Systemic Pseudohypoaldosteronism from Deletion of the Promoter Region of the Human Epithelial Na Channel Subunit Christie P. Thomas,* Jackie Zhou,* Kang Z. Liu, Verity E. Mick, Eithne MacLaughlin, and Michael Knowles Departments of Internal Medicine, University of Iowa, Iowa City, Iowa; University of North Carolina at Chapel Hill, Chapel Hill, North Carolina; and Department of Pediatrics, Children’s Hospital and University of Southern California, Los Angeles, California Systemic pseudohypoaldosteronism type I (PHAI) is an autosomal recessive disorder that arises from loss of function mutations of the , , or subunit of Epithelial Na Channel (ENaC). In addition to a severe renal phenotype in the neonatal period, patients with PHAI develop a childhood pulmonary syndrome characterized by cough and frequent respiratory infections. We tested a patient, born to consanguineous parents, who presented with dehydration, metabolic acidosis, hyperkalemia, elevated renin and aldosterone levels at birth, and recurrent respiratory symptoms in his first year. He demonstrated defective epithelial Na transport in multiple organs (raised sweat Cl, 120 mM; raised salivary Na and Cl, 118 and 111 mM, respectively; and little nasal amiloride-sensitive potential difference). No deleterious mutation was identified in the coding region of the three ENaC subunits. Reverse transcriptase-polymerase chain reaction of nasal epithelial RNA showed reduced ENaC expression, and inability to amplify promoter elements indicated the possibility of a deletion in the 5 region. Using a probe that corresponded to exon 1A of ENaC, we confirmed a large deletion ( 1,300 bp). In summary, a homozygous mutation in the promoter region of ENaC leads to PHAI, the first description of a mutation in the regulatory regions of an ENaC subunit leading to a clinical phenotype.
Pseudohypoaldosteronism type 1 (PHAI) is a rare life-threatening disease that presents in the first few days of life with salt wasting, hyperkalemia, and acidosis. Characteristically these patients have elevated renin and aldosterone values but are unable to maintain blood pressure, which led to the hypothesis of end-organ resistance to the action of aldosterone in these patients (1, 2). In target tissues, including the renal collecting duct, the distal colon, salivary gland, and sweat ducts, aldosterone binds to the mineralocorticoid receptor (MR) and activates a series of transcriptional events that leads to a significant and sustained stimulation of Na transport (3–5). The molecular identity of the Na transport pathway in these epithelia has now been determined to be the heteromultimeric amiloride-sensitive epithelial Na channel (ENaC) composed of , , and subunits (6–8). In addition to aldosterone-sensitive sites, ENaC is also expressed throughout the airway epithelia from the nose to the terminal bronchioles, as well as in alveolar type II cells (9–12). The more severe form of PHAI includes a respiratory phenotype and is inherited as an autosomal recessive disorder, whereas the milder form is inherited in an autosomal (Received in original form February 27, 2002 and in revised form March 21, 2002) *The first two authors contributed equally to the work presented in this article. Address correspondence to: Christie P. Thomas, Department of Internal Medicine, University of Iowa College of Medicine, 200 Hawkins Drive, Iowa City, IA 52242-1081. E-mail:
[email protected] Abbreviations: cystic fibrosis transmembrane regulator, CFTR; epithelial Na channel, ENaC; mineralocorticoid receptor, MR; pseudohypoaldosteronism type 1, PHAI; reverse transcriptase–polymerase chain reaction, RT-PCR. Am. J. Respir. Cell Mol. Biol. Vol. 27, pp. 314–319, 2002 DOI: 10.1165/rcmb.2002-0029OC Internet address: www.atsjournals.org
dominant fashion wherein symptoms appear to be limited to the kidney (13, 14). Recently, inactivating homozygous or compound heterozygous mutations in -, -, or ENaC subunits have been identified in patients with systemic PHAI (15–18). Consistent with loss of function of the epithelial Na channel, these patients have elevated sweat and salivary Na and Cl and absent nasal amiloride-sensitive Na transport. The dominantly inherited form of PHAI appears to arise in some patients from a mutation in MR, and as predicted from its tissue distribution, these patients have normal airway Na transport and no pulmonary phenotype (19). In this article we report a patient with the classic systemic phenotype of PHAI as a result of a homozygous deletion of the upstream regulatory region of ENaC leading to near-total absence of ENaC expression.
