Targeted quantum dots fluorescence probes

Home

Search

Collections

Journals

About

Contact us

My IOPscience

Targeted quantum dots fluorescence probes functionalized with aptamer and peptide for transferrin receptor on tumor cells

This content has been downloaded from IOPscience. Please scroll down to see the full text. 2012 Nanotechnology 23 485104 (http://iopscience.iop.org/0957-4484/23/48/485104) View the table of contents for this issue, or go to the journal homepage for more

Download details: IP Address: 146.229.116.78 This content was downloaded on 25/02/2016 at 15:33

Please note that terms and conditions apply.

IOP PUBLISHING

NANOTECHNOLOGY

Nanotechnology 23 (2012) 485104 (11pp)

doi:10.1088/0957-4484/23/48/485104

Targeted quantum dots fluorescence probes functionalized with aptamer and peptide for transferrin receptor on tumor cells Ming-Zhen Zhang, Rong-Na Yu, Jun Chen, Zhi-Ya Ma and Yuan-Di Zhao Britton Chance Center for Biomedical Photonics, Department of Biomedical Engineering, Wuhan National Laboratory for Optoelectronics-Huazhong University of Science and Technology, Wuhan, HuBei 430074, People’s Republic of China E-mail: [email protected]

Received 6 June 2012, in final form 8 October 2012 Published 9 November 2012 Online at stacks.iop.org/Nano/23/485104 Abstract Quantum dots (QDs) fluorescent probes based on oligonucleotide aptamers and peptides with specific molecular recognition have attracted much attention. In this paper, CdSe/ZnS QDs probes for targeted delivery to mouse and human cells using aptamer GS24 and peptide T7 specific to mouse/human transferrin receptors were developed. Capillary electrophoresis analyses indicated that the optimal molar ratios of QDs to aptamer or peptide were 1:5. Fluorescence and confocal microscope imaging revealed QD-GS24 and QD-T7 probes were able to specifically recognize B16 cells and HeLa cells respectively. Quantitative flow cytometry analysis indicated the transportation of QD-GS24 or QD-T7 into cells could be promoted by corresponding free transferrin. Transmission electron microscopy confirmed the uptake of probes in cells and the effective intracellular delivery. MTT assay suggested the cytotoxicity of probes was related to the surface ligand, and aptamer GS24 (or peptide T7) could reduce the cytotoxicity of probes to a certain degree. The study has great significance for preparing QDs fluorescent probes using non-antibody target molecules. S Online supplementary data available from stacks.iop.org/Nano/23/485104/mmedia (Some figures may appear in colour only in the online journal)

1. Introduction

all kinds of optical molecular probes, fluorescent molecular imaging has become one of the main methods to study molecular events [4–6]. As a new type of fluorescence probe, semiconductor quantum dots coupled with target molecules have wide application in the field of nanomedicine, such as tumor cells labeling [7, 8] and in vivo cancer imaging [9–11]. Quantum dots (QDs) offer many unique features such as broad absorption spectra with continuous distribution, narrow emission spectra with symmetrical distribution, size- and composition-tunable emission from ultraviolet to infrared wavelengths, high fluorescence quantum yields, stability against photobleaching and good biocompatibility [12]. The remarkable photophysical properties of QDs make them

Conventional medical imaging methods, including magnetic resonance imaging (MRI), computed tomography (CT), position–emission tomography (PET), and ultrasound imaging (US), play important roles in the study of clinical medicine and relevant areas for diagnoses and therapies of diseases. However, these conventional medical imaging and detection methods cannot reveal molecular and cellular changes, which reflect characteristics of oncobiology, and have limitations in specificity, sensitivity and resolution [1]. Optical molecular imaging has advantages of ultrasensitivity, ultrafast response, high spatial resolution, multi-parameter testing and low damage [2, 3], and in particular, with the development of 0957-4484/12/485104+11$33.00

1

c 2012 IOP Publishing Ltd Printed in the UK & the USA

Nanotechnology 23 (2012) 485104

M-Z Zhang et al

7 amino acids screened by a phage display selection strategy, which can specifically bind to the human TfR (hTfR) [31]. These two fluorescent probes were used to label B16 cells and HeLa cells (both express high-level TfR) respectively. Fluorescence imaging results showed QD-GS24 and QD-T7 could specially recognize these two cell types. Further quantitative flow cytometry indicated that Tf, the native ligand of TfR, could promote the transportation progress of QDs probes. TEM confirmed the uptake of fluorescent probes in cells and the effective intracellular delivery and MTT experiments showed the cytotoxicity of probes was related to the surface ligand and aptamer GS24 (or peptide T7) could reduce the cytotoxicity of probes to a certain degree. The study has great important significance to prepare quantum dots fluorescent probes using non-antibody target molecules.

