Systemic Delivery of Modified mRNA Encoding

original article

© The American Society of Gene & Cell Therapy

Systemic Delivery of Modified mRNA Encoding Herpes Simplex Virus 1 Thymidine Kinase for Targeted Cancer Gene Therapy Yuhua Wang1, Hsing-hao Su1, Yang Yang1, Yunxia Hu1, Lu Zhang1, Pilar Blancafort2,3 and Leaf Huang1 1 Division of Molecular Pharmaceutics and Center for Nanotechnology in Drug Delivery, Eshelman School of Pharmacy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA; 2Department of Pharmacology and the Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA; 3Current address: School of Anatomy, Physiology, and Human Biology, Cancer Epigenetics group, University of Western Australia, Perth, Australia

Failure of clinical trials of nonviral vector-mediated gene therapy arises primarily from either an insufficient transgene expression level or immunostimulation concerns caused by the genetic information carrier (e.g., bacteriagenerated, double-stranded DNA (dsDNA)). Neither of these issues could be addressed through engineeringsophisticated gene delivery vehicles. Therefore, we propose a systemic delivery of chemically modified messenger RNA (mRNA) as an alternative to plasmid DNA (pDNA) in cancer gene therapy. Modified mRNA evaded recognition by the innate immune system and was less immunostimulating than dsDNA or regular mRNA. Moreover, the cytoplasmic delivery of mRNA circumvented the nuclear envelope, which resulted in a higher gene expression level. When formulated in the nanoparticle formulation liposome-protamine-RNA (LPR), modified mRNA showed increased nuclease tolerance and was more effectively taken up by tumor cells after systemic administration. The use of LPR resulted in a substantial increase of the gene expression level compared with the equivalent pDNA in the human lung cancer NCIH460 carcinoma. In a therapeutic model, when modified mRNA encoding herpes simplex virus 1-thymidine kinase (HSV1-tk) was systemically delivered to H460 xenograft-bearing nude mice, it was significantly more effective in suppressing tumor growth than pDNA. Received 9 July 2012; accepted 31 October 2012; advance online publication 11 December 2012. doi:10.1038/mt.2012.250

Introduction

Messenger RNA (mRNA) is frequently applied as a gene delivery molecule in the field of cancer immunotherapy and stem cell-based biomedical research as an alternative to plasmid DNA (pDNA).1–4 As a direct source of gene products, mRNA has several advantages, including a lack of requirement for nuclear entry,5 which poses a significant barrier to pDNA delivery, especially in nondividing cells. mRNA also has a negligible chance of integrating into the host genome,6 avoiding aberrant transcription and expression

of oncogenes caused by insertional mutagenesis. However, what prevents mRNA from becoming a conventional tool for gene therapy is its vulnerability to the ubiquitously expressed nuclease and the immune stimulation that substantially suppresses expression efficiency and elicits an immune toxicity in the host. Chemically modified mRNA synthesized in vitro and combined with naturally occurring modified ribonucleotides, has overcome the aforementioned shortcomings and shown great promise as a powerful therapeutic tool for gene therapy.4,7,8 Kormann et al. (2011) reported in vivo gene therapy using naked chemically modified mRNA as a therapeutic.7 The modification of mRNA through the incorporation of two nucleotide analogs substantially decreased activation of the innate immune response through the toll-like receptor (TLR) pathway, concomitantly increasing the intracellular stability. A single intramuscular injection of modified mRNA resulted in an elevated expression of mouse erythropoietin for up to 14 days,7 revealing the potential in vivo application of this technology. In this study, we attempted to systemically deliver modified mRNA to tumor sites. This was achieved by rationally addressing the challenges to systemic delivery of mRNA from several perspectives. First, mRNA transcripts were constructed with experimentally established structural modifications for enhanced stability and translatability.4 Second, the immune-stimulating property of in vitro transcription (IVT) mRNA was suppressed by completely substituting cytidine triphosphate and uridine triphosphate with 5-methylcytidine triphosphate and pseudouridine (ψ) triphosphate, respectively. Third, modified mRNA was encapsulated in a lipid/protamine/mRNA (LPR) formulation, which rendered the mRNA with high stability during circulation and possibly improved the pharmacokinetics after systemic administration.9 The functions of multiple components in the formulation of the LPR attributed to an improvement in its gene delivery efficiency. Two components played a role in protecting the LPR and prolonging its circulation; the polycationic protamine condenses nucleic acid into nanosized complexes to protect it from nuclease degradation and heavily coated polyethylene glycol (PEG) enables the nanoparticles to evade nonspecific uptake by the reticuloendothelial system10 to prolong circulation time after intravenous injection. The cationic liposomal membrane facilitates endosomal

Correspondence: Leaf Huang, Division of Molecular Pharmaceutics, Eshelman School of Pharmacy, Campus Box 7571, Kerr Hall, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599, USA. E-mail: [email protected]

358

www.moleculartherapy.org vol. 21 no. 2, 358–367 feb. 2013


Systemic Delivery of Modified mRNA to Tumor

a Protamine + +

+ +

RNA/protamine complex

+

DSPE-PEG2000 − −

− −

− DSPE-PEG2000-anisamide

Modified mRNA

LPR (lipid-protamine-RNA)

Preformed liposome

b

25

%

20 15

c

10 5 0 0.1

1

10

100

1,000

10,000

Size (nm)

50 nm

Total counts

50,000 40,000 30,000 20,000 0.2 µm

10,000

0

0

10

12

60

80

40

0

20

0

0

−4

−2

0

0

−8

−6

20

00

−1

−1

60

−1

−1

40

0 Zeta potential (mV)

Figure 1 Preparation and characterizations of the LPR. (a) Illustration of formulating-modified mRNA into LPR. Anionic mRNA was mixed with different amounts of protamine and DOTAP/cholesterol liposome to form the core/membrane structure complex. The nanoparticles were then PEGylated by post-insertion. (b) Representative histogram showing the size distribution and zeta potential of nanoparticle formulated with formulation 6. (c) Nanoparticles observed with transmission electron microscope (TEM). Bar: 0.2 μm. Inset bar: 50 nm. DOTAP, 1,2-dioleoyl-3-trimethylammonium-propane; DSPE, 1,2-distearoyl-phosphatidylethanolamine; LPR, lipid/protamine/mRNA; mRNA, messenger RNA; PEG, polyethylene glycol.

escape and the cytosolic release of the cargo. And finally, the low molecular weight anisamide (AA) that was grafted on the distal end of PEG facilitates receptor-mediated internalization of the nanoparticles into the sigma receptor overexpressing cancer cells. The present study was initiated with a formulation optimization study, followed by the assessment of in vitro transfection assays. The in vivo biodistribution of LPR and the tumor-specific expression of a model gene were studied using an in vivo imaging system. Systemic toxicity and the immune-stimulating property of the LPR nanoparticles were also examined. As a proof of concept, we delivered a therapeutic mRNA encoding the suicide gene herpes simplex virus 1-thymidine kinase (HSV1-tk) and demonstrated anticancer effect in a xenograft model. The results revealed the superior therapeutic value of the modified mRNA compared with dsDNA.