Materials and Methods Case Presentation J.L. (PHA 44) was the product of a normal full-term labor and delivery, and weighed 7 1/2 pounds at birth. He had no respiratory distress at birth but presented with marked dehydration, metabolic acidosis, hyponatremia (Na 127), and severe hyperkalemia (K 10.2) at 4 d of age. He had no evidence of respiratory disease at that juncture and had a normal chest X-ray. His initial serum aldosterone and plasma renin activity were markedly elevated (1,281 ng/dl and 235.5 ng/ml/h, respectively). After fluid resuscitation, he was treated with supplemental NaCl, NaHCO3, and sodium polystyrene sulfonate. The onset of respiratory symptoms was at 1 mo with persistent clear rhinorrhea, and by 3 mo he began to have recurrent ear and sinus infections. At 8 mo of age he started to have recurrent episodes of cough and tachypnea. The chest roentgenogram with these episodes showed peribronchial thickening, atelectasis, and/or small, fluffy infiltrates. On some occasions accompanying fever was noted, and systemic antimicrobial therapy was administered for presumptive respiratory tract infections, although no pathogenic bacteria were ever demonstrated by blood culture. During these illnesses, he also had modest increases in his AA gradient, with pO2s in the mid-70s, but normal pCO 2. He demonstrated an elevated sweat Cl (120 mM), and salivary Na (118 mM) and Cl (111 mM). During his first 3 yr of life, he was repeatedly hospitalized for these respiratory illnesses (at least 30 d of hospitalization per year), but during intervening periods his lung function was normal, with an FEV1 at 86% predicted at age 5. Over time, the frequency and severity of these respiratory illnesses tended to wane, and after the age of 6, his pulmonary status stabilized, and he developed respiratory illnesses only when associated with an apparent viral infection. By age 7, his only pulmonary symptom was a mild, exercise-induced dry cough. He was treated intermittently with an inhaled -agonist. At that time, his chest roentgenogram showed very mild peribronchial changes, predominantly in the right upper lobe, with no evidence of chronic pulmonary infiltrates or hyperinflation.
Thomas, Zhou, Liu, et al.: ENaC Promoter Deletion in PHAI
Polymerase Chain Reaction Amplification of -, -, and ENaC DNA Each coding exon of the -, -, and ENaC genes was amplified by polymerase chain reaction (PCR) using primers as described, with a few modifications (18). PCR products were sequenced using BigDye Terminator Cycle Sequencing Kit and ABI PRISM 377 Genetic Analyzer (Perkin-Elmer, Applied Biosystem, Foster City, CA). The 5 flanking region and 5 UTR of -, -, and ENaC subunits were amplified using primers corresponding to these regions (Table 1) and the products analyzed by agarose gel electrophoresis and in some instances by sequencing, as indicated above (20–23).
315
1 l of [-32P] dCTP (3,000 Ci/mmol; ICN Biomedicals, Costa Mesa, CA), 2 l of forward, and 2 l of reverse CFTR primers (10 pmol/ l each; Table 2) were added to the PCR mixture. The cDNA fragments in a final volume of 50 ml were amplified for 20 and 24 cycles using the conditions described above. Twenty microliters of the PCR products were separated on a 6% acrylamide gel containing 1 TBE and 4% glycerol. Electrophoresis was performed at room temperature at 300 V for 2 h. The gel was vacuum dried and exposed to X-ray film at 70 C, and the 32 P labeled DNA fragments on the dried gel were quantified using a PhosporImager (Molecular Dynamics, Sunnyvale, CA).
Southern Blotting
Nasal Scrape Biopsy and RNA Isolation Nasal scrape biopsy was performed by gently scraping the inferior turbinates with a rhinoprobe (Arlington Scientific Inc., Arlington, TX). Approximately 5 105 nasal epithelial cells were obtained from both patients and control subjects. Immediately after scraping, the cells were washed in F12 medium and then lysed in 1 ml of TRIzol reagent (Life Technologies, Gaithersburg, MD). Total RNA was isolated following the manufacturer’s instructions. The final RNA pellet was dissolved in 50 l of RNase-free water.
