromo1990),it seemed likely that this would be sufficient flanksomes carrying this transgene were isolated by standard ing sequences to allow correct transcription and progenetic methods. These flies displayed an apricot eye cessing in vivo. color ideal for suppression studies. To test the significance of the Ulb embryonic variant We first examined theeffect of this mutation on splic(134G to U; see Figure l ) ,hybrids between Ula and Ulb ing by comparing white RNA from flies carrying either were constructed.These hybrid genes carry the 5'P[dR18]or the P[B4hsp-w] parental allele, which differ flanking sequence of the Ula suppressor genes, but the only by the two base changes at-1 and + 6 of the 5'splice Ulb variant nucleotide and 3'-flanking sequence of site of the second intron. In both transgenes the white Ulb. Thus, all eight U1 constructs should beunder the gene is under the control of the hsp70 promoter. The same transcriptional control, as has been demonstrated activity of the uninduced heat shock promoter in the for mouse Ula/Ulb hybrid genes transfected in mouse relevant cells ofthe developing eye iscomparable to that tissue culture cells (CACERES et al. 1992). TheseUlb supof the natural white promoter, and hsp70-white fusions pressors were used to examine the effect of the Ulb are phenotypically identical to the correspondingwhite sequence variant on the ability of the U1 compensatory genes (STELLER and PIRROTTA1985;KURKULOS et al. mutations to suppress d R 1 8 . 1994). RNAs that retain the second intron accumulate The ability ofthe suppressor U1 RNAs to alleviate the in dR1', and the ratio between the abundance of norsplicing defect of 7UDR1' was first analyzed by calcium mally spliced forms and these unspliced forms (hencephosphate co-transfections of Drosophila Schneider tisforth "the s/u ratio") can be determinedby quantitative sue culture cells withthe d R 1 8 plasmid and each of the reverse transcription and PCR (RT-PCR) [for a review eight U1 genes. Total RNA was isolated from the transsee FOLEY et al. (1993); see MATERIALS AND METHODS]. This fected cells, and the s/u ratio for dR" in the presence technique involves the direct quantitationof PCRprodof each U1 construct was determined by quantitative ucts by incorporation of radioactivity during amplifica-
Suppressor U1 snRNAs in Drosophila 4 7 (kcal/mol)
A
-
w.t. 5'ss
5'-..A
w.t. U l a
3'-..G
DR18 5'ss
5'-..A
w.t. Ula
3"..G
GA G C U..-3' I 1 * 1 I U C C A W W C A U..-S'
DRlS 5'ss
5"..A
C CIG U Q
u1-x
3"..G
U C
DRl 8 5' ss
369
U A G G U U..-3' I 1 1 . 1 I I U C C A W W C A U..-5'
C GIG
-12.0
C GIG U
A G C U..-3' I I * I I I C A W W C Q U..-5'
U1-9G
5'-..A C GIG U G A G 6 U..-3' I I I * I I 3"..G U E C A W \ y C A U..-5'
DR18 5' ss
5"..A
u1-X,%
3"..G
A G U..-3' I 1 1 ' 1 I I U Q C A W\y C U..-5' C ClG U G
-7.2
-10.7
-8.9
-12.4
B UC A c G A A G m G 3GPPP,J?nl 'GCG C G ' C G U1-3G A U Wl A U
A
C
GC A U II G V GC GCGUA C G G A G ~ ~ A G G C U U G G C C A U U G ~ A UGCGU GUCUCCAGUUGAGUCGG~ GC G u cc U CG A UA A 'A U U A u Ill U UA U AU
Ula
FIGURE 1 .Sequences of suppressor U1 RNAs. (A) Potential base-pairing between the 5' splice site of the white second intron with the 5' end of U1. Pairing between the wild-type 5' splice site with wild-type U1 is shown at top. Below this is shown the dR"5' splice site base-paired with wild-type Drosophila U1 and each of the suppres sor U1 RNAs described in this study. For comparative purposes, the contribution of each pairing to AG3, (TURNER et al. 1988) is indicated to the right. AG2, values would be similar.(B)Location of U1-3G, Ul-gG, and Ulb sequence changes on the Drosophila U1 molecule. The nucleotide changes of the U1-3G and U1-9G compensatory mutations and the Ulb sequence variation are shown on the standard secondary structure of the wild-type Drosophila Ula molecule (MOUNTand STEITZ1981). Conserved nucleotides (5-9 and 133-137) that participate in a possible long range et al. 1992) are bracketed. interaction (STURCHLER