Results Modified mRNA is formulated in LPR nanoparticles with favorable physicochemical properties for systemic delivery

Modified mRNA was prepared with a T7 polymerase-based IVT kit with a yield of ~60 μg/reaction. In the self-assembly, liposome-based, core membrane nanoparticle formulation, the preformed DOTAP (1,2-dioleoyl-3-trimethylammonium-propane)/ cholesterol (1:1 molar ratio) liposome interacted electrostatically with the mRNA–protamine complex, inducing lipid bilayers to collapse on the core structure.9,11–13 As a result, spherical, solid, liposomal nanoparticles with a core/membrane structure were formed. The core supported and stabilized the liposomal membrane to Molecular Therapy vol. 21 no. 2 feb. 2013

allow up to 15% (molar ratio) of DSPE (1,2-distearoy-phosphatidy lethanolamine)-PEG and DSPE-PEG-AA to be inserted for stealth and targeting purposes, respectively (Figure 1a). LPRs of various compositions were prepared according to an experimental design provided for by a screening matrix (Supplementary Figure S1a), such that the optimal formulation could be evaluated based on particle size, zeta potential, and in vitro transfection efficiency. The mean hydrodynamic particle size and surface charge of the LPR were determined using dynamic light scattering and laser doppler electrophoresis techniques, respectively (Supplementary Figure S1b). The LPR prepared using formulation 6 resulted in a nanoparticle with the desired size (ca. 60 nm) and a relatively low zeta potential (ca. 25 mV) (Figure 1b), an indication of a high degree of charge shielding by PEGylation. The size of the LPR was confirmed with transmission electron microscopy (Figure 1c). To examine the stability of the LPR in the presence of serum and test whether the formulation could protect mRNA from RNAse, mRNA or LPR was incubated in the serum followed by an analysis of agarose gel electrophoresis. It was observed that the mRNA stayed encapsulated in the LPR despite the presence of serum protein, which protects the cargo from nuclease degradation (Supplementary Figure S1c). These favorable properties allow mRNA to maintain its biological integrity before being delivered intracellularly to the site of action.

LPR efficiently delivers modified mRNA into cancer cells for transgene expression We evaluated the biological activity of the LPR in vitro. A wellcharacterized sigma receptor expressing cell line NCI-H4609,14 359



b LPR

LPD

c

120

2 × 104 2 × 10

Mean fluorescence intensity

Expression (GFP)

%Uptake/%Transfected

Uptake (Cy3)

100 80 60 40 20

1 × 104 1 × 104 1 × 104 8 × 103 6 × 103 4 × 103 2 × 103

0

0 × 100

LPD

LPR % Uptake

d

LPR

120

Mean fluorescence intensity 100

%Normalized/%Transfected

100

Untrargeted-LPR

80

80

60

60

40

40

20

20

0

0 µm

g

1 × 104

% Survival

Luciferase pg/mg

1 × 103

1 × 102

120

120

100

100

80

80

60

60

40 1 × 101

1 × 100

0 5 µm 25 µm 50 µm Untargeted-LPR Haloperidol concentration

20 0 4

8 Modified mRNA

18

24

Unmodified mRNA

48

72

40

Viability

20

% Transfected

0

2

4

% Transfected

f

120

% Transfected

25 µM

50 µM

LPD

%Transfected

e 0 µM

4

Normalized mean fluorescence intensity (%)

a

6

8

10

12

0

mRNA concentration (µg/ml)

pDNA

Figure 2 In vitro transfection studies of the LPR. (a) Microscopic observation of cellular uptake and expression efficiency after administration of LPR or LPD. Nucleic acids (mRNA or pDNA) were labeled with Cy3 and the expression of transgene could be visualized by green fluorescent protein. (b) Quantification of cellular uptake and expression level with flow cytometry analysis. Percent of cells that took up nanoparticles and percent of cells that expressed transgenes were compared. The data were reported as mean ± SD. (c) Quantification of mean fluorescence intensity (MFI) with flow cytometry analysis. Expression level of each transfected cell, which was reflected by MFI, was compared for the H460 cells transfected with LPR. The data were reported as mean ± SD. (d) Epifluorescence microscopic photographs of transfected H460 cells in the presence of different concentrations of haloperidol. (e) Validation of targeting ability of anisamide ligand by transfecting H460 cells in the presence of sigma receptor ligand, haloperidol. Total green fluorescent protein and percent of transfected cells for the H460 cells transfected with LPR with and without targeting ligand, or in the presence of different concentration of haloperidol, was determined by flow cytometry analysis. The data were reported as mean ± SD. (f) Expression duration study with LPR loaded with luciferase mRNA. H460 cells were transfected with LPR or LPD loaded with equivalent amount of chemically modified mRNA, conventional mRNA, and pDNA that express firefly luciferase. Samples were assayed at different timepoints for luciferase expression level. The data were reported as mean ± SD. (g) Dose-response study and dose-toxicity study for LPR nanoparticle. H460 cells were transfected with various doses of LPR nanoparticle. Toxicity was monitored with 3-(4,5Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay while transfection level was monitored by flow cytometry analysis. GFP, green fluorescent protein; LPR, lipid/protamine/mRNA; mRNA, messenger RNA; pDNA, plasmid DNA.

was transfected with enhanced green fluorescent protein (GFP) mRNA-loaded LPR that had been prepared with various formulations (LPR 1–9). Transfection efficiency was quantitatively 360

determined by flow cytometry analysis 24 hours post-transfection. It was demonstrated that the LPR was able to transfect 68–78% of the population with a high gene expression level in individual www.moleculartherapy.org vol. 21 no. 2 feb. 2013



b

a High Heart

c

High

Heart Liver

Liver Spleen

Spleen

Lung

Lung LPR (RFP)

Kidney

LPR (control)

Kidney

Tumor

Low

Tumor Low

PBS

LPR (Texas red labeled)

LPR

LPR (RFP mRNA loaded)

e

9,000 8,000

40

7,000

35

6,000

Cytokine (pg/ml)

d

Luciferase pg/mg

30 25 20 15

5,000 4,000

Untreated Modified mRNA Unmodified mRNA pDNA

3,000 2,000

10

1,000

5

0

0 Heart

Liver

Spleen

Lung

Kidney

Tumor

TNF-α

IL-6

IFN-α

IL-12

Figure 3 In vivo biodistribution and transfection studies of the LPR. (a) Biodistribution of Texas red-labeled LPR in the major organs of H460 xenograft-bearing nude mice 4 hours post-administration. (b) Expression profile of mcherry RFP in major organs of H460 xenograft-bearing nude mice 24 hours post-administration. Modified mRNA encoding mcherry RFP was formulated in LPR nanoparticle and intravenously administered to H460 xenograft-bearing nude mice. The transgene expression in major organs was determined with Kodak in vivo imaging system. (c) Confocal microscopic image of cryosection from RFP-expressing tumor tissue after in vivo transfection. (d) Quantification of luciferase activity in major organs and tumor tissue 24 hours post-administration of LPR loaded with modified mRNA encoding luciferase. Animals were killed 24 hours after intravenous injection of LPR. Tissue lysate was subjected to luciferase assay to quantify the expression level of transgene. (e) Serum cytokine levels of LPR-treated CD-1 mice were examined by ELISA assay. Sera were collected from CD-1 mice that received single dose injection of LPR 4 hours post-injection. The cytokine levels were assayed with ELISA kits, respectively. The data were reported as mean ± SD. IFN, interferon; IL, interleukin; LPR, lipid/protamine/ mRNA; mRNA, messenger RNA; PBS, phosphate-buffered saline; pDNA, plasmid DNA; RFP, red fluorescent protein; TNF, tumor necrosis factor.