Reverse Transcription-PCR First-strand cDNA was synthesized with oligo(dT) 12–18 and SuperScript II RNase H Reverse Transcriptase (RT) (Life Technologies) following the manufacturer’s instructions. Three to five microliters of the total RNA ( 1 g) from each sample was used in a 20- l RT reaction that was performed at 42 C for 1 h. This first-strand cDNA served as a template for subsequent PCR analysis. The entire coding region of each of the three ENaC subunits (, , and ) was amplified by PCR in separate tubes. A 50- l PCR mixture contained 5 l of 10 buffer (200 mM Tris-HCl, 500 mM KCl, pH 8.4; Life Technologies), 2 l of 50 mM MgCl2, 0.25 l of 5 / l Taq DNA polymerase (Life Technologies), 1 l of dNTP mix (2.5 mM of each), 2 l of forward and 2 l of reverse primers (10 pmol/ l each), 2 l of cDNA, 5 l of 0.04% Cresol Red (Sigma) in 60% sucrose, and 31 l of H2O. The primers used for ENaC were 2F and 2218R; for ENaC, 1F and 2396R; and for ENaC, 2F and 2187R (Table 2). The cDNA fragments were first heated to 94 C for 3 min, then amplified for 35 cycles at 94 C for 30 s, 60 C for 30 s, and 72 C for 45 s. After a final 5-min extension at 72 C, the PCR products were analyzed by electrophoresis in a 3% Nusieve 3:1 agarose gel.
Quantitative Evaluation of ENaC mRNA ENaC cDNA was coamplified with cystic fibrosis transmembrane regulator (CFTR) cDNA by PCR in the presence of [ -32P]dCTP.
Patient and control genomic DNA (20 g) was digested with 160 U of NdeI for 6 h and then run on a 0.8% agarose gel and transferred to nylon membranes (Zetaprobe GT; Biorad, Hercules, CA). Cosmid clones containing the 5 portion of the hENaC gene, 359G1 and 355F5, were also cut with NdeI and run alongside as positive controls (23). The 613-bp 15-7 genomic DNA fragment was radiolabeled with Klenow DNA polymerase and [-32P]dCTP (Decaprime II DNA Labeling kit; Ambion, Austin, TX) and the transferred membrane hybridized overnight at 65 C in a solution that contained 0.5 M Na 2HPO4 (pH 7.2) and 7% SDS. The membranes were washed twice at 65 C in 40 mM Na2HPO4 (pH 7.2), 5% SDS, and then with 40 mM Na 2HPO4 (pH 7.2), 1% SDS and subjected to autoradiography. A second genomic fragment corresponding to a 200-bp region of terminal exon of hENaC was amplified with primers 5 GCTGGTGGCCTTGGCCAAGAG and 5 GTCCAGCGGCTGCAGACGCAG, and radiolabeled as previously described. After allowing the radiographic signals to decay, the membrane was rehybridized to the second DNA fragment, then washed and autoradiograms generated.
Results The clinical syndrome manifested by this young male with renal salt wasting, hyperkalemia, and metabolic acidosis associated with elevated plasma renin activity and aldosterone levels is characteristic of PHAI. This phenotype arises from loss of function of the epithelial sodium channel and occurs with mutations of any of the three ENaC subunits as an autosomal recessive disease or with mutations in the MR as an autosomal dominant disease (18, 19, 24). Mutations of ENaC subunits cause a more severe phenotype at birth and are often associated with childhood pulmonary symptoms, a form called systemic PHAI (14, 25). We have recently demonstrated that most patients with systemic PHAI have mutations in the coding exons of -, -, or ENaC (15).
TABLE 1
Primer pairs used to amplify the 5 end of -, -, and ENaC Primers
Forward
Reverse
Gene
Product size (bp)
T-1
GCACGTGAAGAAGTACCTACTGAAG GGCCTG GGTCTGAGGCTGTGGACTTC GAGCCCTCTCATCACCAG CAGTCCACAAAAGGCACATCT AAGAGGCGGAGGGAAGAACG TGAGTGGCCTGGCTGAACAG ACCCAGCACCCAGAGAGCAGACGAA
GGTGAGCAGGAACCACATGGCT TTCTTC CATTTGCCCTCTCTCCACTC AGTCTCAGCCTTAGGGACCTG CCCATCGGTAGGCATTATCC AGCGGGGACACGGAGGATGC GCTGCTCCTCTGCTCGCTCTCG CCATGAGACCTGGTATGG
166
999 487 889 613 519 2,786
31-32 9-24 20-11 15-7 15-4 25-30
Based on accession numbers: U81961, U48937, AF260227, and AF260228.
