The stems are usually pubescent, with serrate decussate leaves. The inflorescence is terminal with decussate flowers; the corolla can be purple, green, yellow.
Molecular Phylogeny for the Colombian species of páramo, for the genera Bartsia and Castilleja (Orobanchaceae)
Simon Uribe Convers
Director Santiago Madriñán Ph.D. Profesor Asociado Departamento de Ciencias Biológicas Universidad de los Andes Bogotá, Colombia
Codirector Sarah Mathews Ph.D. Pl, Sargent Fellow The Arnold Arboretum of Harvard University Cambridge, USA
Bogotá D.C., Diciembre 2008
Molecular Phylogeny for the Colombian species of páramo, for the genera Bartsia and Castilleja (Orobanchaceae) Introduction The plant family Orobanchaceae and its phylogeny have been studied broadly (Young et al. 1999, Wolfe et al. 2005, Bennett & Mathews 2006). The family has a cosmopolitan distribution but most of its genera are distributed in the Mediterranean, southern Africa, the Himalayas and western North America (Bennett & Mathews, 2006). The genera are mostly herbaceous with a great diversity in floral morphologies. Orobanchaceae, as it is currently defined (Young et al., 1999) includes all types of parasitism, ranging from the nonparasitic Lindenbergia Lehmann to facultative photosynthetic (hemiparasites) and nonphotosynthetic (holoparasites) genera and it is the largest parasitic family consisting of 89 genera and ca. 2047 species (Nickrent, 2006). As originally the family included only holoparasitic genera, but Olmstead et al. (2001) showed, based on the analysis of plastid sequences, that hemiparasitic genera of the Scrophulariaceae (Thieret, 1967) shared a monophyletic origin with the holoparasitic genera from Orobanchaceae. Parasitism in the family has evolved once (Young et al., 1999) and holoparasitsm has had several independent origins from hemiparasitic ancestors. Lindenbergia , the nonparasitic genus, is found to be the sister group to the parasitic genera (Young et al. 1999, Olmstead et al. 2001; Bennett and Mathews, 2006). This study will focus on the genera of Bartsia Linnaeus and Castilleja Mutis ex L.f. independently, both members of Orobanchaceae. Both genera are facultative
1
hemiparasites that are widely distributed. Bartsia is represented by eight species in Colombia and Castilleja by five (Luteyn, 1999). Wolfe et al. (2005) as well as Bennett and Mathews (2006), have included both genera in previous studies of Orobanchaceae. The genus Bartsia is named after the German physician Johann Bartsch in 1753 (Molau, 1990) and it is a noticeable element in the alpine flora from Europe, Africa and South America. It is represented by ca. 50 species, 45 of which are endemic to the Andes. All Bartsia species are herbs, and the majority are perennials. Normally the roots and lower parts are perennial whereas the aerial shoots die during winter or after fruit production (Molau, 1990). The stems are usually pubescent, with serrate decussate leaves. The inflorescence is terminal with decussate flowers; the corolla can be purple, green, yellow or white depending on the species. The fruits are dry capsules with many seeds per capsule (20-200). The genus was well studied morphologically by Ulf Molau in 1990 when he published a monograph in Opera Botanica, but there is no good phylogenetic study available. There has been a constant movement of species to and from the genus, especially between the genus Odontites Ludwig, and even the specie B. trixago L., included in this study, has from time to time been referred to a genus of its own (Molau, 1990). Here, we try to give a starting point for further phylogenetic analyses for this genus, which in our opinion is in need of a robust survey. Bartsia has been well studied at a morphological level on two occasions (Bentham 1846, Molau 1990), but a phylogenetic analysis of the genus has been lacking. Only B. alpina L., B. trixago L. and B. inaequalis Benth. have been included in previous phylogenetic studies.
