Metro Manila, Philippines). Abstract: An F3 population derived from ..... Plant Cell, 2000, 12: 2033-2045. 18 Jia Y, Wang Z, Singh P. Development of dominant ...
Rice Science, 2004, 11(5-6): 251-254 http://www.ricescience.org
251
Tagging Blast Resistance Gene Pi 1 in Rice (Oryza sativa) Using Candidate Resistance Genes WU Jian-li1,2, Menchu BERNADO2, ZHUANG Jie-yun1, ZHENG Kang-le1, Hei LEUNG2 (1Chinese National Center for Rice Improvement, State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; 2Entomology and Plant Pathology Division, International Rice Research Institute, DAPO P.O. Box 7777, Metro Manila, Philippines)
Abstract: An F3 population derived from C101LAC/CO39 containing 90 lines was analyzed for blast resistance with 48 candidate genes developed from resistance gene analogs (RGA) and suppression subtractive library. Genetic analysis confirmed that blast resistance of the population was controlled by a single gene Pi 1. One of the candidate genes, R10 was identified as associated with the blast resistance gene on the long arm of chromosome 11 and mapped using a DH population derived from Azucena/IR64. A pair of PCR based primers was designed based on the sequence of R10 for marker-aided selection of the blast resistance gene. The recombination frequency between Pi 1 and the marker was estimated as 1.28%. It suggested that strategy of employing candidate genes is useful for gene identification and mapping. A new RFLP marker and the corresponding PCR marker for tagging of Pi 1 were provided. Key words: rice; candidate gene; marker-aided selection; blast resistance
The increasing availability of DNA sequences from different sequencing projects has opened up new doors and opportunities to predict gene function and their contribution to phenotypes. Based on similarity to known genes or conserved motifs of proteins, many DNA sequences can be inferred to encode certain biochemical or metabolic functions. Depending on the richness of information of a particular biochemical pathway, putative functions can be ascribed to a collection of candidate genes either as complete cDNA or as expressed sequence tags (ESTs). Relative to anonymous molecular markers, DNA probes or markers derived from candidate genes are expected to be more informative in predicting function. One of the best cases of using candidate genes for understanding quantitative traits is the analysis of resistance to earworm in corn [1]. The p1 locus coding for a transcriptional activator together with other three candidate genes was identified to be responsible for resistance to corn earworm and explained 75.9% of the total phenotypic variation of resistance. Candidate gene approach has been used enormously in the analysis of metabolic pathways and identification of markers as selection tools in breeding programs [1-6].
Rice blast resistant gene Pi 1 originated from variety LAC23, Liberia, is one of the important and favorite resistant sources in tropical area of South Asia and Southeast Asia. The gene was first reported by Yu
et al [7] and located on the long arm of chromosome 11. To utilize the gene in marker-aided selection in rice breeding program for blast resistance including Pi 1 more effectively, various approaches including major gene resistance, major gene pyramiding and major gene with quantitative trait loci have been carried out in rice blast breeding programs. Whatever methods used so far in practice, there has been still a lack of specific molecular markers closely linked to the genes under investigation [8]. So far, marker-aided selection for this gene has been limited to RFLP markers in rice breeding program, and more closely linked markers are needed. Candidate major genes with common structure such as nuclear binding site (NBS) and leucine-rich repeat (LRR) provide more effective opportunities for the tagging of blast resistant major genes. We here present a new molecular marker derived from a rice major candidate gene for tagging blast Pi 1 gene.