transfected cells (Supplementary Figure S1d). Out of all the formulations with high gene delivery efficiency, the LPR-6 was able to transfect ca. 68% of H460 cells with a high expression level of GFP. The compact particle size of LPR-6 indicated a complete condensation of mRNA. Moreover, there are extensive studies with regard to the correlation between the nanoparticle size and tumor penetration efficiency, all of which pinpoint that smaller size allows extravasation and deeper penetration into the crowded interstitial space in the tumor tissue.15–18 The relatively low zeta potential of this formulation would minimize the absorption of serum protein during circulation. Therefore, this formulation was chosen for in vivo delivery based on its colloidal properties and in vitro transfection activity.

Nanoparticle-formulated modified mRNA is superior to pDNA for gene therapy In order to compare the transfection efficiency between modified mRNA or pDNA delivered by LPR (or LPD), we investigated the cellular uptake of LPR (or LPD) with Cy3-labeled mRNA or pDNA. The expression level was determined by quantifying the Molecular Therapy vol. 21 no. 2 feb. 2013

GFP expression mediated by mRNA or pDNA after delivery into H460 cells using the same formulation. The results showed that the uptake of the targeted LPR were highly efficient in vitro, regardless of the type of cargo encapsulated. Nevertheless, a significantly larger proportion of cells expressed GFP when they had been delivered mRNA than when delivered pDNA (86 and 12%, respectively) (Figure 2a,b). When individual cell expression of GFP was evaluated by flow cytometry, the mean fluorescence intensity of LPD-transfected cells was three times higher than that of LPR-transfected cells (Figure 2c).

AA-modified LPR facilitates the internalization of nanoparticles into sigma receptor expressing cells We demonstrated that the LPR was internalized through sigma receptors by performing an inhibition assay. The assay was performed by pretreating the cells with haloperidol (a sigma-1 receptor ligand) to saturate the receptors before administration of the LPR. The results indicated that the percent of transfected cells was reversely proportional to the concentration of the competing ligand in the media (Figure 2d,e), reaching 7% of the control 361



b

LPR (HSV-tk) LPD (HSV-tk) LPR (con + GCV + GCV + GCV

GCV

Untreated

5

10 4

10 3

10 0

Propidium iodide (FL2)-A 5

−572

5

10 4

10 3

10 2

−113 0 10

10

−110

−87

0 10

2

3

10 10 FITC-A

4

10

5

0 10

2

3

10 FITC-A

10

4

5

10

72 hours

3

10

4

10

5

1-LPR(tk ) + GCV 72 hours

10

4

10

5

1-LPR(tk) + GCV 48 hours 48 hours

Propidium iodide (FL2)-A

0

4

24 hours

−820 0

20

3

10 10 FITC-A

10

40

0 10

3

60

2

−110

10

%Survival

80

0

Propidium iodide

100

1-LPR(tk) + GCV 24 hours

Untreated

−750

120


1-Untreated


a

−91

0 10

2

3

10 FITC-A

10

4

5

10

Annexin V

c

d

3,000 Untreated Targeted LPD (HSV-tk) + GCV Targeted LPR (HSV-tk) + GCV Untargeted LPR (HSV-tk) + GCV Targeted LPR (control) + GCV

Tumor volume (mm3)

120 100

%Survival

80 60

2,000

1,000

40 20 0

e

0 LPR (HSV-tk) + GCV

LPR (con) + GCV

Untreated

5

10

15

20

Day

f

3,000

Tumor volume (mm3)

0

2,000

1,000

0

) ) ) ) -tk -tk -tk on (c CV SV CV SV CV SV CV R H H H G G G G ( + ( + ( + LP + R R D ed LP LP LP et d d d g e e e r et et et Ta rg rg rg ta Ta Ta Un

ed

at

re nt

U

Figure 4 Systemic delivery of modified mRNA encoding HSV-tk in the LPR coupled with GCV for cancer gene therapy. (a) MTS cell proliferation assay used to determine the killing efficiency of LPR (HSV-tk)/GCV in vitro. The data were reported as mean ± SD. (b) Flow cytometry analysis of H460 cells treated with LPR (HSV-tk)/GCV followed by PI/annexin V staining. Cells were transfected with LPR (HSV-tk) nanoparticles in combination with GCV. Timeline of cell apoptosis was determined by PI/annexin-V double staining followed by flow cytometry analysis. (c) Proliferation capacity for the survival cells after HSV-tk/GCV therapy determined by clonogenic assay. The number was normalized against untreated group. The data were reported as mean ± SD. (d) Tumor growth inhibition study on H460 tumor xenograft. Tumor size was monitored every 3 days during the drug treatment. Tumor volumes were calculated as ½ × length × width × height. The data were reported as mean ± SEM (n = 4–6). (e) Tumor volumes from animals at end point of the experiment. Each symbol represents an individual mouse. Horizontal lines indicate mean values. (f) TUNEL assay showing the apoptosis degree of tumors harvested from end point of the tumor growth inhibition experiment. Con, control; GCV, ganciclovir; HSV-tk, herpes simplex virus-thymidine kinase; LPR, lipid/protamine/mRNA; mRNA, messenger RNA; PI, propidium iodide; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

362

www.moleculartherapy.org vol. 21 no. 2 feb. 2013



for the group treated with 50 µmol/l haloperidol. However, no significant difference between the gene expression levels of the transfected cells was observed. In addition, LPR without AA showed a significantly compromised transfection capacity, likely due to the lack of entry to the cells through receptor-mediated endocytosis. To compare the translatability of modified mRNA with that of regular mRNA and pDNA, an LPR loaded with 0.5 μg IVTmodified mRNA or pDNA encoding firefly luciferase was used to transfect H460 cells. Luciferase is a short-lived enzyme with an half-life of about 3 hours,19 making it advantageous for monitoring the real-time transgene expression profile. Results revealed that LPR-treated cells had a rapid luciferase expression (1,513 pg/mg) 4 hours post-transfection and reached peak expression 18 hours post-transfection (3,495 pg/mg). However, pDNA-mediated expression did not reach a comparable level until 18 hours posttransfection (1,686 pg/mg) (Figure 2f). Both of the expression levels from mRNA and pDNA started to decline 48 hours posttransfection. Toxicity is also a critical parameter used to evaluate a therapeutic agent for clinical use. By incubating H460 cells with different concentrations of LPR and performing an 3-(4,5-Dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, we demonstrated that the LPR induced minimal in vitro cytotoxicity at a concentration of up to 5 µg/ml mRNA (Figure 2g). As little as 100 ng of modified mRNA was able to transfect up to 66% of cells seeded in a 96-well plate. The especially high efficacy and low toxicity shown in these studies suggest an excellent therapeutic index for in vivo studies.