a superior probe in molecular imaging. At present, QDs mostly conjugate with antibodies to label cells or tissues expressing antigens [13–15]. Antibodies which have target binding capacity have been widely used in the fields of cancer diagnoses and treatments, but this method has limitations that include possible immunogenicity, long residence time in the blood, incomplete target tissue penetration, and being costly and time consuming in production [16, 17]. Therefore, using other kinds of target molecules with the advantages of no immunogenicity, shorter residence time in the blood, higher binding affinity and more accessible by chemical synthesis to prepare quantum dots, fluorescent probes have become one of the hotspots in the development of molecular probes [18–21]. Aptamers are selected from very large random libraries by a procedure known as systematic evolution of ligands by exponential enrichment (SELEX), which is an iterative process of enriching the mixture in molecules with high binding affinity and selectivity against the desired target. Aptamers with targeted specificity similar to antibodies and with the advantages of small size, easy synthesis and no immunogenicity [16, 17, 22], have been developed in cancer cell labeling and imaging. For example, Chu et al conjugated the A9 aptamer of prostate-specific membrane antigen (PSMA) with QDs and realized the labeling of fixed cells, live cells and prostate tumor cells (LNCaP) in a collagen gel matrix simulating tissue [23]. Chen et al conjugated a DNA aptamer targeted tenascin-C with QDs and achieved the labeling of glioma cells expressing high-level tenascin-C [24]. Recently, peptide sequences with high affinity and high specificity to their targeting molecules have also been screened and used in imaging. For instance, Brown et al conjugated the screened peptide sequence TP H2009.1 targeting αv β6 with QDs and realized the special labeling of lung adenocarcinoma cell line, H2009 [25, 26]. Gao et al conjugated superparamagnetic iron oxide (SPIO) nanoparticles with this lung cancer-targeting peptide, and used in magnetic resonance imaging (MRI) of lung cancer cells [27]. Other research groups also conjugated aptamer and peptide with different colored QDs for cancer cells simultaneous imaging. Ko and coworkers used dual color QDs conjugated by the AS1411 aptamer (targeting nucleolin) and the RGD tripeptide (targeting the integrin αv β3 ) and realized MDA-MB-231, HeLa and C6 cells derby imaging [28]. QDs fluorescent probes will have very promising application prospects based on aptamers and peptide ligands. TfR has been reported to be over-expressed on some tumor cells, about 100-fold more than that on normal cells [29]. Thus TfR is one of the ideal markers in early diagnoses of some cancers. However, few studies using QDs probes for targeted delivery to cancer cells based on aptamer and peptide specific to transferrin receptors have been reported. In this paper, two different sequences, aptamer GS24 and peptide T7 specific to TfR, were chosen, and their quantum dots conjugates QD-GS24 and QD-T7 were prepared. GS24, a DNA aptamer, contains 64 nucleotides by complementary base-pairing in chain to form a certain space structure, which can specially bind to the extracellular domain of mouse TfR (mTfR-ECD) [30]. T7 a short peptide contains

2. Experimentation 2.1. Materials and reagents CdSe/ZnS QDs were synthesized in our lab. Dulbecco’s modified Eagle medium (DMEM), reduced serum medium (Opti-MEM), trypsin and fetal bovine serum (FBS) were purchased from Gibco. Penicillin, streptomycin, dimethylsulfoxide (DMSO), 3-(4, 5-Dimethylthiazol-2-yl)2, 5-diphenyltetrazolium bromide (MTT), transferrin of human and mouse (hTf and mTf), mercaptoacetic acid (MAA), 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and reduced glutathione (reduced GSH) were obtained from Sigma-Aldrich. Sulfosuccinimidyl-4-(Nmaleimidomethyl) cyclohexane-1-carboxylate (Sulfo-SMCC) was purchased from Thermo Scientific. The DNA aptamer of GS24 with the sequence 50 -NH2 -spacer GAATTCCGCGTGTGCACACGGTCACAGTTAGTATCGCTACGTT CTTTGGTAGTCCGTTCGGGAT-30 containing a 50 -amino group attached by a hexaethylene glycol spacer and a GS24 mutant (GS24mt) with the sequence 50 -NH2 spacer GCCATTGCCATTGCCATTGCCATTGCCATTGCC ATTGCCATTGCCATTGCCATTG-30 were custom synthesized by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd (Shanghai, China). T7 with a cysteine on the N-terminal (cys-HAIYPRH, cys-T7) was synthesized by ChinaPeptides Co., Ltd and a T7 mutant with a cysteine on the N-terminal (cys-GSDVEDGS, cys-T7mt) was synthesized by GL Biochem (Shanghai) Ltd. All other materials and reagents were of analytical grade. 2.2. Preparation of water-soluble quantum dots Oil-soluble CdSe/ZnS core–shell QDs with emission maxima centered at 625 nm and 578 nm were synthesized and made hydrophilic by ligand exchange with MAA and reduced GSH respectively [15, 32]. The preparation of MAA capped QDs (625 nm) was as follows: 1 ml of oil-soluble QDs (dissolved in CH3 Cl) were centrifuged to remove impurities and supernatant washed three times with excess methanol to remove CH3 Cl and TOPO. Then QDs were dispersed in 1 ml of dimethyl formamide (DMF), followed by the addition 2


M-Z Zhang et al

of 1 ml of MAA. After incubating overnight, the mixture was centrifuged to remove precipitates. The supernatant was mixed with 700 µl of tetrahydrofuran and 300 µl of NaOH (1 mol l−1 ). Then the mixture was centrifuged and the resulting red precipitates were MAA modified water-soluble QDs (QD-MAA). Finally, the QD-MAA were dissolved in 0.01 M PBS and stored at 4 ◦ C. GSH- modified QDs (578 nm) were prepared as follows: 1 ml of oil-soluble QDs (dissolved in CH3 Cl) were centrifuged to remove impurities and 250 mg of reduced GSH powder was added to the supernatant. After incubating overnight, 100 µl of NaOH (1 mol l−1 ) and 400 µl of deionized water were added to transfer all particles to the water phase. The water-soluble QDs were separated from the chloroform layer by centrifugation for 5 min. Excess GSH was removed by precipitation steps using acetone. The resulting QD-GSH were dissolved in 0.01 M PBS and stored at 4 ◦ C. The concentrations of QDs were measured according to a previous report [33].

conjugates of QD-GS24 and QD-T7 were determined by a Nano ZS90 (Malvern, UK) according to a dynamic light scattering (DLS) technique at 25 ◦ C. CE analyses were carried out on a home-built system. A capillary was fixed on the detecting platform of an inverted fluorescence microscope and a 100 W mercury lamp was used as excitation source. The detected QDs fluorescence was recorded by a fiber optic spectrometer QE65000. The capillary was 60 cm long with an effective length of 35 cm from the inlet to the detection window and the inner diameter (ID) was 75 µm. Hydrodynamic injection was performed by siphoning at 15 cm height differences for 15 s at the anode. The electrophoresis buffer was Na2 B4 O7 (25 mM, pH 9.2). 2.5. Cell culture HeLa (human cervical cancer cell line) and B16 (mouse malignant melanoma cell line) (both kindly provided by Professor Zhi-Hong Zhang at WNLO) cells were cultured in complete growth medium supplemented with 100 U ml−1 penicillin, 100 µg ml−1 streptomycin and 10% (v/v) heat-inactivated fetal bovine serum (FBS). Cells were grown in a culture flask and incubated at 37 ◦ C under 5% CO2 atmosphere. When they had reached about 80% confluence, cells were treated with trypsin (2.5%) for further culture.