316
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 27 2002
TABLE 2
List of oligonucleotide primers for RT-PCR Name
2F 2218R 1F 801F 1335R 2396R 2F 2187R CF4330F CF4647R
Gene
Sequence
-ENaC -ENaC -ENaC -ENaC -ENaC -ENaC -ENaC -ENaC CFTR CFTR
CGGCCAGCGGGCGGGCTCCCCAGCCAG GTTTGGGCGGCTCTGAGAGGAAGCC ATGCACGTGAAGAAGTACCTGCTG TCACTATGGCAACTGTTACATC CTTGCACATGCCAATGCAGGTC TTCTAGAGTAAATCAGGTGCCAC CCTCAAAGTCCCATCCTCGCCATG CTGGACAGTTGTGAGTGTTGCTGCG TGTGAACACAGGATAGAAGCAATGCT TTCCATGAGGTGACTGTCC
Patients with mutations of the MR have milder symptoms without lung involvement, and these symptoms remit with age. In this particular patient (PHA 44) with a clinical picture consistent with systemic PHAI, we first estimated nasal Na transport by measuring basal and amiloridesensitive transepithelial voltage. (26). Some of the clinical features and laboratory data have been previously presented in abbreviated form (15). In each nostril this patient had a low basal PD (10 and 14 mV, respectively) with an inhibition of only 1 mV after amiloride infusion, which demonstrates a substantially reduced amiloride-sensitive potential difference as previously reported (15). To test for a mutation in ENaC, we amplified each of the coding exons and adjacent splice sites of each of the ENaC subunits by PCR for direct sequencing and could not identify a significant mutation (Patient #5 in Ref. 15). The lack of mutations in the coding region indicated one of two possibilities: (i) the disorder exhibited genetic heterogeneity and in this patient it was secondary to a mutation in a gene other than ENaC, or (ii) that the mutation was present elsewhere in an ENaC gene such as in the untranslated re-
Figure 1. RT-PCR of -, -, and ENaC subunits. Total RNA was prepared from nasal scrapings of PHA 44 and 46 and from a normal control subject. PCR products were examined by agarose gel electrophoresis. - and ENaC were present in all samples, whereas ENaC mRNA was absent in PHA 44.
gion, intron, or in a regulatory region, thus affecting transcription, translation, stability, or splicing of the transcript. To determine if there was a change in expression of ENaC transcript, the coding region of each subunit was amplified by RT-PCR from the patient’s nasal epithelial RNA. A single band of the appropriate size was observed for and subunits, whereas no product was detectable for the subunit (Figure 1). Nasal epithelia cDNA from a normal control subject and from a patient (PHA 46) with a known mutation elsewhere were used as controls and, as expected, amplified products for each of the subunits. To exclude the possibility that one of the primers was located in an absent noncoding region of the ENaC cDNA, four pairs of primers generating four overlapping segments of ENaC cDNA were used in a second set of PCR reactions. We were unable to amplify any of these regions of ENaC in this patient (data not shown). To evaluate ENaC mRNA semiquantitatively, we compared ENaC mRNA levels in this patient with that of CFTR, an unrelated chloride channel. ENaC cDNA was coamplified with CFTR cDNA in the presence of [32P]dCTP to increase the sensitivity of detection. In comparison with normal control subjects and PHA 46 (a patient with normal levels of expressed ENaC), there was no detectable ENaC after 20 cycles of PCR, although a faint signal was observed after 24 cycles (Figure 2). This signal was less than 2% of the ENaC product in normal control subjects, and it is not clear if the faint signal in the patient was indeed from ENaC cDNA. We then considered the possibility that the phenotype was secondary to a mutation in the 5 untranslated region or the 5 regulatory regions of the ENaC gene. The 5 end of the ENaC gene has a complex organization with three exons, 1A, 1B and 1C, upstream of exon 2, which contains the translation start codon (23). As a result of this organization, two transcripts, ENaC-1 and -2, arise from alternate initiating exons under the control of separate promoters. A series of primers was designed to amplify each of the 5 exons and the 5 flanking region upstream of these exons as well as the 5 flanking region of - and ENaC genes (see Table 1). Although we amplified exon 2
Figure 2. Semiquantitative RT-PCR of ENaC. ENaC mRNA was coamplified with CFTR mRNA for 20 and 24 cycles. [ 32P]labeled PCR products were separated by acrylamide gel electrophoresis. There is no detectable ENaC in PHA 44 after 20 cycles, although a very faint band was observed after 24 cycles. The second lane is a pooled sample from normal individuals.