P. C. H.
370
Lo.D. Roy and S. M. Mount
17 cyda
IS cydes
19 cycles I
I
I
mng
OD
c +
n
unsplid-
spud-
1
2
3
4
5
6
7
8
9
1 0 1 1 1123 1 4 1 5
RT-PCR. Because no 7uhite RNA could be detected in nontransfected cells (data not shown), all of the RNA seen here must be derived from 7U""X. Typical results for the Ula series of suppressors from one experiment are shown in Figure 3. In this experiment, theamplification of the spliccd and unspliced cDNA bands is exponential (linear on the semilog plots) from cycles 18 to 22 in all four RNA samples. Since these products are all being exponentially amplified in the same manner (the eight semilog-plotted lines are parallel), we can reliably compute the S/II ratio for each co-transfection sample and compare the different ratios with each other. A complete experiment involved co-transfection of 7 ~ ' " ' ~ with each of the eightsuppressors, plus a negative control of no added suppressor. To facilitate a comparison of the results from three independent experiments, the s/u ratios of eachexperiment were normalized to the sample with no added suppressor. These normalized ratios ("-fold suppression") were then averaged for each suppressor construct from the three experiments (Figure 4). With no added suppressor U1, the s/u ratio for 7 f l R ' * under our transfection conditions averages 0.22, indicating a hundredfold decrease in splicing efficiency relative to the equivalent construct with a wild-type 5' splice site, which has a s/u ratio of 22. While this s/u ratio indicates that splicing is about fivefold more efficient in flies than in transfected cells, the decrease in splicing efficiency is comparable to the 60-fold decrease o h served with ru"R'Xflies (Figure 2; data notshown). Steady state levels of suppressor U1 snRNAs were determined by primer extension assays using the same RNA samples (see MATERIAIS AND METHODS). Assays specific for Ul-SG, U1-9G and Ulbwere carried out by extension of a specific labeled primer in the presence of three deoxynucleotides and one dideoxynucleotide, resulting in one extension product for the wild-type sequence andanother slightly longer extension product for the mutant sequence (Figure 5A). That these U1snRNA sequence variants were present in snRNP particles was confirmed by immunoprecipitation with an anti-U1 snRNP antibody, using nuclear extracts of transfected cells from a
3
1
4
p 3 e
h
FICURF. 2.-Re\~erse transcription-PCR assav of RNA from flies carrying 71j'H'S. Total RNA (100 and 500 ng;treated with RNascfrce DNase) from JJR/A'( 71,//f.%';p[71jVt/8 ] 1) or ?I)* ( I I ) ~ " ' ; P [IWt.sp-71)]) adult flies was subjected to 15, 17, and I!) cycles of RT-PCR (see MMT.RIA~S AND Mn-tIoDs). The resulting labeled PCR productc were separated on a 8 % nondenaturing acylamide gel and visualized bv autoradiography. tRNA = negative control of RT-PCR using 5 pg of carrier tRNA. plas mid DNA = positive control RT-PCR using I pg of pP[rd'"#] plasmid DNA to verify size of the unspliced band.
