Table S1. Summary of reference sequences included in the ... - PeerJ

Recommend Documents

S1 Table: Summary of included studies - PLOS

young adults aged 18 â 25 years with chronic kidney disease. 80 young adults in baseline, 76 after 12 months. Ferris et al (2015) [28]. Intervention proposals n/a.

Table S1. Summary of the available experimental data ... - PeerJ

Acropora millepora. 0-(-155). Vogel et al. 2015. TA and BW. 16 days. 1 h. 0.2 L no information on coral size. Level of response is light- dependent. Acropora.

Table S1: Characteristics of included studies

Medtronic Interstimâ¢ model 3625, Minneapolis, MN; a; procedure of ... Interstim system (Medtronic: Minneapolis, MN); procedure and programming was.

S1 Table Reference 16S rRNA gene sequences of ...

Hanada S, Liu W-T, Shintani T, Kamagata Y, Nakamura K. Tetrasphaera elongata sp. nov., a polyphosphate-accumulating bacterium isolated from activated ...

Table S1 List of specimens included in the study.

Vrhnika. Slovenia. GenBank. L. juvernica hj11. EF599645. Barje. Slovenia. GenBank. L. juvernica hj1. EF599646. Barje. Slovenia. RVcoll.10-B468. L. juvernica.

Table S1: Included study characteristics

Pain Before and After a Pilates Intervention. 28 da Silva, A. 2010. Evaluation of an Extract of Brazilian Arnica. (Solidago chilensis Meyen, Asteraceae) in Treating.

Table S1: Included Study Characteristics

Bernstein J, Heeren T, Edward E, et al. ... Diedrichs PC, Atkinson MJ, Steer RJ, Garbett KM, Rumsey N, Halliwell E. Effectiveness of a brief school-based body ...

SUPPLEMENTARY MATERIAL Table S1. Variables included in the ...

Heart failure. hsCRP*. NT-proBNP*. Age. Sex. Body mass index. Systolic blood pressure. Hypertension meds. Cardiac murmur. PR interval. Heart failure. Age.

Table S1. Variants included in the genetic instruments

Non-cancer illness code, self-reported: irritable bowel syndrome. MR, LDSC. 20002_1155 ..... Treatment/medication code: questran 4g/sachet powder. MR.

Table S1. Details of supplement used in included studies ... - MDPI

Zureik et al.2004[10]. Vitamins plus minerals 5(3 vitamins + 2 minerals). Vitamin C, vitamin ... 8 minerals. Water rich in calcium, magnesium, sodium, potassium, ...

Supplementary Table S1 Sequences of primers used

5-Methylthioribose 1-phosphate. 1.41E-05. 0.99. 0.05. 1.18. 0.90. 0.38 1.33. 2M+FA-H ... 6.07 606.07 C17H27N3O17P2 UDP-N-acetyl-D-mannosamine. 7.63E-14 ..... 11.27 1.62 29.28 1.86 0.28 1.93 0.14 1.40 1.93 1.21 .... V. 35.68+1 7.14%. â. â. â. 3-

S1 Table. Summary of sequences involved in the KEGG pathways and ...

Adipocytokine signaling pathway. 136. Adrenergic ... Axon guidance. 185. B cell receptor signaling pathway. 149 ... Hippo signaling pathway -fly. 181. Histidine ...

Table S1. Summary of strains and sequences used in the ... - mBio

Expression uncertain. No. No. None. SK597 / CCUG 55094. AEDV00000000. 23641. smI. Pos. Pos. Yes. Yes. aliC + aliD. SK608. PRJNA242555. 21468. smI.

Table S1. Native American populations included in this study ... - PLOS

17. Waunana. Chanco, Chocama, Noanama, Noenama, Nonama, Waumeo, Waun Meo, Woun Meu,. Wounaan, Wounmeu1,2. 5. -77. 20. Embera. Atrato, Cholo ...

Table S1. Taxa and GenBank accession numbers included in ... - MDPI

Page 1. Page 2.

Table S1. Summary of oligonucleotides ...

coracle ATRE CHIP For gctcttgatattatgccttagctggtgc coracle ATRE CHIP Rev cgaattgtcgatagcgcatagcgatt. aTub84B ATRE ChIP For gctgaaaagaaatttgtgtgggcaaa.

Table S1. Summary of published lung differentiation

mouse. N/A. Basal cells (but not secretory or ciliated) in mouse graft. N/A. Potential cystic fibrosis. Wong et al, ... Dorsomorphin (BMP inhibitor), SB431542 (TGFÎ².

Table S1. Summary of Ethical Approvals Ethical

.57 .05 .51 .05. My supervisor knows when my next supervision meeting will take place .49 .05 --. --. My supervisor does not give me personal feedback (R).