Thomas, Zhou, Liu, et al.: ENaC Promoter Deletion in PHAI
317
of BENaC we were unable to amplify exon 1A or exon 1B with its adjacent 5 flanking region (Figure 3). In all reactions we were able to amplify the corresponding sequence in a “normal” control. We were also able to amplify the 5 flanking region of - and ENaC genes in PHA 44 (data not shown). Because each 5 exon in ENaC is 1.5 kb apart, these findings were strongly suggestive of a large deletion in this region of the gene. To confirm this hypothesis, we performed Southern blot analysis using NdeI digested patient and control subject genomic DNA, as well as ENaC cosmid clones and a radiolabeled probe corresponding to the proximal promoter region for ENaC-1. A distinct band of the predicted size was present in control lanes but was not seen in the lane that contained patient DNA (Figure 4). To confirm that there was no error in DNA loading and to look at a different region of the ENaC gene, the blot was rehybridized with a probe that corresponded to the terminal exon of ENaC. The results showed that a similar sized fragment of equal intensity was detected in both control subject and patient lanes. These studies confirm that patient PHA 44 has a homozygous deletion that includes the 5 end of ENaC that is at least 1,300 bp in length. Based on the inability to amplify selected regions of the gene, the deletion is likely to be greater than 2,600 bp.
Discussion This patient has the typical clinical features of systemic PHAI: (1) born with no evidence of perinatal respiratory stress; (2) early presentation within the first week of life with severe dehydration, acidosis, and hyperkalemia; (3) striking evidence of renal salt wasting, but with high levels of aldosterone and renin; (4) successful treatment of the metabolic syndrome with supplemental NaCl, NaHCO3, and potassium exchange resins; (5) recurrent respiratory illnesses beginning in the first year of life and waning in severity and frequency by approximately age 6; and (6) evidence of defective Na absorption in sweat ducts and salivary ducts and nasal epithelia. If these patients reach the age of 6 to 8 without development of serious bronchiectasis, they tend to have relatively normal pulmonary status, although viral illnesses appear to precipitate mild exacerbations of their PHA-related pulmonary disease, which is manifested primarily as cough and sometimes as wheezing. There are three principal forms of PHA. Type 1 refers to a clinical syndrome that appears to be inherited as an autosomal recessive disorder arising from mutations in any of the ENaC subunits or as an autosomal dominant disorder from mutations in the MR (13, 27). Mutations in MR have also been detected in apparently sporadic cases of PHAI (28). Furthermore, some dominant kindred do not have identifiable mutations in the MR, suggesting that there may be locus heterogeneity for the dominant form. Type II refers to a clinical syndrome that includes hyperkalemia and acidosis without salt wasting and with normal or low aldosterone levels, which, in some families, arise from mutations in kinases of the WNK family (29). In contrast to other types of PHA, patients with PHAII (also called Gordon’s syndrome) have hypertension and the absence of an elevated aldosterone level, indicating that this form of PHA is a mis-
Figure 3. Genomic PCR of selected regions at the 5 end of ENaC. (A) Schematic of the 5 end of ENaC. Open and closed boxes are numbered exons, and the bent arrows indicate transcription start sites. Primers are indicated as numbered arrows, and the size of each intron is indicated below. An asterisk indicates primers that failed to give a PCR product in PHA 44. (B) Individual PCR reactions in negative control (no DNA), positive control (normal DNA), and PHA 44 DNA. Primer pairs 9-24, 20-11, and 15-7 do not amplify a product from PHA 44 DNA.