2.3. Preparation of QD-aptamer and QD-peptide probes To obtain QD-GS24 probes, amine terminated aptamer GS24 was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.4) at given concentrations. 80 µl of QD-MAA in an EP tube was mixed with 10 µl EDC (5 mg ml−1 ) thoroughly. Then different amounts of aptamer solution were added, followed by adding deionized water to keep the final volume at 300 µl. The solution was incubated for 2 h at room temperature. Finally, the solution was ultra-filtrated (50 000 MWCO, 1.5 ml, Millipore) to remove redundant aptamer. The obtained conjugates of QD-GS24 were dissolved in PBS and stored at 4 ◦ C. In the control group, QD-GS24mt followed the same method. To obtain the QD-T7 probe, 100 µl of QD-GSH was added to 400 µl of cross-linking buffer (100 mM Na3 PO4 , 150 mM NaCl, 5 mM EDTA, pH 7.2) in an EP tube and mixed uniformly, then 20 µl of cross-linker sulfo-SMCC (2 mg ml−1 ) was added. After shaking at room temperature for 30 min, the cross-linker was removed using a desalting column (ZebaTM Desalt Spin Columns, 2 ml, Thermo Scientific) equilibrated with cross-linking buffer. Coupling T7 peptide was conjugated to QDs by mixing 20 µl of T7 peptide (1 mg ml−1 ) with the maleimide-activated QDs in cross-linking buffer and incubated at 4 ◦ C overnight. Afterwards, the solution was ultra-filtrated (30 000 MWCO, 1.5 ml, Millipore) to remove redundant peptide T7. The obtained conjugates of QD-T7 were dissolved in PBS and stored at 4 ◦ C. In the above reaction, the molar ratio of QD-GSH to cross-linker and cys-T7 was 1:10:5. The same procedure was used to conjugate QD-GSH with cys-T7mt and yield QD-T7mt as a control [34, 35].

2.6. Cell imaging For cell fluorescence imaging, HeLa and B16 cells were first cultured for 24 h in 6-well cell culture plates (Corning Incorporated, USA) at a density of about 2 × 104 cells per well. Then the cells were treated with probes and incubated at 37 ◦ C for 1 h, and the cells were washed three times with PBS. In the competitive group, Tf was added with corresponding probes. Fluorescence images were captured by a converted fluorescence microscope (Olympus IX71, Japan) and color CCD (Pixera Penguin 150CL, California). For further confocal laser scanning fluorescence imaging, HeLa and B16 cells were first seeded in glass culture dishes (Met-Tek, USA) at a density of about 1 × 104 cells per well. After 24 h incubation, the cells were treated with probes and incubated at 37 ◦ C for 1 h. Then the cells were washed with PBS three times, consecutively, fixed with 4% formaldehyde solution for 10 min and washed with PBS three times again. In the competitive group, Tf was added with corresponding probes. The confocal fluorescence images were obtained with a confocal microscope (Olympus FluoView FV1000, Japan) using a 60 × water-immersion objective. Excitation and filters were as follows: QD-GS24, its control group and competitive group (with mTf), 488 nm excitation, emission BP 600–650 nm filter; QD-T7, its control group and competitive group (with hTf), 488 nm excitation, emission BP 560–600 nm filter.

2.4. Characterization of probes For spectra analyses, the fluorescence spectra of two different oil-soluble QDs, QD-MAA, QD-GSH, QD-GS24 and QD-T7 were measured by a fiber optic spectrometer QE65000 (Ocean Optics, USA). For hydrodynamic diameter (HD) analyses, the size distribution of QD-MAA and QD-GSH and their

2.7. Flow cytometry analysis For flow cytometry analysis, HeLa and B16 cells were first cultured for 24 h in 6-well cell culture plates (Corning 3


M-Z Zhang et al

dissolved with 150 µl of dimethylsulfoxide (DMSO). The absorbance at 490 nm was recorded with a micro-plate reader (BioTek ELX808IU, USA). The absorbance was directly correlated with cell quantity, and cell viability was calculated by assuming 100% viability in the control. Each well was performed in triplicate in 3 independent experiments for each cell line.

Incorporated, USA) at a density of about 2 × 104 cells per well, then the cells were incubated with probes at 37 ◦ C for 1 h. To investigate the effect of Tf, it was added to the medium together with corresponding probe. For B16 cells, the final concentration of mTf was 34 µM, and for HeLa cells the concentration of hTf was 50 µM, the final concentrations of probes were both 3.2 µM. Then the cells were washed three times with PBS and dissociated from 6-well plates with trypsin (2.5%). Finally, cells were suspended in PBS for use. Fluorescence analysis were performed by a flow cytometry instrument (FC500, Beckman Coulter) equipped with a 488 nm argon laser. A minimum of 104 cells of each sample was analyzed. To quantify the effects of different treatments on cellular fluorescence, the median of cell fluorescence distribution (X-mean) in the experiment was normalized to X-mean in the untreated control. Each experiment was performed in triplicate. The mean ± S.D. is indicated on the figures. A Students’ t test was used to confirm whether there was a significant statistical difference in cell fluorescence between experimental groups.