could induce hepatic toxicity.20 Therefore, it was necessary to check the liver and kidney damage after the systemic administration of nanoparticles. CD-1 mice were intravenously injected with the regular dose of LPR for tumor delivery (equivalent to 10 µg modified mRNA in each injection) for three consecutive days. The serum alanine transaminase and aspartate transaminase levels were assayed as markers for liver infraction. The blood urea nitrogen level, a kidney damage indicator, was also assayed. The data demonstrated that, in nanoparticle-treated mice, all three parameters fell within the normal range (Supplementary Figure S1f). This result, coupled with the hematoxylin and eosin stains of major organs (Supplementary Figure S1e), indicated that minimal, if any, toxicity had been caused to the liver, kidney, and other organs by the LPR after repeated systemic administration. To evaluate if IVT mRNA synthesized with modified nucleotides was useful in reducing inflammatory response induced specifically by single-stranded RNA, sera were collected from CD-1 mice 4 hours post-injection. The cytokine levels were evaluated by ELISA assay (Figure 3e). The results demonstrated that LPR formulation loaded with the modified mRNA induced negligible levels of tumor necrosis factor-α and interleukin (IL)-6; the level of IL-12 was close to that of the untreated mice. The only elevated cytokine was interferon (INF)-α (~490 pg/ml). In contrast, LPR loaded with unmodified mRNA induced relatively high level of IL-6 (~1,495 pg/ml), IFN-α (~1,953 pg/ml), and IL-12 (~1,950 pg/ ml). The pDNA-loaded LPD induced high levels of IFN-α (~5,109 pg/ml) and IL-12 (~5,653 pg/ml), although IL-6 elevation was not observed.

LPR accumulates in the tumor and results in model gene expression after systemic administration The in vivo biological activity of LPR was assessed in H460 xenograft-bearing nude mice. A significant amount of particle accumulation, represented by Texas-red fluorescent dye, was observed in the tumor 4 hours post-injection. However, there was a relatively small portion of nanoparticles that were nonspecifically taken up by the liver, lung, and kidneys (Figure 3a). To evaluate the transfection capacity of the LPR in vivo, mRNA for mcherry red fluorescent protein (RFP) was encapsulated into the LPR. RFP was selected for imaging purpose due to the low background autofluorescence signal compared with that of the commonly used enhanced GFP. The results showed a strong fluorescence signal in the tumor, while all the major organs only displayed background level fluorescence intensity compared with the phosphate-buffered saline (PBS)treated control group (Figure 3b). The expression of RFP was also confirmed by confocal microscopic observation of cryosections from RFP-expressing tumor tissue (Figure 3c). A quantitative luciferase activity assay was conducted after systemic administration of LPR loaded with luciferase mRNA (Figure 3d). Tumor-targeted delivery of luciferase mRNA produced luciferase activity in tumors (25 pg/mg) that was higher than in other tissues (0–2 pg/mg).

LPR delivers modified mRNA encoding HSV1-tk to xenograft in nude mice and induces apoptosis and inhibits the tumor growth HSV1-tk/ganciclovir (GCV), one of the most widely used suicide gene/prodrug systems in cancer gene therapy, was used as a model therapeutic gene to test our delivery system. The in vitro cell-killing efficiency of LPR loaded with HSV1-tk mRNA combined with GCV was evaluated using an MTT assay. The higher percent of transfected cells mediated by modified mRNA led to a significant killing rate (73%). In contrast, the expression of tk driven by the cytomegalovirus promoter mediated by pDNA achieved only 23% cell death (Figure 4a). No significant cytotoxicity was observed in cells treated only with GCV. The timeline of cell death after treatment with LPR (HSV-tk)/GCV was investigated with annexin-V and propidium iodide staining followed by flow cytometry analysis. The data revealed that the treatment induced early apoptosis of 70% of H460 cells within 24 hours of transfection and that the cells reached the late apoptosis stage within 48 hours (Figure 4b). In a clonogenic assay, which was used to determine the proliferation capacity of the surviving cells after treatment, barely 1% of the cells recovered and formed colonies (Figure 4c). A H460 xenograft animal model was also utilized to test the antitumor efficacy of LPR (HSV-tk)/GCV in vivo. In this study, treatment with LPR (HSV-tk)/GCV resulted in a significant inhibition of tumor growth compared with the untreated group (P = 0.0003) (Figure 4d). Furthermore, surface modification of the targeting ligand AA allowed for more efficient tumor growth inhibition (P = 0.008). As was consistent with the in vitro data, LPD

LPR induces lower cytokine level than LPD in CD-1 mice As was observed in the biodistribution study, the liver and kidneys were the two major organs that took up the LPR. It is reported that systemic administration of cationic lipid/nucleic acid complexes Molecular Therapy vol. 21 no. 2 feb. 2013

363


(HSV-tk) nanoparticles showed an inferior inhibition efficacy to LPR (HSV-tk) combined with GCV (P = 0.0006). To assess the amount of apoptosis caused by the treatment, a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed on harvested tumor tissue samples. A larger area of apoptosis was observed in tumors treated with LPR (HSV-tk)/ GCV, demonstrating that the nanoparticles loaded with modified mRNA were able to impact a larger population of the target cells (Figure 4f). We also tracked the weight of mice during the treatment. The results did not show any significant change in the weight of the animals, an indication of low systemic toxicity (Supplementary Figure S1g). The expression of HSV-tk was confirmed by western blot analysis using goat anti-tk polyclonal antibodies (Supplementary Figure S1h).