2
The genus Castilleja, commonly known as paintbrushes and named after the Spanish botanist Domingo Castillejo in 1771, consists of approximately 180 species with a worldwide distribution. Most of them are herbaceous perennials (ca. 160 spp.) but there are also ca. 20 annuals species. The ability to change from annuals to perennials is believed to have evolved from an annual ancestor (Tank & Olmstead, 2008), contrary to the classical interpretation where annuals derive from perennial plants. Supposedly this change of strategy has been possible thanks to polyploidization events. Perennials have a greater chance of finding another individual with the same grade of polyploidization, thus making reproductive isolation less severe (Tank & Olmstead, 2008). The stems are usually pubescent, with alternate leaves, and red, yellow, purple or white flowers. The bracts are often brightly colored and are larger than the flowers (Britton & Brown, 1913). Castilleja produces contact organs called haustoria (Weber, 1985), with which it parasitizes the host’s roots. The dry weight of the host drops dramatically after some days of being parasitized (Malcom, 1966), it shows a clear loss in water and nutrients. While similar data for Bartsia are lacking, its hemiparasitic habit suggests that similar relationships with its hosts pertain. Castilleja is an emblematic plant in the western United States and it has been studied broadly. Polyploidy and hybridization are widespread in the genus and Heckard and colleagues made a series of biosystematic studies starting in the 1950’s and continuing through the 1970’s (Heckard, 1958; Heckard, 1968; Heckardand Chuang, 1977; Chuang and Heckard, 1993), and presented a revision of Castilleja and related genera (Chuang and Heckard, 1991). Mathews and Lavin (1998) collected data that refuted one of Heckard’s hypotheses of allopolyploid origin in Castilleja. Holmgren (1971, 1978) 3
presented a revision of a western North American species group (Holmgren, 1971) and characterized species of Panama and Costa Rica (Holmgren, 1978). Egger and Meinke (1999) and Egger (2002 a, b) have studied the genus at the taxonomical level identifying new and rare species in the northern coast of Oregon, USA, and Mexico, respectively. Recently, Tank and Olmstead (2008) studied the life history strategies of the subtribe Castillejineae, and how perennial species are shown to have an annual origin. Despite these advances in understanding the genus, South American Castilleja remain poorly known. This study serves as a starting point for further phylogenetic analyses of the genus Bartsia and infers the phylogenetic position of the Colombian species of Castilleja found in the páramos.
Materials and Methods
A total of 24 plant samples were collected from different páramos in Colombia. Within these samples, 10 corresponded to the genus Bartsia and 14 to the genus Castilleja. The samples were stored in single airtight bags filled with silica gel. Additionally, three samples of Bartsia and one of Castilleja were used from dried material and two sequences of Ecuadorian specimens of Bartsia were kindly shared by Jakub Těšitel (unpublished). For the study of Castilleja a total of 78 sequences were obtained from Genbank (Tank & Olmstead, 2008) belonging to the Castillejinae subtribe. A total of 10 sequences were obtained from Genbank for the study of Bartsia. A full list of origins of plant material is given in Table 1.