3. Results and discussion 3.1. Aptamer and peptide-coupled QDs The as-synthesized two kinds of core–shell QDs with different emission wavelengths (emission maximum at about 625 nm or 578 nm) and TOPO as surfactant can only be dispersed in non-polar organic solvents, such as chloroform and hexane. However, in order to be applied in biological applications QDs must be made water-soluble. One efficient approach involves replacing hydrophobic surface groups with hydrophilic ones (e.g. carboxyl or amino) by means of ligand exchange. QDs (emission maximum at 625 nm) were modified with MAA, a negatively-charged carboxy-terminated thiol. A cross-linker 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was used to conjugate QD-MAA with amine terminated aptamer GS24 to yield probes QD-GS24 (figure 1(A)). In addition, QD-MAA was conjugated with GS24mt to yield QD-GS24mt as a control in the same way. QDs (emission maximum at 578 nm) were modified with reduced GSH, a natural sulfhydryl compound, which can replace TOPO and result in water-dispersible QD-GSH with active amino groups at the surface. Sulfo succinimidyl-4-(Nmaleimidomethyl) cyclohexane-1-carboxylate (sulfo-SMCC) as a heterodimeric cross-linker was applied to conjugate QD-GSH with cys-T7 to obtain probe QD-T7 (figure 1(B)). Similarly, QD-GSH was conjugated with cys-T7mt to yield QD-T7mt as a control.

2.8. TEM of ultrathin sections of cells B16 and HeLa cells were incubated with probes of QD-GS24 and QD-T7 respectively for 1 h. After incubation, the medium containing the excess probes was removed and the cells were washed three times with PBS (0.1 M, pH 7.4). Primary fixation of the cells was carried out with 0.1 M PBS of 2.5% glutaraldehyde for 1 h at 4 ◦ C, then cells were detached from the 6-well plate by scraping and centrifuged (4 ◦ C, 2500 rpm, 20 min) to form compact pellets. After washing with PBS, the cells were stained with OsO4 (1%) for 1 h and washed again with PBS. Cells were then dehydrated at 4 ◦ C using a series of increasing concentrations of acetone (50%, 70%, 90%, 96%, and 100%), prior to being embedded in epoxy resin Epon812. After polymerization at 60 ◦ C for 48 h, ultrathin sections (60–80 nm) were cut with an ultramicrotome and placed on carbon-coated Cu grids. Finally, these grids were further enhanced with lead citrate and uranyl acetate. Electron micrographs of probes combined with cells were obtained with a FEI Tecnai G2 20 TEM at 200 kV.

3.2. Analysis of spectra, hydrodynamic diameter (HD) and capillary electrophoresis (CE) of probes Water-soluble QDs and their conjugates could disperse well in PBS buffer. After being conjugated with aptamer or peptide, the emission maxima of water-soluble QDs shifted slightly to red, as shown in figure S1 (supporting information available at stacks.iop.org/Nano/23/485104/mmedia). Emission of QDMAA shifted from 617 to 623 nm (supporting information, figure S1(A) available at stacks.iop.org/Nano/23/485104/ mmedia) and QD-GSH shifted from 577 to 580 nm (supporting information, figure S1(B) available at stacks.iop. org/Nano/23/485104/mmedia). DLS analysis showed that the HDs of QD-MAA, QD-GS24, QD-GSH and QD-T7 were 9.0 nm ± 0.2 nm, 14.5 nm ± 0.6 nm, 6.9 nm ± 0.8 nm and 8.5 nm ± 0.5 nm respectively (figure 2). This meant that aptamer and peptide had successfully linked to QDs. Meanwhile, it was found that the HD of QD-MAA increased by about 67% after being conjugated with aptamer GS24, and QD-GSH only increased by about 23% after being conjugated with peptide T7. The reason might be due to

2.9. MTT cell proliferation assay Cytotoxicities of the aptamer GS24, QD-MAA, QD-GS24 and the peptide T7, QD-GSH, QD-T7 were assessed by the MTT assay. Briefly, HeLa or B16 cells were grown in 96-well tissue culture plates (Corning Incorporated, USA) overnight in complete growth medium. Cells were then treated with a series of increasing concentrations of materials. For the assessment of chronic toxicity, materials were applied to cells and incubated for 24 h prior to assaying the number of viable cells. For the assessment of acute toxicity, the materials were cultured with the cells for 1 h and removed, and then cultured for 24 h again prior to assaying for cell viability. After incubation, 20 µl (5 mg ml−1 ) of MTT solution were added to each well and incubated for 4 h, then the medium was discarded, and the formazan-obtained was 4


M-Z Zhang et al

Figure 1. Schematic represents the conjugate of QDs with aptamer GS24 (A) and peptide T7 (B).

Figure 2. HDs changes of QDs conjugated with aptamer GS24 (A), and peptide T7 (B). (A): QD-MAA (a), QD-GS24 (b); (B): QD-GSH (a), QD-T7 (b).

Figure 3. CE of QDs conjugated with aptamer GS24 (A), and peptide T7 (B). (A): QD-MAA (a), 1:2 (QD-MAA/aptamer) (b), 1:5 (c) and 1:10 (d); (B): QD-GSH (a), QD-cross-linker (b) and QD-T7 when the ratio is 1:10:5 (QD-GSH/cross-linker/T7) (c). RF means relative fluorescence.

aptamer GS24 having a sequence of 64 bases, while peptide T7 only has 8 amino acids containing the cysteine at the end. Obviously the former has a thicker modified layer than the latter. CE was used to investigate the optimal

ratios of QDs to aptamer and peptide. As shown in figure 3, the pure QD-MAA was measured and only one electrophoresis peak appeared at about 484 s (figure 3(A), curve a). When the ratio was 1:2 (QD-MAA/aptamer), two 5


M-Z Zhang et al

Figure 4. Fluorescence images of QD-GS24 probe labeled B16 cells. (A): control QD-GS24mt; (B): QD-GS24; (C): QD-GS24 incubated with Tf (34 µM) together. 1: bright field; 2: fluorescence; 3: fluorescence spectra. Scale bar: 5 µm.