Discussion

The advent of mRNA synthesized with naturally occurring ribonucleotides opens a new window of opportunity for using modified mRNA as a novel therapeutic agent to treat cancer and other diseases. The incorporation of chemically modified nucleotides into mRNA has substantially reduced the innate antiviral immune response, leading to high translation efficiency and relieving concerns regarding the safety of the therapy. The main objective of our study was to demonstrate the feasibility of systemically delivering the modified mRNA to the tumor site for transgene expression with high efficiency using a lipidic nanodevice. With the formulation screened by physicochemical and biological tests, mRNA could be condensed into nanoparticles smaller than 100 nm in diameter, a size suitable to fit into a clathrincoated pit in order to be internalized through receptor-mediated endocytosis.21 The zeta potentials were moderate, an indication of a high degree of PEGylation. The hydrophilic PEG molecules were expected to screen the positive charge by DOTAP/cholesterol lipid bilayer, thereby preventing the attachment of serum protein and minimizing uptake of nanoparticles by the reticuloendothelial system. The colloidal stability of nanoparticles in the presence of serum, as well as the protection of mRNA from RNAse digestion, increased the likelihood of mRNA being delivered to the tumor with full integrity after a long circulation time. As a direct source of gene product, there is still a question whether modified mRNA is more efficacious (i.e., generating more therapeutic protein products) than pDNA. When electroporation is exploited to deliver exogenous mRNA into hematopoietic cells, mRNA electroporation has shown a higher and more sustainable expression than DNA electroporation.6 However, when a nonviral vector is introduced into the systemic delivery of modified mRNA, the intricacy of the nonviral vector per se leads to the uncertainties regarding gene transfer efficiency. Cationic liposomes are very efficient DNA-based transfection reagent. However, mRNA delivered by lipoplex is suggested to lead to a poor transfection efficiency compared with pDNA22 probably due to the higher-binding affinity between the cationic liposome and single-stranded RNA than pDNA which reduces the accessibility of RNA to intracellular translation machinery.23 Therefore the assumption that cytoplasmic delivery of mRNA results in a higher expression level than pDNA as a result of obviating the necessity for nuclear entry should not be easily made without the context.24 364


When we compared the in vitro expression levels of mRNA and pDNA delivered by LPR (or LPD), which were identically formulated in nanoparticles that displayed similar physicochemical properties. Although H460 cells took up comparable numbers of nanoparticles loaded with mRNA or pDNA, only about 10% of cells that took up LPD particles expressed GFP. In contrast, ca. 90% of cells that took up LPR expressed GFP. The high transfection efficiency mediated by mRNA suggested that the release of nucleic acids from the vector did not seem to be the rate-limiting step in that mRNA or pDNA was condensed by a low molecular weight polycation (protamine, 4 kDa).24 Since endosome escape facilitated by the cationic lipid DOTAP was the same for both nanoparticles,25 the large discrepancy in the percent of transfected cells probably resulted from the barriers to nuclear entry for pDNAmediated transfection.26 Other factors such as favorable transcription conditions or egression efficiency of RNA transcripts from the nucleus27 could account for lower pDNA-mediated transfection efficiency, as well. The translatability of mRNA and pDNA, on the other hand, was reflected by the average fluorescence intensity of transfected cells. pDNA exhibited a fluorescence intensity 2.5 times higher than that of mRNA. The observation could be explained by the fact that pDNA continues to generate copies of mRNA transcripts until the promoter is transcriptionally inactivated28 or the pDNA is lost during cell proliferation. Moreover, the rapid increase in expression caused by modified mRNA (4 hours post-transfection) and the delayed pDNA-based expression (18 hours post-transfection) suggested that pDNA expression was cell cycle dependent26 and mRNA was not24 because the doubling time for H460 cell is 23 hours.29 As was expected, delivery of modified mRNA resulted in a pattern of rapid, transient, and cell cycle-independent expression profiles. In addition to the cytoplasmic translation, low immune stimulation also makes modified mRNA advantageous for gene delivery. IVT mRNA has been intensively used in dendritic cell-based immunotherapy largely due to the fact that RNA transfection alone could cause dendritic maturation. It has been reported that singlestranded RNA could activate TLR7, a mechanism that the innate immune system exploits to detect an RNA virus infection.30 It is reported that the secondary structure of exogenous mRNA is likely to activate PKR, a global repressor of protein translation,31 resulting in a low transgene expression. In mammalian cells, RNA from various organelles are heavily and diversely modified,32 allowing the innate immune system to distinguish foreign RNA from selfRNA. To suppress the properties that cause immune stimulation, we substituted cytidine triphosphate and uridine triphosphate with naturally occurring 5-methylcytidine and pseudouridine (ψ) triphosphate, respectively, while synthesizing IVT RNA. Incorporation of the modified ribonucleotides renders a disguise for exogenous RNA, reducing the ability to activate TLR3, TLR7, TLR9, retinoic acid inducible gene I, and PKR.33 The results from the ELISA assays demonstrated that the chemically modified mRNA formulated in LPR reduced the innate immune response in the animals. The relatively low level of IFN-α was probably due to the presence of dsDNA or other impurities according to the work published by Karikó et al.33 It is reported that the presence of such impurities in the IVT mRNA would elevate tumor necrosis www.moleculartherapy.org vol. 21 no. 2 feb. 2013


factor-α and IFN-α levels and this particular immune-stimulating property could be eliminated by high-performance liquid chromatography purification of mRNA.33 This low immune stimulation property overcomes the obstacle to the clinical application of pDNA caused by unmethylated CpG motifs. Finally, the relatively low cellular toxicity and high efficacy opens a broad therapeutic window for the in vivo application of LPR. Solid tumor tissues are distinguished from normal tissues by its elevated level of vascular permeability and a lower lymphatic drainage.34 This tumor-specific property has been indicated as the major cause for the passive targeting (the enhanced permeability and retention effect) that causes the accumulation of macromolecules or nanoparticles after systemic administration of the nanoparticles. Although the in vitro data pinpointed that the presence of AA at the distal end of LPR creates selectivity and facilitates the internalization of nanoparticles into the targeted cells, it is still arguable that ligands have a major impact on the tumor accumulation of the administered nanoparticles.35 Because the sigma receptor is not only expressed in the tumor tissues but also in all major organs (data not shown), we can assume that the high accumulation of LPR in tumor sites was predominantly due to long-circulating properties and the enhanced permeability and retention effect. This result was consistent with the previous data acquired from the LPD system. Densely PEGylated lipidic nanoparticles exhibited higher passive targeting to tumors with leaky vessels because of their extended blood circulation half-life.36 After LPR penetrates into the tumor mass, the targeting ligand on the surface can then facilitate the internalization, resulting in the expression of the transgene. To demonstrate a proof of concept of the therapeutic efficacy of the LPR nanoparticle for cancer therapy, we delivered a suicide gene into a xenograft mouse model. This HSV-tk/GCV suicide gene therapy has been extensively studied in the clinical trials on prostate cancers, ovarian cancers, and brain cancers.37 In most of the clinical trials, viral vectors are more favorable because they can provide a sufficient gene expression level, despite the safety concerns arising from the use of viral vectors in gene therapy.38,39 The idea behind the therapy is that the expression of HSV-tk sensitizes transfected tumor cells to the exposure of prodrug GCV. Because of the transfer of GCV triphosphate via gap junctions or apoptosis bodies, both cells expressing the transgene and their neighboring cells will undergo apoptosis. This process has been termed the “bystander effect”.37 The bystander effect was observed in our in vitro experiments; only ca. 12% of H460 cells were transfected by LPD, but the results of the MTT assay indicated a killing efficiency of ca. 23%. However, as the transfection efficiency of the LPR-mediated delivery approached 70%, the marginal benefit acquired from the “bystander effect” reduced due to the shortage of untransfected cells in vitro. In vivo transfection does not seem to be mediated by the same limiting factor as in vitro delivery. The larger the amount of transfection was in vivo, the larger the cell population that was killed through the bystander effect. In the tumor inhibition study, there was a statistically significant (P = 0.0006) difference between LPDand LPR-treated tumor sizes, which was considered a reflection of the transfection efficiency. The incorporation of nucleotide analogs into dsDNA results in DNA chain breaks and mitochondrial damage that initiates HSV-tk/GCV-induced apoptosis.37 TUNEL analysis revealed a significantly larger population of cells undergoing Molecular Therapy vol. 21 no. 2 feb. 2013