4
DNA Extraction Plant tissue was ground in 1.5 milliliter centrifuge tubes using a ceramic bead and sterile sand. DNA extraction was performed using DNAeasy Plant Mini Kit protocol (QIAGEN, Valencia, California, USA) following the manufacture’s instructions with minor modifications. Extracted DNA was stored at -20˚C. DNA Amplification One nuclear and two plastid markers were used for this survey. The entire internal transcribed spacer (ITS) region was amplified using the ITS5 and ITS4 primers (Baldwin, 1992). For the rps16 intron, the primers rps16F and rps16R2 (Oxelman et al., 1997) were used and the primers trn-c and trn-f (Taberlet et al. 1991) were used for the trnL/F region. Primer sequences are shown in table 2. The polymerase chain reaction (PCR) conditions were as following: ITS: 1) 94° (1’00’’); 2) 50° (1’00’’); 3) 72° (1’00’’); 4) go to #2 30×; 5) 72° (5’00’’); Chloroplast markers: 1) 94° (1’30’’); 2) 94° (30’’); 3) 54° (45’’); 4) 68° (2’00’’); go to #2 34×; 6) 72° (5’00’’). Final PCR products were purified using ExoSAP-IT (USB Corporation, Cleveland, Ohio, 44128, USA) with a prolonged time of 60 minutes at 37˚C and a second step of 20 minutes at 80˚C. DNA Cloning ITS products were gel-extracted using the Millipore, Ultrafree-DA DNA Gel Extraction Kit (from Agarose), and cloned using XL-1 Blue competent E. coli cells from the Topo TA Cloning Kit (Invitrogen, Carlsbad, CA, USA). Colonies were screened using PCR with T7 and M13r vector primers according to protocol described in the Topo TA manual, with the following PCR conditions: 1) 94° (30’’); 2) 57° (30’’); 3) 72° (2’30’’); 4) go to #2 30×; 5) 72° (4’00’’). Final products were then sequenced. 5
DNA Sequence PCR product for rps16 and trnL-F were sequenced directly using the primers that were used to generate the templates. ITS clones were sequenced using vector-based primers. Sequencing for all PCR products was performed on either an ABI 3100 or ABI3730XL according to manufacturer's recommended procedure at the Pennsylvania State University, USA. Phylogenetic Analysis Sequence editing and alignment for the three markers were performed using the software Geneious Pro (v3.8.5., Drummond et al. 2007). Each chromatogram was checked manually for errors or ambiguities. The sequences were aligned using the Muscle (Edgar, 2004) algorithm. A manual check of the alignments was carried out using the software MacClade (v. 4.08 Maddison & Maddison, 2005). Parsimony analyses were conducted to every sequence as implemented in PAUP* v.4.0b10 (Swofford, 2002). Heuristic searches were performed with 1000 replicates of stepwise random taxon addition and TBR branch swapping. One thousand replicates of nonparametric bootstrapping (Felsenstein, 1985) were performed to estimate support for individual clades. Maximum likelihood analyses were carried out using the RAxML algorithm (v.7.0.4, Stamatakis et al., 2008) on the web portal of Cipres (http://www.phylo.org/). For every matrix the general time-reversible model (Rodríguez et al., 1990) was selected using again the RAxML algorithm (v.7.0.4, Stamatakis et al., 2008). A 1000 replicate bootstrap was conducted on the same web portal.
6
A combined matrix from the three genes was created for each genus and a Bayesian inference analysis using MrBayes v.3.1.2 (Ronquist and Huelsenbeck, 2003) was performed. The evolutionary model for each sequence was found using the program Modeltest v.3.6 (Posada and Crandall, 1998). The combined matrix was partitioned after model selection with Modeltest (version 3.6) under the AIC criterion (Posada and Crandall, 1998), so each gene would be treated independently. Evolutionary models and Modeltest results are shown in table 3. Each analysis consisted of two runs of 2,000,000 generations from a random starting tree using the default heating values and four Markov chains, sampled every 100 generations. The initial 200,000 trees were discarded as burnin. The chains were checked for convergence using the program Tracer v.1.3 (Rambaut and Drummond, 2004). Branch support was evaluated using the posterior probabilities (PP) resulting from Bayesian inference analyses.
Results
Bartsia The localities for this study were chosen to represent the diversity of species in the genus (Table 4). Molau (1990) reported a high degree of sympatry with as many as 9 species of Bartsia flowering at the same time within one hectare. In this study, this sympatry was observed in two of the five localities chosen. In the locality of Chingaza B. laniflora, B. santolinifolia and B. ramosa were collected. In the locality of Sumapaz we found two species (B. laniflora and B. stricta) living together, whereas the localities of El Cocuy, Cruz Verde and El Tablazo had only one species each (B. santolinifolia, B. stricta and B. stricta, respectively). The samples were found in moist soils and normally in full exposure. All the páramos visited had similar ecological conditions.