18 17 16
parallel suppression experiment. When extracted RNAs from the immunoprecipitated U1 snRNPswere analyzed by the 3G and 9G primer extension assays, it was o h served that all six suppressor mutations were present in U1 snRNPsin approximately the same relative levels seen in the total RNA .samples (Figure 5B; compare Figure 5A). Ula-3G and Ulb3G partiallysuppressthe dRf8 doublemutation in transfectedcells: Co-transfection with the wild-type U la gene had virtuallyno effect on the S/II ratio of IU"'"~' (Figure 4). indicating that transfection with Ula constructs per se has a negligible effect on the splicing efficiency of the ruhife second intron. Thisw a s also observed for co-transfection withwild-type Ulb (Figure 4), in which case we could directly veri9 an increase in the amount of Ulb with the Ulb primer extension assay (Figure 5A, lanes 8 us. 9). Therefore, any suppression observed with theother U1 constructs should be attributable to their respective compensatoty base changes in the 5' end of the U1 coding sequence. Both U 1-3Gsuppressors were expressedat steady state levels readily detected by the U1-3G assay (Figure 5A, lanes 4 and lo), and each w a s able to suppress the splicing defect of 7 f l R I X to the same extent (4-sfold; Figure 4). These resulu show that it is possible to partially s u p press the 7U""" 5' splice site double mutation in transfected cells with a U1 snRNA bearing a single compensatory mutation complementary to the +6C intronic mutation of 7 ~ ' ' ~ ' ~These . results also showthat theU laU 1b hybrid genes areactive inSchneider cells and that the U1b variant of 11. melnnoguster is functional in vivo. More suppression is achieved with Ula-3G,9G than with Ulb3G,9G: Because UI-SG,SG should restore full base-pairing of U1 with the double mutant 5' splice site of ru""", it w a s expected to be a more efficient suppressor than the U 1-3G suppressor. The Ula-3G,9G suppressor caused a 4-5-fold partial suppression of the 7 ~ ' ' ~ ' ~ splicing defect in transfections, similar to that observed with the Ul-SG suppressors (Figure4). However, because the level of the Ula-SG,SC suppressorin transfected cells w a 9 much lower than that of the Ula-3G suppressor(Figure 5A, 3G assay of lane 6 vs. 4). it appears that the Ula-
Suppressor snRNAs U1 UW3C
U1.-wt
UI.-X;,9C
U1.-9C
1-7
Craa
18
19
20
21 22
9
18
$9 20
21
n
B 18
1s
20
21
in Drosophila
n
a 5
18
1s
20 21 22
"nlpl-
7 0
~
S -195 "!
rpt-
-
0
,0
.
Id
-
*M
Id
PCR e y c l e a
PCR c y c l r
PCR ye*r
PCR ycln
-121
37I
FIGCRE 3.-Typical quantitative RT-PCR results for Ula suppressor co-transfections. Quantitative RT-PCR (18-22cycles) wascamedouton total RNA samplesfrom Schneidercellsco-transfectedwith the J""pIasmid and the indicated Ula suppressor construct. The RNnw control ("RNaw")for each set of RT-PCR reactions had DNaw-free RNaw added to the primer annealing of the reverse wanscription step and were subjected to 22 cyclesof RT-PCK. An autoradiograph of the labeled PCR products .wparated on 5% nondenaturing gel is shown at top. Quantitation is shown below. The spliced and unspliced ban& from each set of RT-PCR reactions were quantitated in arbitrary units (pixel value) a5 described in M~~ERLUS AYD M ~ ~ I and ) S plotted against the number of PCRcycles on a semilog graph. The graph for eachset of RT-PCR reactions is shownbeneath the corresponding portion of the autoradiograph.