Table S1. Summary of available artemisinin ...

Summary of available artemisinin combination therapies (ACTs). List is a compilation from [1-4]. N/A represents that data on world usage of the drugs are.

S1 Table. Summary of simulation settings. - PLOS

stratification. Sample overlap. 1. Blood lipids. 1a. #$% = â()*. " 0.87. â0.04. 0.30. 0.85. â0.04. 1.00. â0.62 0.18. 0.30. â0.62. 0.93. 0.30. 0.85. 0.18. 0.30. 0.95. 1.00.

Supplementary Tables Table S1. Summary of markers

3.35. 3 m19159. 43.19. 3.51 scaffold177666. 9,343. Coagulation factor V. 1.00E-05. 3 m114454. 43.29. 3.51 scaffold19346. 1,543. Acid trehalase-like protein 1.

Table S1. Neuropsychological Tests Included in Meta ...

Table S1. Neuropsychological Tests Included in Meta-Analysis. Cognitive domain. Neuropsychological Test. Number of Studies. Attention. Digit Span. 4 (26-29).

Table S1. List of specimens of living species included ...

Supplemental Table S1 Oligonucleotide primer sequences ... - Hindawi

5-GGTGGAAGGACTTAGGTTTG-3 p16. 5'- TTATTTGAGCTTTGGTTCTG-3'. 5'- CCGGCTTTCGTAGTTTTCAT-3' p21. 5'-GAGGCCGGGATGAGTTGGGAGGA-3'.

Table S1. Summary of reference sequences included in the ... - PeerJ

Download PDF

1 downloads 0 Views 23KB Size Report

Comment

Metazoa Gnathostomulida. Metazoa Hemichordata. Metazoa Kinorhyncha. Metazoa Loricifera. Metazoa Mollusca. Metazoa Myzostomida. Metazoa Nematoda.

Table S1. Summary of reference sequences included in the databases used for taxonomic assignment of COI and 18S using ecotag.

Taxonomic group Prokaryota Amoebozoa Apicomplexa Apusozoa Centroheliozoa Ciliophora Cryptophyta Dinoflagellata Excavata Euglenozoa Excavata Other Fungi Ascomycota Fungi Basidiomycota Fungi Blastocladiomycota Fungi Chytridiomycota Fungi Cryptomycota Fungi Entomophthoromycota Fungi Entorrhizomycota Fungi Glomeromycota Fungi Microsporidia Fungi Neocallimastigomycota Fungi Zygomycota Glaucophyta Haptophyta Metazoa Acanthocephala Metazoa Annelida Metazoa Arthropoda Metazoa Brachiopoda Metazoa Bryozoa Metazoa Chaetognatha Metazoa Chordata Metazoa Cnidaria Metazoa Ctenophora Metazoa Echinodermata Metazoa Entoprocta Metazoa Gastrotricha Metazoa Gnathostomulida Metazoa Hemichordata Metazoa Kinorhyncha Metazoa Loricifera Metazoa Mollusca Metazoa Myzostomida Metazoa Nematoda Metazoa Nematomorpha Metazoa Nemertea Metazoa Onychophora Metazoa Platyhelminthes Metazoa Porifera Metazoa Priapulida Metazoa Rhombozoa Metazoa Rotifera Metazoa Tardigrada Metazoa Xenacoelomorpha Opisthokonta Choanozoa Perkinsozoa

Number of reference sequences in db_COI_MBPK database

Number of reference sequences in db_18S_r117 database

45 16 166 0 0 99 5 603 6 11 156 25 2 4 0 0 0 1 0 0 5 6 9 95 7269 108843 44 158 44 40037 1118 1 4771 3 52 2 4 0 0 15032 1 1507 0 160 363 1439 397 4 14 761 229 60 0 0

2 462 628 22 36 904 178 423 475 149 1200 584 29 62 1 48 4 122 60 11 195 4 94 59 1018 8275 34 137 20 339 671 12 66 17 95 24 17 23 2 858 0 1547 13 79 38 1259 244 5 4 34 109 134 52 8

Rhizaria Cercozoa Rhizaria Foraminifera Rhizaria Polycystinea Rhizaria Other Rhodophyta Stramenopiles Bacillariophyta Stramenopiles Chrysophyceae Stramenopiles Bigyra Stramenopiles Eustigmatophyceae Stramenopiles Oomycetes Stramenopiles Phaeophyceae Stramenopiles Raphidophyceae Stramenopiles Synurophyceae Stramenopiles Xanthophyceae Stramenopiles Other Viridiplantae Chlorophyta Viridiplantae Streptophyta TOTAL

2 0 0 0 4723 68 7 2 8 235 170 26 2 8 0 28 128

193 948 84 2 688 584 72 101 25 70 65 5 45 30 22 717 1588

188929

26125