7
ITS— The entire region of the internal transcribed spacer was sequenced, with a total of 786 bp. The alignment has 811 nucleotides sites, 73 being parsimony informative. Gaps within the matrix were treated as missing data. The Maximum Parsimony (MP) analysis resulted in 368 equally parsimonious trees each of 264 steps in length, the consistency index (CI), consistency index excluding uninformative characters (RC), homoplasy index (HI) and a retention index (RI) for these results and for the ones from other analyses are shown in table 5. The strict consensus tree and one of the most parsimonious trees are shown in figs. 1 and 2, respectively. Two or three copies of sequences for the internal transcribed spacer (ITS) were found for some of the species. Alignment of these copies was not straightforward and it yielded two groups differing at the beginning and at the end of the sequences. Fig. 2 and 3, show the formation of these two groups. B. laniflora Benth. (Chingaza) is one of these cases and interestingly both copies are nested in different groups, although with no support. The rest of the species, which have more than one copy, tend to cluster together or very close. These two clades however, collapse in the strict consensus tree. Maximum likelihood (ML) analysis generated one tree with a likelihood score of –ln 2486.241552 (Fig. 3), complete results for ML analyses are shown in Table 6. The strict consensus tree for the MP analysis has almost no resolution for this group. B. laticrenata Benth. and B. pedicularioides Benth., both Ecuadorian specimens, are clustered together with a strong support, as the sister group for the Colombian specimens. B. trixago and Parentucellia viscosa (L.) Caruel, form a clade that is sister to the group of the Ecuadorian and Colombian specimens. The two species are distributed in subtropical regions like Chile, Argentina and Uruguay. B. alpina does not cluster with any of the samples thus showing great divergence. Maximum Likelihood analysis gave similar results for the non-Colombian samples. B. pedicularioides and B. laticrenata remain together with a strong support and are again the sister group to the Colombian specimens. B. trixago and Parentucellia viscosa remain together being sister group of the tropical Bartsia, with strong support as well. Odontites serotina (Lambert) Dumort. is sister to the Bartsia-Parentucellia and B. alpina is in a polytomy at the base of the tree.
8
rps16— 869 bp of the rps16 intron were sequenced. The alignment has 903 nucleotide site of which 30 were parsimony informative. Gaps within the matrix were treated as missing data. Parsimony analysis resulted in two equally parsimonious trees each of 78 steps in length varying only in the position of B. laniflora (Chingaza). The strict consensus tree, and one of the most parsimonious trees are shown in Fig. 4 and 5. The resulting tree for the ML analysis (Fig. 6) has a likelihood score of –ln 1678.001133. MP analysis shows three individuals of B. santolinifolia (Kunth) Benth. forming a group with relatively good support. Another clade conformed by B. stricta (Kunth) Benth. (4 individuals), B. laniflora (Sumapaz) and B. ramosa Molau (Chingaza) is formed but it has a low bootstrap support of 61. The topology corresponding to the ML analysis corroborates the formation of the clade B. santolinifolia conformed by three individuals from the same locality. This clade it is well supported by bootstrap percentage. B. stricta (4 individuals), B. laniflora (Sumapaz) and B. ramosa (Chingaza) come together again in a clade including an individual of B. laniflora from the locality of Chingaza, but there is no bootstrap support. trnL/F— 837 bp of the trnL/F region was sequenced. The alignment has 946 nucleotide sites, of which 15 are parsimony informative. Gaps were treated as missing data. 40 equally parsimonious trees each of 49 steps in length were found by conducting the MP analysis. The strict consensus tree and one of the most parsimonious trees are shown in Fig. 7 and 8. The best resulting tree for the ML analysis (Fig. 9.) has a likelihood score of –ln 1595.191841. Again in the MP analysis, a clade forms with three individuals of B. santolinifolia from the locality of Cocuy, although this time with a lower support. Here, they are within a group including B. laniflora (Sumapaz) and B. santolinifolia (Chingaza)
9