234 s appeared (figure 3(B), curve c). These results indicated that the QDs had completely conjugated with peptide T7 in this ratio.

electrophoresis peaks were observed at about 234 s and 471 s (figure 3(A), curve b), and the migration time of the latter was quite close to the pure QD-MAA, which should be caused by remnant QD-MAA. Compared with the pure QD-MAA, the former electrophoresis peak (234 s) appeared much earlier. It was speculated that it could be the electrophoresis peak of conjugate QD-GS24, because the probe surface charge changed when coupled with GS24. The relative magnitude of the electroendosmotic mobility and electrophoretic mobility determined the migration time and speed in CE. Thus the change of surface charge of QD-GS24 caused the change of electrophoretic mobility, and thus the speed is also changed. When the ratio increased to 1:5 (QD-MAA/aptamer), only one electrophoresis peak appeared, at about 226 s (figure 3(A), curve c). Continuing to increase the ratio to 1:10, still only one electrophoresis peak appeared in the same place (figure 3(A), curve d). These results showed that with the ratio of 1:5 (QD-MAA/GS24), QD-MAA had completely coupled with aptamer. Therefore, the optimal ratio of QD-MAA to aptamer was chosen as 1:5. In the same way, the optimal ratio of QD-GSH to peptide T7 was also investigated. The conjugate between QD-GSH and peptide was a two-step cross-linking reaction. The ratio was chosen as 1:10:5 (QD-GSH/cross-linker/peptide). For QD-GSH, only one electrophoresis peak appeared at about 372 s (figure 3(B), curve a). When conjugated with cross-linker, the electrophoresis peak appeared slightly earlier than pure QD-GSH, at about 357 s (figure 3(B), curve b). And after being coupled with peptide T7, only one peak at about

3.3. Fluorescence imaging GS24, a DNA aptamer selected by a procedure known as SELEX can bind to the extracellular domain of mouse TfR (TfR-ECD) [30]. To investigate whether probes of QD-GS24 have specificity, mouse B16 cells over-expressing high-level mTfR were incubated with QD-GS24, and then the labeled effects of probes were observed using fluorescence imaging. Results showed that, after incubation with QD-GS24, obvious fluorescence of QDs could be seen on the membrane of B16 cells (figure 4(B)-2), indicating aptamer GS24 have specially bound to mTfR on B16 cells. The fluorescence spectra of the cells were also recorded at the same time, as shown in figure 4(B)-3, the maximum emission was at about 624 nm, in accordance with that of QD-GS24 (supporting information, figure S1(A) available at stacks.iop.org/Nano/23/ 485104/mmedia). In the control experiment, the sequence of GS24mt could not target mTfR and thus no fluorescence of QDs was observed on the membrane of the cells (figure 4(A)), only some punctate pattern of QDs fluorescence appeared, which might be caused by electrostatic adsorption between cells and probes or free probes that were not washed away completely. It has been shown that the binding site of GS24 was distinct from the mTf binding site [30], so it was speculated that GS24 would not compete with mTf and 6


M-Z Zhang et al

Figure 5. Fluorescence images of QD-T7 probe labeled HeLa cells. (A): control QD-T7mt; (B): QD-T7; (C): QD-T7 incubated with Tf together. 1: bright field; 2: fluorescence; 3: fluorescence spectra. Scale bar: 5 µm.

the labeling of probes was not inhibited by mTf. To verify our hypothesis, in the presence of 34 µM mTf (amount to concentration of Tf in mouse serum) [30, 36], the labeling of QD-GS24 to B16 cells was investigated (figure 4(C)). Results showed that on the membrane of cells there still appeared QDs fluorescence and labeling effects were similar to the condition in the absence of Tf. In the close to physiological environment, probes QD-GS24 realized labeling of target cells successfully, and provided an experimental basis for its further use in vivo. The structure between mTfR and hTfR is different [37], whether GS24 could bind to human TfR or not was also investigated. The labeling of QD-GS24 to HeLa cells was showed in figure S2 (supporting information available at stacks.iop.org/Nano/23/485104/mmedia), no QDs fluorescence existed on the membrane of HeLa cells, suggesting QD-GS24 only had specific binding ability to mouse tumor cells. T7 is a short peptide screened by Engler et al through a phage display selection strategy capable of binding hTfR [31]. To investigate the specificity of probe QD-T7, it was incubated with HeLa cells which over-expressed a high level of hTfR, and then the labeling effects of cells were observed using fluorescence microscopy. Results have shown that, after incubation with QD-T7, obvious fluorescence of QDs could be seen on the surface of HeLa cells (figure 5(B)-2), indicating peptide T7 can specifically bind to hTfR on the surface of HeLa cells and the maximum emission at about 582 nm (figure 5(B)-3), in accordance with that of QD-T7 (supporting information, figure S2(B) available at stacks.iop.org/Nano/

23/485104/mmedia). In the control experiment, T7mt did not have specificity and could not target hTfR, so there was no obvious fluorescence of QDs on the membrane of HeLa cells (figure 5(A)). It has been shown that peptide T7 bound to a unique binding site and did not interfere with hTf binding [38], so it was speculated that T7 binding to hTfR should not compete with hTf. To verify this hypothesis, a competitive experiment was performed. QD-T7 was incubated with HeLa cells in the presence of 50 µM Tf (amounting to a concentration of Tf in human serum) [39] and the labeling effects were investigated (figure 5(C)). The results showed that there was still some fluorescence on the membrane of HeLa cells similar to that of Tf not being present. Probes QD-T7 also realized labeling target cells successfully in a close to physiological environment, and provided an experimental basis for its further use in vivo. The labeling effects of QD-T7 to B16 cells were also investigated (supporting information, figure S3 available at stacks.iop.org/Nano/23/485104/mmedia) and no QDs fluorescence appeared on the membrane of B16 cells, indicating probe QD-T7 only had specific binding ability to human tumor cells. 3.4. Flow cytometry From the results of figures 4 and 5, it was found that cell fluorescence in C-2 appeared brighter than those in B-2, which was an interesting phenomenon. In order to quantify cell fluorescence and demonstrate whether there was 7