nomer. PHA type III include a variety of “salt wasting” acquired chronic renal diseases that have reductions in GFR, hyperkalemia, acidosis, and hyperaldosteronism (30). The only form of PHA with reported lung disease is the autosomal recessive form of PHAI. The pulmonary phenotype appears to be related to absent or severely reduced amiloride-sensitive Na transport in airway epithelia, a functional defect that can be identified by measurement of transepithelial potential difference in nasal and bronchial epithelia. This systemic syndrome arises from loss of function mutations in both copies of the -, - or ENaC subunit (15–18). As is common with rare autosomal recessive disorders, many of these patients are the products of consanguinity, whereby homozygous mutations reflect the inheritance of the same abnormal allele from both parents (15). In other patients, the syndrome arises from heterozygous mutations in both alleles of the same gene (15–18). Interestingly, in three Swedish kindred, all affected patients had a single base deletion, 1449delC, in the ENaC subunit, suggesting that this may be a founder mutation in that population. In contrast to mutations in ENaC sub-
318
AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 27 2002
Figure 4. Southern blot. (A and B) Schematic of the 5 and 3 ends of the ENaC gene with numbered exons as open and closed boxes, the probes shown as lines, and NdeI sites indicated. (C) Cosmid and genomic DNA digested with NdeI and analyzed by Southern hybridization. A specific 1,300-bp band corresponding to the NdeI fragment shown in A is seen with cosmid clones 359G1 and 355F5 and in normal control DNA. The marker is a 1-kb DNA ladder (Life Technologies) that shows nonspecific hybridization with the probe. (D) A specific 3,200bp band corresponding to the NdeI fragment shown in B is seen in normal control DNA and in PHA 44 DNA. There is nonspecific hybridization to the 1,600bp marker. There is no hybridization signal with cosmid clones 359G1 and 355F5 because these contain the 5 end of the gene only.
units that cause the systemic form of PHAI, mutations in MR cause a renal limited form of PHAI because Na transport in alveolar and airway epithelium is not normally responsive to aldosterone (31). We have previously measured nasal and rectal potential difference before and after stimulation with spironolactone and gathered in vivo data to support this concept (32). Some patients, like PHA 44, who have systemic PHAI with reduced amiloride-sensitive Na absorption in nasal epithelia do not appear to have mutations in the coding exons of any of the three ENaC subunits (15, 33). In one of these patients, we now demonstrate a homozygous deletion in the 5 regulatory region of ENaC resulting in absent or nearabsent expression of the ENaC transcript. Compared with point mutations, large gene deletions are unusual causes of disease and arise from unequal crossover during meiosis, replication slippage, or excision by transposable elements. We have been unable to confirm the full extent of the deletion or the mechanism that may have led to this type of mutation. Using the Censor server at http://www.girinst.org/ Censor_Server.html we identified numerous interspersed repetitive sequences, including Alu, MIR, and L2B elements, and we speculate that replication slippage during DNA synthesis may account for this gene deletion (34). In summary, when there is no identifiable loss of function mutations in -, -, and ENaC subunits in patients with classic systemic PHAI, screening for mutations in the proximal promoter region should be considered. The demonstration that large deletions in regulatory regions can cause severe disease also raises the possibility that milder clinical phenotypes may result from polymorphisms in the promoter regions of ENaC. Furthermore, because at least three distinct genes can cause loss of function of the epi-
thelial sodium channel, it is possible that systemic PHAI could be inherited in a digenic pattern from heterozygous mutations in one copy of each of two independent genes. Indeed, in a recent study, five sporadic cases of renal-limited PHAI had single nucleotide substitutions in one or both copies of MR and one or both copies of ENaC (35). Acknowledgments: This work was supported in part by USPHS grants DK54348, HL34322, and RR00046; by March of Dimes Birth Defects Foundation Research Grant #6-FY99-444; and by a CF Foundation RDP. C.T. is an Established Investigator of the American Heart Association.