but the support is also low. B. inaequalis is included in this analysis and it clusters among the other Bartsia. B. inaequalis is distributed in the northern division of the tropical Andes (Molau, 1990) in Venezuela, Colombia and Ecuador, but the exact origin of the sample is not certain. Maximum likelihood analysis corroborates the formation of the clade with B. santolinifolia (Cocuy), B. laniflora (Sumapaz) and B. santolinifolia (Chingaza) but with no support. On the other hand the clade in which the three B. santolinifolia individuals from Cocuy are nested it is well supported by bootstrap values. The best tree of the Bayesian inference analysis yielded from this analysis has a score of –ln 6021.49, and is shown with its corresponding posterior probabilities in Fig. 10. The clade containing the three B. santolinifolia individuals from Cocuy is well supported and again it is nested within a clade including B. laniflora (Sumapaz) and B. santolinifolia (Chingaza). B. inaequalis and B. laniflora (b, Chingaza) cluster together as sister group but with no support. B. laticrenata and B. pedicularioides come together again with a high support and are sister group of the Colombian samples. Odontites serotina (Dumort.) Corb., Lamourouxia rhinantifolia Kunth. and Brandisia hancei Hook.f. form a clade, which is the sister group to the Bartsia clade, except for B. alpina and B. trixago. Castilleja Castilleja divaricata was collected in three of the five localities (Cruz Verde, Sumapaz and Tablazo). It shares the same localities with C. integrifolia while C. fissifolia only shares the locality of Sumapaz and it was found alone in Chingaza and El Cocuy. The habitats were very similar ecologically, with small shrubs growing besides them. Castilleja was normally found growing besides Aragoa sp., Calamagrostis sp. and Espeletia all three major components of the páramo flora.
10
ITS— 687 bp were sequenced form the ITS. The matrix resulting from the alignment consisted of 722 nucleotide sites, of which 238 were parsimony informative. The gaps within the matrix were treated as missing data. The information for this marker is somewhat poor with only four ITS sequences for Colombian specimens due to problems in amplification processes. Multiple band were observed in agarose gel which might represent multiple copies for this marker, but we were unsuccessful in cloning them. 2639 equally parsimonious trees each with 981 steps in length were found using MP analysis. In addition to the strict consensus tree (Fig. 11), one of the most parsimonious trees is also shown in Fig. 12. Maximum Likelihod analysis yielded a best tree with a likelihood score of -ln 5937.423071. Maximum parsimony analysis gives as a result a well-supported clade for Castilleja, where Clevelandia beldingii (Greene) Greene and Ophiocephalus angustifolius Wiggins are nested. These results are in agreement with the ones presented by Tank and Olmstead (2008). Although representation of the Colombian specimens is low, a small group within the Castilleja clade was formed with a strong support. C. racemosa (Breedlove & Heckard) and C. conzattii Fernald are sister to this group. Triphysaria Fisch. & C. A. Mey. comes as sister group for the Castilleja clade, while Cordylanthus Nutt. ex Benth. is shown to have a paraphyletic origin. Maximum likelihood analysis corroborates the previous results offering more resolution within internal groups (Fig.13). rps16—877 bp. were sequenced for the rps16 intron. . The matrix resulting from the alignment consisted of 954 nucleotide sites, of which 68 were parsimony informative. The gaps were treated as missing. Parsimony analysis gave as a result 2011 equally parsimonious trees each with 241 steps in length. The likelihood score of the best tree 11
obtained for ML analysis is -ln2926.364056. The resulting trees are shown in Fig 14 and 15 respectively, as for one of the most parsimonious trees recovered (Fig. 16). The Colombian specimens form a group within the Castilleja group, although with a low support. Clevelandia beldingii and Ophiocephalus angustifolius appear like a clade nested in the Castilleja group. Again Triphysaria is found like the sister group of Castilleja and Cordylanthus was recovered with a paraphyletic origin. Maximum likelihood results corroborate these findings. The closely related Orthocarpus Nutt. forms a monophyletic group at the base of the group. trnL/F— 937 bp. were sequenced for the trnL/F. . The matrix resulting from the alignment consisted of 1123 nucleotide sites, of which 80 were parsimony informative. For the