M-Z Zhang et al

Figure 6. Flow cytometry to quantify fluorescence intensity of functional conjugates, mutant conjugates and conjugates in the presence of Tf. (A), B16 cells; (B), HeLa cells. 1, mutant conjugates; 2, functional conjugate without Tf; 3, functional conjugate with Tf (for QD-GS24, 34 µM of mTf was added together; for QD-T7, 50 µM of hTf was added).

a statistically significant difference in intensity between each experimental treatment or not, the labeling effect of cells was evaluated using FACS. As shown in figure 6, for B16 cells, the fluorescence intensity was 75.87 ± 3.28 normalized by untreated cells, when mTf was added together with QD-GS24 probes, the value was changed to 103.17 ± 4.01; for HeLa cells, the value of fluorescence intensity caused by probes QD-T7 was 42.84 ± 2.37 and 52.64 ± 2.85 with hTf presence or not (supporting information, figure S4 available at stacks.iop.org/Nano/23/485104/mmedia). The changes were statistically significant at p < 0.01. The mean reason may be that probes of QD-GS24 (or QD-T7) and transferrin (Tf) have different binding regions on transferrin receptors and endogenous Tf (in our experiment, Tf was added to the cells similar in concentration to the physiological level) and could promote the transportation of QD-GS24 or QD-T7 (without Tf, probes can also be internalized by transferrin-mediated internalization). These results were in accordance with our previous fluorescence imaging results.

(figure S6(B)-2 available at stacks.iop.org/Nano/23/485104/ mmedia), while the control QD-T7mt could not label HeLa cells (figure S6(A)-2 available at stacks.iop.org/Nano/23/ 485104/mmedia). In the presence of hTf (50 µM), the labeling effects of probe QD-T7 were similar with hTf absent (figure S6(C)-2 available at stacks.iop.org/Nano/23/485104/ mmedia). 3.6. Transmission electron microscopy TEM was used to observe the real distribution of probes in cells [40, 41]. QD-GS24 and QD-T7 were incubated with B16 cells and HeLa cells respectively for 1 h, and then they were fixed, dehydrated and embedded in epoxy resin. TEM of ultrathin sections of cells were obtained as shown in figure 7. Probes were clearly visible as higher-contrast regions in the electron micrographs; most of them were attached on the surface of cells and some probes had been transported into the cytoplasm of cells through TfR-mediated endocytosis (marked by the white arrows).

3.5. Confocal imaging 3.7. Cytotoxicity of QD-GS24 and QD-T7 probes Confocal microscopy was further used to analysis the labeling effect of QD-GS24 and QD-T7 to B16 cells and HeLa cells respectively. As illustrated in figures S5 and S6 (available at stacks.iop.org/Nano/23/485104/mmedia), there existed obvious fluorescence of QD-GS24 on the membrane and cytoplasm of B16 (figure S5(B)-2 available at stacks.iop. org/Nano/23/485104/mmedia), while for the QD-GS24mt, no fluorescence could be seen on the membrane of cells (figure S5(A)-2 available at stacks.iop.org/Nano/23/485104/ mmedia). Similarly, in the presence of mTf (34 µM), GS24 could also bind to mTfR (figure S5(C)-2 available at stacks.iop.org/Nano/23/485104/mmedia). These results were consistent with our former fluorescence microcopy results. The same results also happened on QD-T7 probes. T7 specially bound to hTfR on the membrane of HeLa cells

The short-time (acute) and long-time (chronic) cytotoxicity of GS24, QD-MAA, QD-GS24 to B16 cells and T7, QD-GSH, QD-T7 to HeLa cells were assessed using a colorimetric tetrazolium-based cell proliferation assay (MTT) [42]. Acute cytotoxicity represents the influence of materials to cell viability in the delivery time course required for successful intracellular uptake [43], and chronic cytotoxicity represents the influence of materials to cell viability after they have been delivered into the cells [43, 44]. In acute conditions, cells were incubated with the materials for 1 h, then washed three times with PBS and subsequently cultured for 24 h. As shown in figure 8, no distinct inhibition was observed in cell viability for aptamer GS24 and peptide T7 (highest concentration 16 µM), while for QD-MAA (highest concentration 3.2 µM) 8


M-Z Zhang et al

Figure 7. Electron micrographs of B16 cells incubated with QD-GS24 probes (A) and HeLa cells incubated with QD-T7 probes (B) for 1 h.

Figure 8. Cytotoxicity of GS24, QD-MAA, QD-GS24 to B16 cells and T7, QD-GSH, QD-T7 to HeLa cells. Acute (A) and chronic (B) cytotoxicity of GS24, QD-MAA and QD-GS24; Acute (C) and chronic (D) cytotoxicity of T7, QD-GSH and QD-T7. For the QD-aptamer, QD-MAA and QD-T7, QD-GSH, the concentrations designate those of QDs, and the data represent the mean of triplicated measurements (n = 3).

and its conjugate QD-GS24, significant inhibition to cell proliferation was observed, as much as 30% of cell viability reduction in highest concentration (figure 8(A)). As to QD-GSH (highest concentration 3.2 µM) and its conjugate QD-T7 (figure 8(C)), the cytotoxicity was relatively smaller than QD-MAA and QD-GS24, respectively. The reason was mainly attributed to the fact that reduced GSH was a natural molecule in cells and had a higher biocompatibility than MAA, therefore, GSH-modified QDs and its conjugate had a smaller cytotoxicity. These results also confirmed that appropriate modification of QDs would reduce their cytotoxicity. In chronic conditions, along with the

concentration increase, the cytotoxicity of probes increased accordingly and showed an obvious dose dependence. The cytotoxicity of QD-GS24 and QD-T7 was relatively lower than QD-MAA and QD-GSH respectively, suggesting GS24 and T7 play important roles in reducing the cytotoxicity of QDs (figures 8(B) and (D)). In general, the effect of QD-GS24 and QD-T7 to cell viability were still obvious. Results of cytotoxicity suggested that in order to take full advantage of the unique optical properties of quantum dots, strategies (such as appropriate modification of QDs) to reduce the cytotoxicity become the foremost issue. 9