U1-9Gsuppressesd'R'8weaklyornot at all:: Suppression by U1-9G depends on restoration of base-pairing between the ninth nucleotide of U1 and the exonic-1 position of the 5' splice site. While the Ula-3G single site compensatory mutation suppresses 7J"I8 fairly well at 4-5foId. Ula-9G suppresses only 2-fold. This is despite 4 4 a steady state level of the U 1a-9G suppressor that is similar to that of Ula-3G (Figure 5A; 9G assay of lane 5 vs. 3G assay of lane 4). We conclude that Ula-9G is less efficient as a suppressor than is Ula-3G. Intriguingly, Ulb9G shows little if any suppression. An examination of the Ulb9G steady state level reveals that this is again attributable to a somewhat lower level of expression of the U 1b form. However, the level of the Ulb9G suppressor in the transfected cells is still significant (Figure 5A, 9G assay of lane 11).lying between 01 .s a a b a b a b athatb of the U lb3G,9G suppressor (3G and 9G assays of a, " " lane 12) and that of the U1 b3G suppressor (3G assay of lane 10). 2 U1-wt U13G U1-9G U13G,9G U13G suppressors function in whole flies: Having FIGURE 4.Suppression of dR" by U1 compensatory muestablished that thesplicing defect of ~'""~wa..suppresstations in Schneider cell cmransfections. The -fold suppresible by the appropriate compensatory mutations in the ~ 'each ~ of the eight U1 suppressors in sion (see text) of U I "by 5' end of U1 snRNA in transfected Schneider cells, we Schneider cell co-transfections is shown; a and b refer to the adult (134G) and embryonic (134U) forms, respectively. The next asked whether the same suppressor U 1 RNA5 could baselinevalueof in theabsence of co-transfection with phenotypically suppress the eye color defect of IJ)~'' in U 1 is defined as 1. Error bars show the standard deviation of flies. All eight suppressor ConstructS were cloned into a three separate experiments. suitable Pelement transformation vector carrying the v+ marker (FRIDELL and SFARLL.1991) and second chro3G,% suppressor is indeed a more efficient suppressor. mosome insertion lines were obtained by standard In contrast to the Ulaform of the 3G,9G suppressor, methods (see MATERIALS AND METHODS). To test for the U 1b3G,9G suppressed less than Bfold, significantly effect of each suppressor on the apricot eye color of lower than the 4-5fold suppression observed with the zd)'IR, flies withor without one copy ofa U1 suppressor Ula form. This differencecan be attributed to a steady were compared. Among the eight U1 constructs, transstate level of Ulb3G,SG that is even lower than that of formant lines that phenotypically suppressed the eye Ula-3C,9G, as detected by both the 3G and 9G assays (Figure 5A, lane 12 vs. 6 ) .This lower level of Ulb3G,9G color defect of 78'"were obtained only for the Ul-3G was also seen relative to the U l b w t and Ulb3G consuppresors. OneU 1a-3G and two U 1b3G transforman t structs using the Ulb assay (Figure 5A, lane 12 vs. lanes lines showed partial suppression of the u f R I R phenotype 9 and 10). However, the reasons for the lower levels of (Figure 6 ) .The strongest suppression was observed for U 1 b3G,9Gare not known (see DISCUSSION). the Ulb3G line l c l , which darkened the w'"'* apricot
IaL v)
372
P. C . H. Lo, D. Roy and S. M. Mount
A.
DR18
a
+
Ula
0
8 1 30 Wl
9G wt
-
30,
O
8
no wt 3 0 9 0 9 0
1
1
1
1
1
+
DR18
-
r ' O a
' D l
30,
3 0 90 90
no wt
1
1
Ulb
1
1
1
1
-
-
9G
assay
Ulb-
wt
Ulb
-
assay 1
4
3
2
6
5
7
8
9
1 0 1 1 1 2
B. OR18
2 a
+
Ula
0
e 1 30
-
wt
-
90
wt
DR18
+
Ulb
"
36,
no wl 3G 9G 9 G wt 3G 9G
1
1
1
1
1
-
1
1
1
36. 9G
I
9G
assay
. I
2
3
4
5
6
. 7
8
9
1
0
FIGURE 5.-Expression of U1 RNAs in co-transfectedSchneider cells as determined by primer extension assays. (A) Primer extension assays on total RNA from Schneider cell cotransfections. Total RNA was annealed to the appropriate"Pend-labeled primer and extended under theappropriate conditions for the 3G, 9G, and Ulb assays (see MATERIALS AND METHODS). Extension products from these assays were separated on a 15% sequencing gel and visualized by autoradiography. Each assay is shown on a separate panel; indicated to the left ofeach panel are the positions of the wild-type extension product ("wt") and the slightly longer extension product indicative of each particular base change being assayed ("3G," YG," and "Ulb"). The "no DR18" lane is a negative control of Schneider cells transfected with a control plasmid (pUC19). The "no" lane for the Ula andU l b suppressor co-transfections plasmid co-transfected with no are negative controls of w''''~ suppressor. The data shown here is typical of three separate assays from independent transfections. (B)Primer extension assays on U1snRNA isolated from U1snRNPs immunoprecipitated from nuclear extracts of theSchneider cell cotransfections. The U1 snRNA from the immunoprecipitated U1 snRNPs weresubjected to the 3G and 9G assays, shown in the two separate panels.