MP analysis 2011 equally parsimonious trees were found each with 237 steps in length. One of the most parsimonious trees and the strict consensus tree are shown in Figs. 17 and 18 respectively. As for the ML analysis the best resulting tree has a likelihood score of -ln 3217.246237 (Fig. 19). The results obtained by MP corroborate with the results from other markers, except for Triphysaria, which is nested within the Castilleja clade, but with a polytomic origin. The Colombian specimens cluster together this time with a higher support and again Clevelandia beldingii and Ophiocephalus angustifolius are within Castilleja. Cordylanthus has a paraphyletic origin. ML analysis shows similar results, giving additional support and resolution to some groups. The BI analysis conducted on the combined matrix resulted in one best tree with score of –ln 1.394E4 and it is shown in Fig. 20 with its posterior probability support for branches and clades. In this analysis the Colombian specimens cluster together with a very high support. Clevelandia beldingii and Ophiocephalus angustifolius are within Castilleja 12
forming a well-supported clade, with C. affinis Benth. subsp. affinis and C. plagiotoma A. Gray as sister group. Cordylanthus has a paraphyletic origin with a high support and Triphysaria is nested within Castilleja with strong support.
Discussion
Bartsia The markers used in this survey gave limited resolution. There are never the less, some results worth discussing. A clear clade comprising three individuals of B. santolinifolia was formed in almost every analysis. The three specimens were collected in the same locality (Table 1). B. alpina is always found outside the group of Colombian specimens, showing great divergence, consistent with its placement in a separate section of the genus (Molau, 1990). This species has a unique distribution in the genus, occurring in the Alps and in the arctic. B. trixago changes position in the phylogeny when BI analyses are performed. For this species only the ITS sequence was used and the absence of information might explain the conflicting results. As stated previously, there is no robust phylogenetic analysis of the genus Bartsia, however, Bennett and Mathews (2006) used four phytochrome A sequences of three species of Bartsia (B. alpina, B. crenata Molau and B. trixago) in a study inferring the phylogeny of Orobanchaceae. They found that Bartsia had a paraphyletic origin, with one of the sequences of B. alpina at the base of clade V, the other one at the top and B. crenata and B. trixago in the middle forming a group with Parentucellia viscosa, P. latifolia (L.) Caruel and Odontites himalayicus Pennell. In this study Bartsia has a paraphyletic origin too, although no strong statement can be made because of the restricted sampling. Also Odontites serotina and
13
Parentucellia viscosa, both species nested within Bartsia are commonly know in the southern region of South America as Red Bartsia and Yellow Bartsia, respectively, and they might be wrongly identified. Both species resemble Bartsia very well and a constant movement from species from both genera to Bartsia has been reported (Molau, 1990). Although with low support, Bayesian inference analysis (Fig. 10) shows that two groups are formed for the Colombian Bartsia with a clear distinction in the sampling locality. This is true for almost all the specimens with only a few exceptions. B. santolinifolia appears to have a monophyletic origin, where the majority of the individuals are from the locality of Cocuy. B. laticrenata and B. pedicularoides, both from Ecuador, form a strong clade which comes as the sister group of the Colombian specimens in ITS and BI analyses. More molecular markers should be implemented in further studies to try to resolve the relationship between the Colombian species. Castilleja The results found in this study corroborate those of Tank and Olmstead (2008), in which Orthocarpus has a monophyletic origin and is resolved as one of the basal lineages of the subtribe Castillejineae. Cordylanthus on the other hand has a paraphyletic origin, occurring in two well-supported groups . Triphysaria is resolved as the sister group of Castilleja in almost every analysis, and Clevelandia beldingii and Ophiocephalus angustifolius are nested within the Castilleja clade, which might indicate that these two species beong to the genus Castilleja. We will focus our analyses on the Colombian species, which are new for these results. A supported clade comprising the Colombian species of Castilleja was obtained with every marker, although the markers gave little resolution within the clade, showing a high 14