apoptosis treated by LPR compared with LPD. However, the tk expression levels from homogenates of tumor tissue were not different based on a western blot analysis (Supplementary Figure S1h). Collectively, it could be deduced that larger populations of cells expressing moderate levels of enzymes were more efficacious than smaller populations of cells expressing high levels of enzymes in regards to this specific gene therapy. It should also be noted that, in the case of intraperitoneal administration, rapid expression of the transgene mediated by modified mRNA allowed an immediate action of a small molecule drug, GCV. The expression of tk increases before the GCV is eliminated via renal clearance, creating favorable conditions for converting the prodrug into the active form. This advantage could be utilized in combination therapies when gene therapy and chemotherapy are employed in tandem to kill cancer cells via different mechanisms of action. Any synergistic effects may reduce the possibility of cells developing drug resistance.

Conclusion In summary, we have demonstrated an LPR-mediated systemic delivery of modified mRNA into targeted tumor cells for transgene expression and therapeutic efficacy. Chemically modified mRNA seems to be a superior genetic information carrier to pDNA in terms of both efficacy and safety. This study demonstrates the applicability of modified mRNA in targeted gene therapy in vivo. Although relatively transient, expression mediated by modified mRNA was rapid and robust, free of concerns for chromosomal integration, and immune response. These features indicate great potential for future clinical trials. Apart from cancer gene therapy, the systemic delivery of modified mRNA may also be of great convenience and advantageous in the development of regenerative medicine for the treatment of diabetes, spinal cord injuries, myocardial infarction, and neurologic syndromes. Furthermore, LPR systems could potentially be equipped with different targeting ligands to be able to deliver genes to various cell types for diverse therapeutic purposes.

Materials and Methods

Materials. DOTAP and DSPE-N-(methoxy (polyethyleneglycol)-2000) ammonium salt (DSPE-PEG2000) were purchased from Avanti Polar Lipids (Alabaster, AL). Cholesterol and protamine sulfate (fraction × from salmon) was purchased Sigma-Aldrich (St Louis, MO). All the other chemicals were purchased from Sigma-Aldrich unless otherwise mentioned. DSPE-PEG-AA was synthesized according to the previously established protocol.40 Preparation of modified mRNA. Modified mRNA was prepared with

a T7 polymerase-based IVT kit (Ambion, Austin, TX) according to the manufacturer’s manual. The open-reading frame of the gene of interest was cloned into a pcDNA3.1 vector under the regulation of T7 promoter. The untranslated region and gene of interest was amplified by PCR reaction with 5′ primer CTAGAGAACCCACTGCTTACTGGCTTATCG and 3′ primer T120GCGTCGACACTAGTTCTAGACCCT. The amplicons were used as templates for IVT. The RNA was synthesized with MEGAscript T7 kit (Ambion, Austin, TX) with 1.6 μg template and 7.5 mmol/l adenosine triphosphate, 1.5 mmol/l guanosine triphosphate, 6 mmol/l 3′-0-Me-m7G(5′)ppp(5′)G (anti-reverse cap analog), 7.5 mmol/l 5-methylcytidine triphosphate, and 7.5 mmol/l pseudouridine triphosphate (TriLink Biotechnologies, San Diego,CA). Reactions were incubated at 37 °C for 4 hours. mRNA was purified by using the Ambion MEGAclear kit (Ambion). Although the incorporation of antireverse cap analog

365


drastically reduced the yield to ca. 60 μg per 40 μl reaction, the blocking of 3′ hydroxyl of methylated G makes 3′ hydroxyl of unmethylated G available for initiation, which guarantees the biological activity of capped mRNA transcripts. Vectors carrying enhanced GFP (Addgene 26822) and mcherry RFP (Addgene 26823) gene were purchased from Addgene (Cambridge, MA). Open-reading frame of HSV-tk was purchased from Invivogen (San Diego, CA). Preparation of liposome and LPR. DOTAP and cholesterol (1:1, mol/mol) were dissolved in chloroform and solvent was removed under reduced pressure. The lipid film is hydrated overnight with distilled water to make the final concentration 10 mmol/l DOTAP and cholesterol. The liposome was sequentially extruded through 400, 200, 100, and 50 nm polycarbonate membranes (Millipore, Billerica, MA) in order to form 80–100 nm unilamellar liposomes. LPR core was formed by mixing 146 μl of solution A (10 μg mRNA) and 146 μl of solution B (3 μl of 2 mg/ml protamine, 12 μl of 10 mmol/l DOTAP/cholesterol liposome, and 131 μl distilled water). The mix solution was incubated at room temperature for 10 minutes. PEGylation was performed by adding 4 μl DSPE-PEG (10 mg/ml) and 4 μl DSPE-PEG-AA (10 mg/ml) to the LPR core and incubating the mix at 50 °C for 15 minutes. The size and surface charge of the nanoparticles were determined by Malvern ZS90 (Malvern, Worcestershire, UK). In vitro transfection and uptake study. Ninety-six well plates were

seeded with 104 cells per well. Particle equivalent to 0.5 μg of modified mRNA encoding enhanced GFP was added to each well in the presence of OptiMEM medium and kept in the incubator. The medium was replaced with full medium 4 hours post-transfection. The transfection efficiency was determined with FACSCanto (BD Biosciences, San Jose, CA). For the uptake study, a 10% FAM-labeled oligonucleotides (IDT, Coralville, IA) mixture was combined with mRNA as a fluorescent marker, the percent of uptake was determined 2 hours post-transfection by FACSCanto. Cells transfected with modified mRNA or pDNA encoding luciferase were subjected to luciferase assay (Promega, Madison, MI) according to manufacturer’s instruction at different timepoints. Cells transfected with mRNA encoding HSV-tk were subjected to MTT cell proliferation assay 2 days post-transfection; 20 μl of 12 mmol/l MTT solution was added to each well in fresh phenol-red free full media. The reaction was stopped by removing media after 2 hours incubation at 37 °C incubator. The formazan was solubilized by adding 200 μl dimethyl sulfoxide and shaken at room temperature for 30 minutes. The absorbance was read at 570 nm to determine the cytotoxicity. In vivo transfection study. Nanoparticles equivalent to 10 μg of mRNA

prepared as aforementioned were injected intravenously into the subcutaneous tumor-bearing nude mice. Twenty percent Texas-red labeled oligonucleotide (IDT) was mixed with mRNA as a fluorescent marker for the nanoparticles biodistribution study. Four hours post-injection, animals were killed to collect organs (heart, liver, spleen, lung, kidneys, tumor). Organs were imaged with Kodak in vivo imaging system FX Pro (Kodak, Rochester, NY). To study transfection in vivo, nanoparticles equivalent to 10 μg of mRNA encoding mcherry RFP were intravenously administered to subcutaneous tumor-bearing nude mice. Mice were killed 24 hours post-injection and the organs were collected to image RFP expression. In the case of luciferase, nanoparticles equivalent to 20 μg of mRNA encoding luciferase were intravenously administered to nude mice bearing subcutaneous tumors. Mice were killed 24 hours post-injection. Organs and tumor tissues were homogenized and the tissue lysates were subject to luciferase assay(Promega) according to manufacturer’s instruction. A standard curve was plotted by using luciferase standard in the H460 tumor or tissue lysates without luciferase. All the relative luminescence units were converted to amount of luciferase enzyme according to the standard curve. All animal protocols were approved by the University of North Carolina at Chapel Hill’s Institutional Animal Care and Use Committee.