MATERIALS AND METHODS Rice populations
Received: 30 August 2004; Accepted: 10 December 2004
An F3 population containing 90 lines derived from C101LAC/CO39 was provided by Plant
252
Rice Science, Vol. 11, No. 5-6, 2004
Breeding Genetic and Biochemistry (PBGB) Division, International Rice Research Institute (IRRI) and used for inoculation and segregation studies. C101LAC, donor of Pi 1 gene [9], was resistant to a major Philippine blast isolate PO 6-6 (lineage 4), while CO39 was highly susceptible to the isolate. The DH population containing 116 lines [10] was used for mapping of the blast resistance gene. Inoculation Blast inoculation followed the method as described previously [11]. One week after inoculation of the lines, disease response was scored following the methods of Bonman et al [12]. Having complete scoring of blast, the diseased leaves were cut off, discarded, and plants were allowed for regeneration of new leaves for DNA extraction. Southern blotting, PCR and polymorphism detection Approximately three weeks later, newly generated leaves were used for DNA extraction. Five grams of fresh leaves from 10 plants were bulked for DNA extraction using CTAB method [13]. Seven restriction enzymes (BamH I, Dra I, EcoR I, EcoR V, Hind III, Xba I and Bgl II) were used for parental survey of polymorphism. Southern blotting with Hybond-N+ membrane (Amersham Phamacia Biotech) was performed according to the standard procedure[14]. A total of 48 candidate gene probes, 11 from RGA
RESULTS
Table 1. Candidate gene clones used in this study. Clone namea
Code
Accession number
Source
NBS-LRR
R1
AF032688
Rice
NBS-LRR
R2
AF032689
Rice
NBS-LRR
R3
AF032690
Rice
NBS-LRR
R4
AF032691
Rice
NBS-LRR
R5
AF032692
Rice
NBS-LRR
R6
AF032693
Rice
NBS-LRR
R8
AF032695
Rice
NBS-LRR
R9
AF032696
Rice
NBS-LRR
R10
AF032697
Rice
NBS-LRR
R12
AF032699
Rice
NBS-LRR
R14
AF032701
Rice
a
and 37 from a rice subtractive library (rNBS clone, details see http://www.ksu.edu/ksudgc/) were used for parental survey in this study (Table 1). Candidate resistance gene probes were amplified with following procedures: pre-denaturation at 94 ℃ for 4 min followed by 35 cycles of 94 ℃, 1 min, 50 ℃, 1 min, 72 ℃, 2 min, and finally extended at 72 ℃ for 5 min. Blots were detected using ECL kits according to the manufacturers’ recommendation (Amersham). Sequences of candidate genes were supplied by Kansas State University (http://www.ksu.edu/ksudgc/) and primers were designed based on the sequence using Primer 3 Input. Forward primer PR10F for Pi 1 is: 5’AGGGAGATTTGACCATCGTG3’, and the reverse primer PR10R is: 5’CCTGATTGCAAGAGG TAGGC3’. The PCR reaction mixture contained 50 mmol/L KCl, 10 mmol/L Tris-Cl (pH 8.4), 0.1% Triton-X100, 1.5 mmol/L MgCl2, 0.2 μmol/L dNTPs, 2 ng of each primer and one unit of Taq polymerase in a total volume of 25 μ L. PCR amplification was conducted with an initial pre-denaturation at 94 ℃ for 4 min, followed by 35 cycles of 1 min denaturing at 94 ℃, 1 min annealing at 55 ℃ and 2 min extension at 72 ℃, and a final extension at 72 ℃ for 7 min. 10 μL of PCR products was digested with Hind III and the digests were run on 4% denaturing polyacrylamide gel with silver staining. Silver staining for detection of DNA band patterns was performed using the method recommended by the manufacturer (Promega).
Only 11 NBS-LRR candidate genes are listed on this table, 37 suppression subtractive clones (rNBS clones designated from rNBS1 to rNBS37) are not listed, detail information of the clones can be reached at: http://www.ksu.edu/ksudgc/
Among the 90 F3 lines inoculated with PO6-6, 68 lines were visualized as resistant and 22 lines as susceptible. Chi square test showed a single gene, Pi 1, was involved in the genetic control of the resistance (P3:1=0.17) as expected. Twelve lines out of 90 lines were not able to regenerate after inoculation, thus only 78 lines including 66 resistant and 12 susceptible lines were used for further DNA extraction and for probing and PCR amplification. Thirteen out of the 48 candidate genes used showed polymorphism between the two parents with multiple bands, and the candidate gene R10 displayed a sort of co-segregation with blast
CO39
C101LAC
WU Jian-li, et al. Tagging Blast Resistance Gene Pi 1 in Rice (Oryza sativa) Using Candidate Resistance Genes
R
R
R
S
S
S
S
S
S
R
R
R
R
253
R
bp
A
400 300 400 300 200
B
100 200
C
Fig. 1. Development of a PAGE-based STS marker for blast resistance gene Pi 1. A: PCR fragment amplified using the primers derived from candidate gene R10; B: PCR products digested with Hind III showing four major bands. C: 4%PAGE showing a band approximately 200 bp (arrow) co-segregating with Pi 1. The numbers on the left indicate molecular sizes (bp). R=resistant, S=susceptible.