M-Z Zhang et al

4. Conclusions

[8] Michalet X, Pinaud F F, Bentolila L A, Tsay J M, Doose S, Li J J, Sundaresan G, Wu A M, Gambhir S S and Weiss S 2005 Quantum dots for live cells, in vivo imaging, and diagnostics Science 307 538–44 [9] Nie S M, Gao X H, Yang L L, Petros J A, Marshal F F and Simons J W 2005 in vivo molecular and cellular imaging with quantum dots Curr. Opin. Biotechnol. 16 63–72 [10] Bentolila L A, Ebenstein Y and Weiss S 2009 Quantum dots for in vivo small-animal imaging J. Nucl. Med. 50 493–6 [11] Gao J H, Chen K, Xie R G, Xie J, Yan Y J, Cheng Z, Peng X G and Chen X Y 2010 In vivo tumor-targeted fluorescence imaging using near-infrared non-cadmium quantum dots Bioconjug. Chem. 21 604–9 [12] Wang J H, Wang H Q, Li Y Q, Zhang H L, Li X Q, Hua X F, Cao Y C, Huang Z L and Zhao Y D 2008 Modification of CdTe quantum dots as temperature-insensitive bioprobes Talanta 74 724–9 [13] Song R, Lee J, Choi Y, Kim K, Hong S, Park H Y, Lee T and Cheon G J 2010 Characterization and cancer cell specific binding properties of anti-EGFR antibody conjugated quantum dots Bioconjug. Chem. 21 940–6 [14] Lee S, Park J W, Park A Y, Yu N K, Lee S H and Kaang B K 2010 Detection of TrkB receptors distributed in cultured hippocampal neurons through bioconjugation between highly luminescent (quantum dot-neutravidin) and (biotinylated anti-TrkB antibody) on neurons by combined atomic force microscope and confocal laser scanning microscope Bioconjug. Chem. 21 597–603 [15] Tiwari D K, Tanaka S-I, Inouye Y, Yoshizawa K, Watanabe T M and Jin T 2009 Synthesis and characterization of anti-HER2 antibody conjugated CdSe/CdZnS quantum dots for fluorescence imaging of breast cancer cells Sensors 9 9332–54 [16] Jayasena S D 1999 Aptamers: an emerging class of molecules that rival antibodies in diagnostics Clin. Chem. 45 1628–50 [17] Lee J O, So H M, Jeon E K, Chang H, Won K and Kim Y H 2008 Aptamers as molecular recognition elements for electrical nanobiosensors Anal. Bioanal. Chem. 390 1023–32 [18] Kang W J, Chae J R, Cho Y L, Lee J D and Kim S 2009 Multiplex imaging of single tumor cells using quantum-dot-conjugated aptamers Small 5 2519–22 [19] Farokhzad O C, Jon S, Khademhosseini A, Tran T N, Lavan D A and Langer R 2004 Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells Cancer Res. 64 7668–72 [20] Dwarakanath S, Bruno J G, Shastry A, Phillips T, John A A, Kumar A and Stephenson L D 2004 Quantum dot-antibody and aptamer conjugates shift fluorescence upon binding bacteria Biochem. Biophys. Res. Commun. 325 739–43 [21] Savla R, Taratula O, Garbuzenko O and Minko T 2011 Tumor targeted quantum dot-mucin 1 aptamer-doxorubicin conjugate for imaging and treatment of cancer J. Control. Release 153 16–22 [22] Tuerk C and Gold L 1990 Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase Science 249 505–10 [23] Chu T C, Shieh F, Lavery L A, Levy M, Richards-Kortum R, Korgel B A and Ellington A D 2006 Labeling tumor cells with fluorescent nanocrystal-aptamer bioconjugates Biosens. Bioelectron. 21 1859–66 [24] Chen X C, Deng Y L, Lin Y, Pang D W, Qing H, Qu F and Xie H Y 2008 Quantum dot-labeled aptamer nanoprobes specifically targeting glioma cells Nanotechnology 19 235105 [25] Elayadi A N, Samli K N, Prudkin L, Liu Y H, Bian A, Xie X J, Wistuba I I, Roth J A, McGuire M J and Brown K C 2007

With advantages of lack of immunogenicity, small size, ease of synthesis and similar targeting ability to antibodies, aptamers and peptides have been quickly emerging as powerful classes of ligands for applications in optical molecular imaging. In this study, two kinds of different quantum dots fluorescence probes (QD-GS24 and QD-T7) based on aptamer and peptide respectively were prepared and used for cell labeling. Fluorescence and confocal imaging results revealed that QD-GS24 and QD-T7 probes could label B16 cells, and quantitative flow cytometry analysis indicated the transportation of QD-GS24 or QD-T7 into cells could be promoted by corresponding free transferrin (Tf). TEM confirmed the uptake of fluorescent probes in cells and the effective intracellular delivery. MTT experimental results suggested that modification with aptamers and peptides could effectively reduce the cytotoxicity of QDs. This work provides an important reference to prepare quantum dots fluorescent probes using ‘non-antibody’ target molecules, along with a rapid expansion of aptamer selected and peptide screened technology, and has value in guiding the development of fluorescence probes with no ‘interference’.

Acknowledgments This work was supported by the National Key Technology R&D Program (2012BAI23B02), National Natural Science Foundation of China (Grant No. 81071229, 81000661, 81271616), Specialized Research Fund for the Doctoral Program of Higher Education of China (No. 20100142110002), the Fundamental Research Funds for the Central Universities (Hust, 2012TS016), and the Open Research Fund of State Key Laboratory of Bioelectronics, Southeast University. We also thank the Analytical and Testing Center (HUST) for the help of measurement. Professor Zhi-Hong Zhang at WNLO kindly provided the cells.