References 1. Petersen, S., J. Giese, A. M. Kappelgaard, H. T. Lund, J. O. Lund, M. D. Nielsen, and A. C. Thomsen. 1978. Pseudohypoaldosteronism: clinical, biochemical and morphological studies in a long-term follow-up. Acta Paediatr. Scand. 67:255–261. 2. Oberfield, S. E., L. S. Levine, R. M. Carey, R. Bejar, and M. I. New. 1979. Pseudohypoaldosteronism: multiple target organ unresponsiveness to mineralocorticoid hormones. J. Clin. Endocrinol. Metab. 48:228–234. 3. Verrey, F. 1999. Early aldosterone action: toward filling the gap between transcription and transport. Am. J. Physiol. Renal Physiol. 277:F319–327. 4. Rogerson, F. M., and P. J. Fuller. 2000. Mineralocorticoid action. Steroids 65:61–73. 5. Stokes, J. B. 2000. Understanding how aldosterone increases sodium transport. Am. J. Kidney Dis. 36:866–870. 6. Garty, H., and L. G. Palmer. 1997. Epithelial sodium channels: function and regulation. Physiol. Rev. 77:359–396. 7. Barbry, P., and P. Hofman. 1997. Molecular Biology of Na absorption. Am. J. Physiol. 273:G571–G585. 8. Matalon, S., and H. O’Brodovich. 1999. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties and physiological significance. Annu. Rev. Physiol. 61:627–661. 9. Matsushita, K., P. B. J. McCray, R. D. Sigmund, M. J. Welsh, and J. B. Stokes. 1996. Localization of epithelial sodium channel subunit mRNAs in adult rat lung by in situ hybridization. Am. J. Physiol. 271:L332–L339. 10. Talbot, C. L., D. G. Bosworth, E. L. Briley, D. A. Fenstermacher, R. C. Boucher, S. E. Gabriel, and P. M. Barker. 1999. Quantitation and localization of ENaC subunit expression in fetal, newborn, and adult mouse lung. Am. J. Respir. Cell Mol. Biol. 20:398–406. 11. Smith, D. E., G. Otulakowski, H. Yeger, M. Post, E. Cutz, and H. M.
Thomas, Zhou, Liu, et al.: ENaC Promoter Deletion in PHAI
12. 13. 14.
15.
16.
17.
18.
19.
20. 21.
22.
O’Brodovich. 2000. Epithelial Na channel (ENaC) expression in the developing normal and abnormal human perinatal lung. Am. J. Respir. Crit. Care Med. 161:1322–1331. Rochelle, L. G., D. C. Li, H. Ye, E. Lee, C. R. Talbot, and R. C. Boucher. 2000. Distribution of ion transport mRNAs throughout murine nose and lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L14–24. Hanukoglu, A. 1991. Type I pseudohypoaldosteronism includes two clinically and genetically distinct entities with either renal or multiple target organ defects. J. Clin. Endocrinol. Metab. 73:936–944. Hanukoglu, A., T. Bistritzer, Y. Rakover, and A. Mandelberg. 1994. Pseudohypoaldosteronism with increased sweat and saliva electrolyte values and frequent lower respiratory infections mimicking cystic fibrosis. J. Pediatr. 125: 752–755. Kerem, E., T. Bistritzer, A. Hanukoglu, T. Hofman, Z. Zhou, W. Bennett, E. MacLaughlin, P. Barker, M. Nash, L. Quittell, R. Boucher, and M. R. Knowles. 1999. Pulmonary epithelial sodium-channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N. Engl. J. Med. 341:156–162. Schaedel, C., L. Marthinsen, A.-C. Kristoffersson, R. Kornfalt, K. O. Nilsson, B. Orlenius, and L. Holmberg. 1999. Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the -subunit of the epithelial sodium channel. J. Pediatr. 135:739–745. Adachi, M., K. Tachibana, Y. Asakura, S. Abe, J. Nakae, T. Tajima, and K. Fujieda. 2001. Compound heterozygous mutations in the gamma subunit gene of ENaC (1627delG and 1570–1G→A) in one sporadic Japanese patient with a systemic form of pseudohypoaldosteronism type 1. J. Clin. Endocrinol. Metab. 86:9–12. Chang, S. S., S. Grunder, A. Hanukoglu, A. Rosler, P. M. Mather, I. Hanukoglu, L. Schild, Y. Lu, R. A. Shimkets, C. Nelson-Williams, B. C. Rossier, and R. P. Lifton. 1996. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalemic acidosis, pseudohypoaldosteronism type 1. Nat. Genet. 12:248–253. Geller, D. S., J. Rodriguez-Soriano, A. Vallo Boado, S. Schifter, M. Bayer, S. S. Chang, and R. P. Lifton. 1998. Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type I. Nat. Genet. 19:279–281. Thomas, C. P., N. A. Doggett, R. Fisher, and J. B. Stokes. 1996. Genomic organization and the 5 flanking region of the gamma subunit of the human amiloride-sensitive epithelial sodium channel. J. Biol. Chem. 271:26062–26066. Thomas, C. P., S. D. Auerbach, J. B. Stokes, and K. A. Volk. 1998. 5 heterogeneity in amiloride-sensitive epithelial sodium channel alpha subunit mRNA leads to distinct NH2-terminal variant proteins. Am. J. Physiol. 274:C1312–1323. Mick, V. E., O. A. Itani, R. W. Loftus, R. F. Husted, T. J. Schmidt, and C. P. Thomas. 2001. The subunit of the epithelial sodium channel is an aldosterone-induced transcript in mammalian collecting ducts, and this tran-
319
23. 24.