resistance. R10 also showed polymorphism between the parents of the DH population, IR64 and Azucena, and it was mapped on the long arm of chromosome 11 in the vicinity of Pi 1 using the DH population of 116 lines [15]. PCR products amplified from primer PR10F/PR10R, designed using the sequence of R10, did not exhibit any polymorphism on 1.5% agarose gel (Fig.1-A) between C101LAC and CO39 and among the progenies. After digestion of the products with Hind III, four bands were detected on 1% agarose gel but no polymorphism was detected (Fig.1B). However, the polymorphism between the parents was observed on 4% PAGE, and the marker exhibited co-segregation with blast resistance in the progenies (Fig.1-A). All of the 66 resistant progenies showed
7.3 4.5
3.4 3.4 0.6 3.1 3.1 9.3
RG1109 rNBS55 R10
Pi 1
Npb186 rNBS38 OS-JAMyb RZ536 XLRfrA6 BBphen
Fig. 2. Location of candidate gene R10 and Pi 1 on chromosome 11 using a DH mapping population of 116 lines (Azucena/IR64). Only the portion of the long arm of chromosome 11 harboring Pi 1 is presented here.
the same pattern to C101LAC with an additional band of approximately 200 bp (Fig.1-A), while 11 out of 12 susceptible plants showed the same band pattern to CO39. The recombination frequency between Pi 1 and the marker was estimated as 1.28%, and the RFLP probe was mapped on chromosome 11 using the DH mapping population (Fig. 2).
DISCUSSION Although major gene resistance could not prove to be durable in the case of rice blast, various combinations of using major blast resistance genes including mixture cultivation gene pyramiding have been considered in rice breeding programs. Pi 1 is a very useful source of blast resistance especially in tropical and sub-tropical regions such as Viet Nam, Bangladash and Thailand. However, the lack of closely linked molecular markers has impeded the utilization of this important gene. Recent molecular markers in the application of Pi 1 are RFLP markers. These RFLP probes, RZ536 and NpB181, are 7.9 cM and 3.5 cM away from the gene, respectively [8]. In order to utilize marker-aided selection for Pi 1 in rice breeding programs efficiently, closely linked markers are needed. There are several approaches to develop molecular markers including: resistance gene analogs from known genes, candidate genes from suppression subtractive libraries and random markers from various mapping studies. For example, cloning of blast resistance gene Pi b and
254
Rice Science, Vol. 11, No. 5-6, 2004
Pi ta has provided very closely linked markers or markers from within the genes for tagging these two genes [16-18]. We used blast suppression subtractive clones and RGAs in this study for tagging of Pi 1 gene. Previous studies indicated that Pi 1 was mapped on the long arm of chromosome 11[7,19]. Our study confirmed the results of previous mapping studies and identified several clones linked to Pi 1. One of clones, R10, was transformed to PCR marker for tagging of Pi 1. In general, this study would provide both a RFLP marker and a corresponding STS marker for breeders to use in their breeding programs for marker-aided selection of Pi 1. It indicated that candidate gene approach is a very useful and efficient way for identification and mapping of plant resistance genes.
6
7
Thorup T A, Tanyolac B, Livingstone K D, Popvosky S, Paran I, Jahn M. Candidate gene analysis of organ pigmentation loci in the Solanaceae. Proc Natl Acad Sci USA, 2000, 97: 11192-11197. Yu Z H, Mackill D J, Bonman J M, Tanksley S D. Tagging genes for blast resistance in rice via linkage to RFLP markers.