366


Aspartate transaminase, alanine transaminase, blood urea nitrogen assay and cytokine induction assay. CD-1 mice were intravenously

injected with LPR (equivalent to 10 μg) for three consecutive days. On day 4, mice were killed and sera were collected for aspartate transaminase, alanine transaminase, and blood urea nitrogen assay performed by UNC facility. Organs were collected and fixed with 4% paraformaldehyde in PBS overnight before stained with hematoxylin and eosin by University of North Carolina histology facility. For the cytokine induction assay, 4 hours post-injection of LPR (equivalent to 10 μg), CD-1 mice were killed and sera were collected for IL-6, IL-12, IFN-α, and TNF-α level with ELISA assay kit (BD Biosciences, San Diego, CA) according to manufacturer’s manual.

Clonogenic assay. Nanoparticle equivalent to 0.5 μg of HSV-tk mRNA

or control mRNA was administered to 104 H460 cells seeded in 96-well plate. Four hours post-transfection, medium was refreshed with RPMI1640 supplemented with 50 μmol/l of GCV. Forty-eight hours post-transfection, cells were trypsinized and live cells were harvested and counted in the presence of trypan blue (Sigma-Aldrich). Two hundred live cells from each treatment were plated in a 6-well plate. One week later, medium was removed and cells were washed with Dulbecco’s PBS for two times before stained with 0.25% crystal violet blue in 50% ethanol. Tumor inhibition assay. Athymic nude mice of 6–8 weeks old were inoculated with 5 × 106 H460 cells on the hind legs. Nanoparticles equivalent to 10 μg of mRNA or pDNA was prepared as aforementioned were injected intravenously every other day for five treatments since the tumor volume reached 50 mm3. Meanwhile, mice received 25 mg/kg GCV twice a day for 10 days of treatment. Tumor size was measured with digital caliper (Thermo Fisher Scientific, Pittsburgh, PA) and animal weight was monitored every 3 days. Tumor volume was calculated as (½ × length × width × height). TUNEL assay. Tumor tissue was harvested at the end point of tumor inhibition study and was fixed with 4% paraformaldehyde before embedded in paraffin. After deparaffinization, section was stained with DeadEnd Fluoremetric TUNEL Assay kit (Promega) according to the manufacturer’s manual. The image was acquired through Nikon epifluorescence microscope (Nikon Instruments, Melville, NY). Western blot analysis. Five milligram of tumor was homogenized in 300 μl

of RIPA buffer (150 mmol/l NaCl, 1.0% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mmol/l Tris, pH 8.0). The sample was spun down at top speed with a tabletop centrifuge for 10 minutes. Supernatant was quantified with bovine serum albumin assay (Pierce Biotech, Rockford, IL) and 50 μg of protein was loaded on a NuPAGE Novex Bis-Tris 4–12% gel (Invitrogen, Grand Island, NY) and transferred to a polyvinylidene fluoride membrane. The membrane was blocked with PBS-Tween with 5% skim milk for 1 hour followed by overnight incubation with primary antibodies such as mouse anti HSV1-tk (vL-20) antibody (1:200 dilution; Santa Cruz Biotechnology, Santa Cruz, CA) and mouse anti β-actin (C-4) (1:1,000 dilution; Santa Cruz Biotechnology). After wash with PBS-Tween, secondary antibody goat-mouse IgG2a-HRP (1:1,000; Santa Cruz Biotechnology) was applied to the membrane for 1 hour. The protein was detected with Supersignal chemiluminescence substrate (Pierce Biotech).

Statistical analysis. Percentages of GFP-positive cells and mean fluorescence intensities were calculated by BD CellQuest (BD Biosciences) software. Statistical analysis will be undertaken using Prism 5.0c Software (GraphPad Software, La Jolla, CA). A two tailed t-test or an one-way analysis of variance was performed when comparing two groups or more than two groups, respectively. Statistical significance was defined by a value of P < 0.05.

SUPPLEMENTARY MATERIAL Figure S1. Optimization of the formulation and evaluations of systemic toxicity of the LPR.

www.moleculartherapy.org vol. 21 no. 2 feb. 2013


ACKNOWLEDGMENTS The work was supported by National Institutes of Health grants CA129835, CA149363, CA125273, CA151652, CA125273-03S1 and the financial support from Kaohsiung Veterans General Hospital (to H.-h. S.). Yang Yang was on leave from the State Key Laboratory of Biotherapy, West China Hospital, Sichuan University, Sichuan, the People’s Republic of China. Andrew Satterlee and Kelly Racette are acknowledged for their help in preparing the manuscript. The authors declared no conflict of interest.