25. 26. 27. 28.
29.
30. 31. 32. 33. 34. 35.
scriptional response is mediated via distinct cis-elements in the 5 flanking region of the gene. Mol. Endocrinol. 15:575–588. Thomas, C. P., K. Z. Liu, R. W. Loftus, and O. A. Itani. 2002. Genomic organization of the 5 end of human ENaC and preliminary characterization of its promoter. Am. J. Physiol. Renal Physiol. 282:F898–F909. Strautnieks, S. S., R. J. Thompson, R. M. Gardiner, and E. Chung. 1996. A novel splice-site mutation in the gamma subunit of the epithelial sodium channel gene in three psuedohypoaldosteronism type 1 families. Nat. Genet. 13:248–250. Malagon-Rogers, M. 1999. A patient with pseudohypoaldosteronism type 1 and respiratory distress syndrome. Pediatr. Nephrol. 13:484–486. Knowles, M. R., A. M. Paradiso, and R. C. Boucher. 1995. In vivo nasal potential difference: techniques and protocols for assessing efficacy of gene transfer in cystic fibrosis. Hum. Gene Ther. 6:445–455. Oh, Y. S., and D. G. Warnock. 2000. Disorders of the epithelial Na() channel in Liddle’s syndrome and autosomal recessive pseudohypoaldosteronism type 1. Exp. Nephrol. 8:320–325. Viemann, M., M. Peter, J. P. Lopez-Siguero, G. Simic-Schleicher, and W. G. Sippell. 2001. Evidence for genetic heterogeneity of pseudohypoaldosteronism type 1: identification of a novel mutation in the human mineralocorticoid receptor in one sporadic case and no mutations in two autosomal dominant kindreds. J. Clin. Endocrinol. Metab. 86:2056–2059. Wilson, F. H., S. Disse-Nicodeme, K. A. Choate, K. Ishikawa, C. NelsonWilliams, I. Desitter, M. Gunel, D. V. Milford, G. W. Lipkin, J. M. Achard, M. P. Feely, B. Dussol, Y. Berland, R. J. Unwin, H. Mayan, D. B. Simon, Z. Farfel, X. Jeunemaitre, and R. P. Lifton. 2001. Human hypertension caused by mutations in WNK kinases. Science 293:1107–1112. Stokes, J. B. 1999. Disorders of the epithelial sodium channel: insights into the regulation of extracellular volume and blood pressure. Kidney Int. 56:2318– 2333. Grubb, B. R., and R. C. Boucher. 1998. Effect of in vivo corticosteroids on Na transport across airway epithelia. Am. J. Physiol. Cell Physiol. 275: C303–308. Knowles, M. R., J. T. Gatzy, and R. C. Boucher. 1985. Aldosterone metabolism and transepithelial potential difference in normal and cystic fibrosis subjects. Pediatr. Res. 19:676–679. Prince, L. S., J. L. Launspach, D. S. Geller, R. P. Lifton, J. H. Pratt, J. Zabner, and M. J. Welsh. 1999. Absence of amiloride-sensitive sodium absorption in the airway of an infant with pseudohypoaldosteronism. J. Pediatr. 135:786–789. Jurka, J. 1998. Repeats in genomic DNA: mining and meaning. Curr. Opin. Struct. Biol. 8:333–337. Arai, K., K. Zachman, T. Shibasaki, and G. P. Chrousos. 1999. Polymorphisms of amiloride-sensitive sodium channel subunits in five sporadic cases of pseudohypoaldosteronism: do they have pathologic potential? J. Clin. Endocrinol. Metab. 84:2434–2437.