8
9
10
Theor Appl Genet, 1991, 81: 471-476. Hittalmani S, Parco A, Mew T W, Zeigler R S, Huang N. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor Appl Genet 1986, 100: 1121-1128. Mackill D J, Bonman J M. Inheritance of blast resistance in near isogenic lines of rice. Phytopathology, 1992, 82: 746749. Guiderdoni E, Galinato E, Luistro J, Vergara G. Anther culture of tropical japonica/indica hybrids of rice (Oryza sativa L.). Euphytica, 1992, 62: 219-224.
11
Wu J L, Sinha P K, Variar M, Zheng K L, Leach J E, Courtois B, Leung H. Association between molecular markers and blast resistance in an advanced backcross
ACKNOWLEDGEMENTS
population of rice. Theor Appl Genet, 2004, 108: 1024-1032. 12
The authors would like to thank Professor Jan Leach for providing the candidate gene clones. We thank our colleagues Noel Salac and Mayee Revelche for help on growing of plants and DNA extraction at the International Rice Research Institute. The study was supported by Asian Rice Biotechnology Network and Chinese 863 Program (2003AA207030).
Bonman J M, Vergael de Dios T I, Khin M M. Physiological specialization of Pyricularia oryzae in the Philippines. Plant Dis, 1986, 70: 767-769.
13
Murray M G, Thompson W F. Rapid isolation of highmolecular-weight plant DNA. Nucleic Acids Res, 1980, 8: 4321-4325.
14
Sambrook J, Fritch E F, Maniatis T. Molecular Cloning: a laboratory manual. 2nd edn. New York: Cold Spring Harbor Laboratory Press, 1989.
15
REFERENCES
Ramalingam J, Vera Cruz C M, Kukreja K, Chittoor JM, Wu J L, Lee S W, Baraoidan M R, George M L, Cohen M, Hulbert S, Leach J E, Leung H. Candidate resistance genes
1
2
3
4
5
Byrne P F, McMullen M D, Snook M E, Musket T A, Theuri J M, Widstrom N W, Wiseman B R, Coe E H. Quantitative trait loci and metabolic pathways: genetic control of the concentration of maysin, a corn earworm resistance factor, in maize silks. Proc Natl Acad Sci USA, 1996, 93: 8820-8825. Urbanek M, Legro R S, Driscoll D A, Azziz R, Ehrmann D A, Norman R J, Straus J F, Spielman R S, Dunaif A. Thirtyseven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci USA, 1999, 96: 8573-8578. Faris J D, Li W L, Liu D J, Chen P D, Gill B S. Candidate gene analysis of quantitative disease resistance in wheat. Theor Appl Genet, 1999, 98: 219-225. Huh J H, Kang B C, Nahm S H, Kim S, Ha K S, Lee M H, Kim D B. A candidate gene approach identified phytoene synthase as the locus for mature fruit in red pepper (Capsium spp.). Theor Appl Genet, 2000, 102: 524-530. Pflieger S, Lefebvre V, Caranta C, Blattles A, Palloix A. Disease resistance gene analogs as candidates for QTLs involved in pepper-pathogen interactions. Genome, 1999, 42: 1100-1110.
from rice, barley, and maize and their association with qualitative and quantitative resistance in rice. Mol Plant Microbe Interact, 2003, 16: 14-24. 16
Wang Z X, Yano M, Yomanouchi U, Iwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki T. The Pi-b gene for rice blast resistance belongs to the nucleotide binding and leucine rich repeat class of plant resistance genes. Plant J, 1999, 19: 55-64.
17
Bryan G T, Wu K S, Farrall L, Jia Y, Hershey H P, McAdams S A, Faulk K N, Donaldson G K, Tarchini R, Valent B. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell, 2000, 12: 2033-2045.
18
Jia Y, Wang Z, Singh P. Development of dominant rice blast Pi-ta resistance gene markers. Crop Sci, 2002, 42: 2145-2149.
19
Yu Z H, Mackill D J, Bonman J M, McCouch S R, Guiderdoni E, Notteghem J L, Tanksley S D. Molecular mapping of genes for resistance to rice blast (Pyricularia grisea Sacc.). Theor Appl Genet, 1996, 93: 859-863.