eye color appreciably (Figure 6A). Slightly weaker sup pression was shown by the other Ulb-3G line, 4bl (Figure 6B). The one Ula-3G line that suppresses phenotypically, 55e1, had theweakest darkening effect of these three lines on the w " R ' R eye color (Figure 6C). In contrast to these three actively suppressing lines, three Ula-3G lines and one Ulb-3G line had no detectable effect on theeye color phenotype of zd'R'8. An example of this, the Ulb-3G line 8b1, is shown in Figure 6D for comparison with the three other lines. Expression of the U1-3G suppressor snRNAs in the three actively suppressing transformant lines was examined by the 3G primer extension assay in total RNA samples from adult flies heterozygous for the suppressors (Figure 7). These three lines were compared to three other U1-3G lines, two Ula-3G and one Ulb-3G, As can be that did not phenotypically suppress dRiR. seen in lanes 4, 6, and 7 of Figure 7, expression of the U1-3G suppressors in the three active lines was easily detectable over the background levels of the two negative controls in lanes 1 and 5, and the amountof U1-3G suppressor relative to endogenous U1 is roughly the same for these three lines. The samples from the phenotypically non-suppressing U1-3G lines (Figure 7, lanes 2, 3, and 8) did not show any levels of the U1-3G extension product above the background levels of the negative control lanes. Thus, suppressor U1 snRNAs activein whole fliesare able to partially suppress the eye color phenotype of dRiR to differing extents. Non-suppressing Ul-3G lines do not appear to express U1-3G snRNA (Figure 7), so phenotypic suppression is correlated with expression of the transformed U1-3G construct. However, in those lines that do show expression of UlSG, the degree of phenotypic suppression is not quantitatively correlated with the relative expression levels of U1-3G. Functional U l S G leads to defects in viabilityand fertility: During the construction of stocks carrying the U1-3G insertion lines, it appeared that none of the three actively suppressing lines were viable as homozygotes, whereas all of the four non-suppressing lines were homozygous viable.This observation suggested that lethality might result from expression of the U1-3G suppressor snRNA above a critical level. To testthispossibility, crosses leading to trans-heterozygous combinations of U1-3G suppressors were carried out. Flies carrying any two copies of the three active transgenes were inviable, but combinations involving any of three inactive lines were viable(Table 1). Since one copy ofan active U1-3G transgene did not cause subvitality when compared to sibling flies with no U1-3G transgene (data not shown), it is clear that the expression level of suppressor U1 snRNAs from two copies, and not onecopy, ofan active U1-3G transgene can cause semi-lethality. For all three active lines, homozygous adults were observed at low frequencies during maintenance of stocks.
Suppressor U1 s n R N A s in Drosophila
373
FIGURE 6.-Phenotypic suppressionof dR1' by UlSG in transformed flies. In each panel are shown two sibling male flies carrying one copy of P[dR1']; thefly on the left has no UlSG transgene, while the fly on the right has one copy of a U1-3G transgene. (A) The effect of one copy of P[Ulb-3G]lcl on P[dR1']. Genotypes: wlll', P[dR1']3;Cy0/+ (left) and w'",' P[dR1']3;P[v+, Ulb3G]lcl/+ (right). (B)The effect of one copy of P[Ulb3G]4bl on P[dR1']. Genotypes: wl"', P[dR1']3;Cy0/+ (left) and wl"', P[dR1']3;P[v+,U1b3G]4bl/+ (rifht). (C) The effect of one copyof P[Ula-3G]55el on P[dm']. Genotypes:wlI1', P[dR1']3;CyO/+ (left) and wl'', P [ d R ' ]3;P[v+,Ula-3G]55el/+ (right). (D) The effect of one copy of nonexpressing P[Ulb 3G18bl on P[dRIB].Genotypes: wl"', P[dR1']3;CyO/+ (left) and wl"', P[dR1']3;P[v+,U1b-3G]8bl]/+ (right).All flies shown are wild-type for the vermilion locus.