REFERENCES

1. Van Tendeloo, VF, Ponsaerts, P and Berneman, ZN (2007). mRNA-based gene transfer as a tool for gene and cell therapy. Curr Opin Mol Ther 9: 423–431. 2. Steinman, RM and Hemmi, H (2006). Dendritic cells: translating innate to adaptive immunity. Curr Top Microbiol Immunol 311: 17–58. 3. Ponsaerts, P, van Tendeloo, VF, Jorens, PG, Berneman, ZN and van Bockstaele, DR (2004). Current challenges in human embryonic stem cell research: directed differentiation and transplantation tolerance. J Biol Regul Homeost Agents 18: 347–351. 4. Warren, L, Manos, PD, Ahfeldt, T, Loh, YH, Li, H, Lau, F et al. (2010). Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7: 618–630. 5. Van Driessche, A, Ponsaerts, P, Van Bockstaele, DR, Van Tendeloo, VF and Berneman, ZN (2005). Messenger RNA electroporation: an efficient tool in immunotherapy and stem cell research. Folia Histochem Cytobiol 43: 213–216. 6. Ponsaerts, P, Van Tendeloo, VF and Berneman, ZN (2003). Cancer immunotherapy using RNA-loaded dendritic cells. Clin Exp Immunol 134: 378–384. 7. Kormann, MS, Hasenpusch, G, Aneja, MK, Nica, G, Flemmer, AW, Herber-Jonat, S et al. (2011). Expression of therapeutic proteins after delivery of chemically modified mRNA in mice. Nat Biotechnol 29: 154–157. 8. Karikó, K, Buckstein, M, Ni, H and Weissman, D (2005). Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23: 165–175. 9. Li, SD, Chen, YC, Hackett, MJ and Huang, L (2008). Tumor-targeted delivery of siRNA by self-assembled nanoparticles. Mol Ther 16: 163–169. 10. Guo, ST and Huang, L (2011). Nanoparticles escaping RES and endosome: challenges for siRNA delivery for cancer therapy. J Nanomater (epub ahead of print). 11. Chono, S, Li, SD, Conwell, CC and Huang, L (2008). An efficient and low immunostimulatory nanoparticle formulation for systemic siRNA delivery to the tumor. J Control Release 131: 64–69. 12. Li, SD, Chono, S and Huang, L (2008). Efficient gene silencing in metastatic tumor by siRNA formulated in surface-modified nanoparticles. J Control Release 126: 77–84. 13. Li, SD and Huang, L (2006). Surface-modified LPD nanoparticles for tumor targeting. Ann N Y Acad Sci 1082: 1–8. 14. Chen, Y, Sen, J, Bathula, SR, Yang, Q, Fittipaldi, R and Huang, L (2009). Novel cationic lipid that delivers siRNA and enhances therapeutic effect in lung cancer cells. Mol Pharm 6: 696–705. 15. Wong, C, Stylianopoulos, T, Cui, J, Martin, J, Chauhan, VP, Jiang, W et al. (2011). Multistage nanoparticle delivery system for deep penetration into tumor tissue. Proc Natl Acad Sci USA 108: 2426–2431. 16. Popovic, Z, Liu, W, Chauhan, VP, Lee, J, Wong, C, Greytak, AB et al. (2010). A nanoparticle size series for in vivo fluorescence imaging. Angew Chem Int Ed Engl 49: 8649–8652. 17. Cabral, H, Matsumoto, Y, Mizuno, K, Chen, Q, Murakami, M, Kimura, M et al. (2011). Accumulation of sub-100 nm polymeric micelles in poorly permeable tumours depends on size. Nat Nanotechnol 6: 815–823.

Molecular Therapy vol. 21 no. 2 feb. 2013


18. Lee, H, Fonge, H, Hoang, B, Reilly, RM and Allen, C (2010). The effects of particle size and molecular targeting on the intratumoral and subcellular distribution of polymeric nanoparticles. Mol Pharm 7: 1195–1208. 19. Corish, P and Tyler-Smith, C (1999). Attenuation of green fluorescent protein half-life in mammalian cells. Protein Eng 12: 1035–1040. 20. Tousignant, JD, Zhao, H, Yew, NS, Cheng, SH, Eastman, SJ and Scheule, RK (2003). DNA sequences in cationic lipid:pDNA-mediated systemic toxicities. Hum Gene Ther 14: 203–214. 21. Rejman, J, Oberle, V, Zuhorn, IS and Hoekstra, D (2004). Size-dependent internalization of particles via the pathways of clathrin- and caveolae-mediated endocytosis. Biochem J 377(Pt 1): 159–169. 22. Yamamoto, A, Kormann, M, Rosenecker, J and Rudolph, C (2009). Current prospects for mRNA gene delivery. Eur J Pharm Biopharm 71: 484–489. 23. El Ouahabi, A, Pector, V, Fuks, R, Vandenbranden, M and Ruysschaert, JM (1996). Double long-chain amidine liposome-mediated self replicating RNA transfection. FEBS Lett 380: 108–112. 24. Bettinger, T, Carlisle, RC, Read, ML, Ogris, M and Seymour, LW (2001). Peptidemediated RNA delivery: a novel approach for enhanced transfection of primary and post-mitotic cells. Nucleic Acids Res 29: 3882–3891. 25. Tseng, YC, Mozumdar, S and Huang, L (2009). Lipid-based systemic delivery of siRNA. Adv Drug Deliv Rev 61: 721–731. 26. Lam, AP and Dean, DA (2010). Progress and prospects: nuclear import of nonviral vectors. Gene Ther 17: 439–447. 27. Eckner, R, Ellmeier, W and Birnstiel, ML (1991). Mature mRNA 3’ end formation stimulates RNA export from the nucleus. EMBO J 10: 3513–3522. 28. Löser, P, Jennings, GS, Strauss, M and Sandig, V (1998). Reactivation of the previously silenced cytomegalovirus major immediate-early promoter in the mouse liver: involvement of NFkappaB. J Virol 72: 180–190. 29. Banks-Schlegel, SP, Gazdar, AF and Harris, CC (1985). Intermediate filament and crosslinked envelope expression in human lung tumor cell lines. Cancer Res 45: 1187–1197. 30. Diebold, SS, Kaisho, T, Hemmi, H, Akira, S and Reis e Sousa, C (2004). Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303: 1529–1531. 31. Nallagatla, SR, Toroney, R and Bevilacqua, PC (2008). A brilliant disguise for self RNA: 5’-end and internal modifications of primary transcripts suppress elements of innate immunity. RNA Biol 5: 140–144. 32. Cantara, WA, Crain, PF, Rozenski, J, McCloskey, JA, Harris, KA, Zhang, X et al. (2011). The RNA Modification Database, RNAMDB: 2011 update. Nucleic Acids Res 39(Database issue): D195–D201. 33. Karikó, K, Muramatsu, H, Ludwig, J and Weissman, D (2011). Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA. Nucleic Acids Res 39: e142. 34. Maeda, H, Wu, J, Sawa, T, Matsumura, Y and Hori, K (2000). Tumor vascular permeability and the EPR effect in macromolecular therapeutics: a review. J Control Release 65: 271–284. 35. Kirpotin, DB, Drummond, DC, Shao, Y, Shalaby, MR, Hong, K, Nielsen, UB et al. (2006). Antibody targeting of long-circulating lipidic nanoparticles does not increase tumor localization but does increase internalization in animal models. Cancer Res 66: 6732–6740. 36. Li, SD and Huang, L (2010). Stealth nanoparticles: high density but sheddable PEG is a key for tumor targeting. J Control Release 145: 178–181. 37. Tomicic, MT, Thust, R and Kaina, B (2002). Ganciclovir-induced apoptosis in HSV-1 thymidine kinase expressing cells: critical role of DNA breaks, Bcl-2 decline and caspase-9 activation. Oncogene 21: 2141–2153. 38. Bostanci, A (2002). Gene therapy. Blood test flags agent in death of Penn subject. Science 295: 604–605. 39. Hacein-Bey-Abina, S, von Kalle, C, Schmidt, M, Le Deist, F, Wulffraat, N, McIntyre, E et al. (2003). A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 348: 255–256. 40. Banerjee, R, Tyagi, P, Li, S and Huang, L (2004). Anisamide-targeted stealth liposomes: a potent carrier for targeting doxorubicin to human prostate cancer cells. Int J Cancer 112: 693–700.

367