References [1] Gambhir S S 2002 Molecular imaging of cancer with positron emission tomography Nature Rev. Cancer 2 683–93 [2] van Zandvoort M A M J, Douma K, Prinzen L, Slaaf D W, Reutelingsperger C P M, Biessen E A L, Hackeng T M and Post M J 2009 Nanoparticles for optical molecular imaging of atherosclerosis Small 5 544–57 [3] Hasan T, Chang S K, Rizvi I and Solban N 2008 in vivo optical molecular imaging of vascular endothelial growth factor for monitoring cancer treatment Clin. Cancer Res. 14 4146–53 [4] Nuiachristos V 2006 Fluorescence molecular imaging Annu. Rev. Biomed. Eng. 8 1–33 [5] Zhao Y D, Liu T C, Wang J H, Wang H Q, Zhang H L, Zhang Z H, Hua X F, Cao Y C and Luo Q M 2007 Bioconjugate recognition molecules to quantum dots as tumor probes J. Biomed. Mater. Res. A 83A 1209–16 [6] Jaiswal J K, Mattoussi H, Mauro J M and Simon S M 2003 Long-term multiple color imaging of live cells using quantum dot bioconjugates Nature Biotechnol. 21 47–51 [7] Yong K T, Ding H, Roy I, Law W C, Bergey E J, Maitra A and Prasad P N 2009 Imaging pancreatic cancer using bioconjugated InP quantum dots ACS Nano 3 502–10 10


[26]

[27]

[28]

[29]

[30] [31]

[32]

[33]

[34]

M-Z Zhang et al

[35] Neundorf I, Walther C, Meyer K and Rennert R 2008 Quantum dot-carrier peptide conjugates suitable for imaging and delivery applications Bioconjug. Chem. 19 2346–56 [36] Parton R G and Richards A A 2003 Lipid rafts and caveolae as portals for endocytosis: new insights and common mechanisms Traffic 4 724–38 [37] Qian Z M, Li H Y, Sun H Z and Ho K 2002 Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway Pharmacol. Rev. 54 561–87 [38] Oh S, Kim B J, Singh N P, Lai H and Sasaki T 2009 Synthesis and anti-cancer activity of covalent conjugates of artemisinin and a transferrin-receptor targeting peptide Cancer Lett. 274 33–9 [39] Li H, Sadler P J and Sun H 1996 Unexpectedly strong binding of a large metal ion (Bi3+ ) to human serum transferrin J. Biol. Chem. 271 9483–9 [40] Brust M, Krpetic Z, Saleemi S, Prior I A, See V and Qureshi R 2011 Negotiation of intracellular membrane barriers by TAT-modified gold nanoparticles ACS Nano 5 5195–201 [41] Pujals S, Bastus N G, Pereiro E, Lopez-Iglesias C, Puntes V F, Kogan M J and Giralt E 2009 Shuttling gold nanoparticles into tumoral cells with an amphipathic proline-rich peptide ChemBioChem 10 1025–31 [42] Delehanty J B, Medintz I L, Pons T, Brunel F M, Dawson P E and Mattoussi H 2006 Self-assembled quantum dot-peptide bioconjugates for selective intracellular delivery Bioconjug. Chem. 17 920–7 [43] Lovric J, Bazzi H S, Cuie Y, Fortin G R, Winnik F M and Maysinger D 2005 Differences in subcellular distribution and toxicity of green and red emitting CdTe quantum dots J. Mol. Med. 83 377–85 [44] Wei Y, Jana N R, Tan S J and Ying J Y 2009 Surface coating directed cellular delivery of TAT-functionalized quantum dots Bioconjug. Chem. 20 1752–8

A peptide selected by biopanning identifies the integrin alphavbeta6 as a prognostic biomarker for nonsmall cell lung cancer Cancer Res. 67 5889–95 Oyama T, Rombel I T, Samli K N, Zhou X and Brown K C 2006 Isolation of multiple cell-binding ligands from different phage displayed-peptide libraries Biosens. Bioelectron. 21 1867–75 Gao J M, Huang G, Zhang C F, Li S Z, Khemtong C, Yang S G, Tian R H, Minna J D and Brown K C 2009 A novel strategy for surface modification of superparamagnetic iron oxide nanoparticles for lung cancer imaging J. Mater. Chem. 19 6367–72 Ko M H, Kim S, Kang W J, Lee J H, Kang H, Moon S H, Hwang do W, Ko H Y and Lee D S 2009 In vitro derby imaging of cancer biomarkers using quantum dots Small 5 1207–12 Jiang C, Han L A, Huang R Q, Liu S H and Huang S X 2010 Peptide-conjugated PAMAM for targeted doxorubicin delivery to transferrin receptor overexpressed tumors Mole. Pharmacol. 7 2156–65 Neufeld E F et al 2008 Aptamer-based endocytosis of a lysosomal enzyme Proc. Natl Acad. Sci. USA 105 15908–13 Engler J A, Lee J H, Collawn J F and Moore B A 2001 Receptor mediated uptake of peptides that bind the human transferrin receptor Eur. J. Biochem. 268 2004–12 Wang H Q, Li Y Q, Wang J H, Xu Q, Li X Q and Zhao Y D 2008 Influence of quantum dot’s quantum yield to chemiluminescent resonance energy transfer Anal. Chim. Acta 610 68–73 Peng X G, Yu W W, Qu L H and Guo W Z 2003 Experimental determination of the extinction coefficient of CdTe, CdSe, and CdS nanocrystals Chem. Mater. 15 2854–60 Cai W and Chen X 2008 Preparation of peptide-conjugated quantum dots for tumor vasculature-targeted imaging Nature Protoc. 3 89–96

11