When crosses of these homozygous escapers to other strains were attempted, it was discovered that fertilitywas reduced in both sexes oftwo of these three lines (P [Ulb3Gllcl and P[Ulb3G]4bl; data not shown). The severity of infertility correlates with the strength of s u p pression ofdR1', and is stronger in homozygous females than in corresponding homozygous males ofthe same line. DISCUSSION
We have nowdemonstrated suppression of a 5' splice site mutation in D. melunoguster by compensatory mutations in the 5' end of U1, both molecularly in transfected cellsand phenotypically in transformed flies. This is the first demonstration of genetic suppression of a 5' splice sitemutation in a whole metazoan organism. The suppression we have observed both in transfected cells and in transformed flies is partial, a result that would have been expected in both cases because of a background of wild-type U1, and because base-pairing with
U1 snRNA is not the sole determinant of 5' splice site N h in transiently transrecognition. Suppressor U1 R fected cells were expressed in the context of endogenous wild-type U1,and were only a fraction the of total U1 snRNA (Figure 5). Similarly, because wild-type Drosophila strains possess five or six potentially active U1 snRNA genes (Lo and MOUNT1990), a single U l s u p pressor transgene, expressed at an equivalentlevel, would contribute only 1/13th to l / l l t h of the U1 RNA in a diploid fly. Again, an excess of wild-type U1 was indeed confirmed by primer extension assays (Figure 7, lanes 4,6 and 7). Two characteristics of dRle contribute to our ability to detect partial suppression by the U1 compensatory mutations. The first is that this 5' splice site mutation results in the accumulation of an RNA that retains the second intron, indicating both that splicing of this intron is defective and that this unspliced white RNA is relatively stable compared to the spliced RNA in both transfected cellsand transformed flies. While we do not
374
P. U1a-3G flies
C.H.Lo. D. Roy and S. M. Mount
U1b-3G flies
compared to either the Ula-3G or Ula-9G constructs. Both of the single mutant Ula constructs are expressed at comparable levels to each other but the doubly mutant Ula-SG,SC construct attains a much lower steady state level than these two constructs This suggests that two mutations in the 5' end of U1 somehow cause it to 1 1 1 1 1 I I I be less stable than the single mutant U1 suppressors. We note that mutations affecting the stabilty of human U1 have been described previously, and these were typically 3G those that might be expected to affect RNA structure or snRNP assembly (Yuo and WEINER1989b). Our data on the differing steady state levels of U1 1 2 3 4 5 6 7 8 suppressors, whatever their cause, can be combined with FIGURE 7.-U1-3G primerextension assay of total RNA data on the suppression of the splicing defect of I U " ~ " samples from UI-3C transformant fly lines. Total RNA samples in transfected cells to determine therelative efficiencies from adult flies with a single copy of the indicated Ula-3G or of the different Ula suppressor constructs. When corUIb3G uansgene were analyzed by the U13G asay. The nega tive controlswere total RNAs assayed from adult sibling flieslackrected for differences in abundance, the efficiency of ing a UI transgene. Genotypes: lane I , d""/Y;~yO/P[dJR'ql; suppression for the Ula series of compensatory mutalane 2, ~J"N/~P[v+,Ula-~C]51d2/P[dJR'~1; lane 3, d'"/ tions is 3G,9G > 3G > 9G. It is not surprising that the Y;P[v+,Ula-~C].i5b3/P[~J'r'~1; lane 4, d"RfiP[v+,Ula-3Cl3G,9C suppressor is the most efficient suppressor be5%l/P[7&JR'ql; lane 5, d"N/y;CyO/P[dJR'T1; lane 6, J""/ cause it fullyrestores base-pairing betweenthe 5' end of ~P[u+,U1b-3G]Icl/P[uPR'41; lane 7, w"'8fiP[v+,Ulb3Cl4bl/P[dJH'71; lane 8, d ~ ' R ~ , P [ v + . U l b - 3 G ] 8 b l / P [ ~ R ' ~ 1 . U1 and the double mutant 5' splice site of d'"' (Figure 1A). As for the single site suppressors, U1-3G is clearly more efficient than U1-9G. This result could be due to know the half-lives of the spliced and unspliced forms, a greaterintrinsic effect of the +6 intronic mutation on a comparison of steady state s/u ratios between samples splicing compared to the -1 exonic mutation. In support should directly reflect relative splicing efficiencies so long as these half-lives are constant and are independent of this possibility, co-transfection results with the single point mutations -IC and +6C indicated that the splicof RNA abundance. The second important feature of ing defect is relatively mild in both cases, but that the d Hisfthe Xseverity of its splicing defect, which allowed +6C point mutant ha. a somewhat greater splicing deus to discern partial suppression by the various U1 s u p fect than the -IC point mutant (data not shown). AIpressors in the transfected cells and transformed flies. If ternatively, the difference could reflect the ease of s u p the splicing defect of the 5' splice site mutation in the pression. U1-3G base-pairingwith the 1d"""5' splice site white second intron were milder, it might have proven is likely to be more stable than U1-9C base-pairing(AG3, difficult to discern low levels ofsuppression by the com= -10.7 kcal/mol us. AG3, = -8.9 kcal/mol; Figure 1A). pensatory U1 mutations. A third possibility is suggested by evidence that each of SuppressorU1 RNAs differ in theirefficiencyof sup these positions is also recognized by another U RNA pression: While all eight U1 constructs possessed the position -1 base pairs with nucleotide U40 of U5, and same L'la promoter, they reproducibly reached differposition +6 base pairs with nucleotide A41 of U6 (see ent steady state levelsin transfected Schneider cells. Introduction). Thus, it is also possible that the splicing Even if transcription rates were identical for all the U1 of this particular intron is more dependent upon correct suppressor constructs, there areseveral possiblereasons U5 recognition than upon correct U6 recognition, or for these different levels. One possibility is that the disthat the-IC change has a greatereffect on pairing with tinct Ulbspecific 3'-flanking sequence of the U l b s u p U5 than the +6Cchange hasonpairingwith U6. Finally, pressor constructs affect the efficiency of posta fourth possibility is that the U1-9C mutation prevent. transcriptional processing of these U 1b molecules. This base-pairing betweenU 1 RNA and the -1 position of the appears to be unlikely because a similar hybrid mouse 3' splice site. Such pairing in the fission yeast S. pombe U1 gene with Ulb coding and 3' flanking sequence attached to a U l a promoter accumulates the U1b snRNA is supported by suppression of 3' splice site mutations in transfected cells to comparable levelswith Ula snRNA and lethality of mutations affecting the corresponding U1 nucleotide (REICH et al. 1992). In contrast, mutations from a complete Ula gene (CACERES et al. 1992). Anat this position in S. cerevisiae are not lethal, and alother possibility, which we favor, is that either of the compensatory base changes in the 5' portion of the U1 though suppression of 5' splice site mutations is o b suppressors or the U1b sequence variation, or some served, no effect on 3' splice site choice is seen (S~RAPHIN combination thereof, affect the stability of U1 RNAs in and KANDELFLEWIS 1993). the Schneider cells. One example of this is the lower Ulb is less tolerant of the U1-9G mutation; support relative abundance of the Ula-SG,SG suppressor when for a long-range intramolecular interaction: The
-
&."
Suppressor in U1 snRNAs
375
Drosophila
TABLE 1 Viability of combinations of two P[Ul-SG] transgenes Males (Ula) 55el (Ulb) 4bl (Ulb) lcl Females (active)
(active)
lcl (Ulb) (active)
[