similarity between the sequences. C. fissifolia L.f. and C. integrifolia L.f. are predominant in the Colombian páramos (Mark Egger, personal communication) and the majority of the sequences obtained are of these species. Two individuals of C. fissifolia collected in the locality of Cocuy and an individual of C. divaricata from El Tablazo locality, form a basal clade within the Colombian specimens with a high posterior probability in the Bayesian analysis. The individual of C. divaricata from El Tablazo changes position in the strict consensus tree for the trnL/F region, and it is nested in a polytomy with the rest of specimens. The individuals of C. fissifolia remain basal however. A geographical pattern can be found for some of the sequences used in this study. An individual of C. divaricata and one of C. integrifolia both from the locality of Sumapaz, cluster together in the trees of ML and one of the most parsimonious trees for the rps16 intron, but only with bootstrap support in the latter. This similarities between different species from the same locality, might be suggesting that individuals are more similar between them when they are from the same locality, but it is too soon to support this with the geographically formed groups and further studies and extensive sampling are needed. Sadly it was impossible to obtain more sequences for the ITS marker due to cloning and amplification problems and only four are available for this analysis. Two copies of this marker were found for C. integrifolia from the Tablazo locality, and the BI analysis nested them in different groups within the Colombian clade. The genus Triphysaria was recovered as a well-supported group, sister to the Castilleja clade (Tank and Olmstead, 2008). This position was evident in all analyses but in the one using the trnL-F region as a marker, where it is nested within the Castilleja.
15
Conclusion
The genus Bartsia with ca. 45 endemic species from the Andes is a challenging but rewarding genus to study. As previously stated, this genus needs a robust phylogenetic analysis to help resolve the incongruence found in morphological studies, due to their similar appearance as herbarium specimens, and to support with molecular data the already established clades. New markers should be tried on the genus to be able to obtain a greater resolution at the species level. A greater sampling including specimens from different and more distantly located localities will help to establish whether there is a geographical pattern in the phylogeny of the genus. As for the genus Castilleja, although very well studied in Central and North America, a good sampling from the South American species followed by a robust phylogenetic analysis is needed. An interesting question to discuss in future studies would be the appearance and the biogeography for the genus in the Andes. Being a typically montane genus one could expect from it to have colonized the Andes not earlier than 3 MYA, time when the mountains started to rise. This is also true for the genus Bartsia. The low variability found in the markers in both genera can be the result of a rapid speciation, which started not earlier than the rise of the Andes. This will coincide with the Quaternary glacial cycles when drastic changes in the climate occurred. The cold and dry weather would make the populations decrease and isolate from each other, making it a perfect environment for speciation. Then with the hotter and more humid climate following a glacial period, populations would grow and overlap making it possible for species to cross, and then it would be followed by a new glacial period. This has been
16
reported for Valeriana (Bell and Donoghue, 2005) and Lupinus (Aïnouche et al., 2004, Hughes and Eastwood, 2006). While it is too soon to state that Bartsia and Castilleja went through the same process, it will be interesting to test the hypothesis that their evolution has followed a similar pattern.
References
Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: An example from the Compositae. Molecular Phylogenetics and Evolution 1: 3-16. Bennett, J. R. and Mathews, S. 2006. Phylogeny of The Parasitic Plant Family Orobanchaceae Inferred From Phytochrome A1. American Journal of Botany 93(7): 1039–1051. Bentham, G. 1846. Scrophulariaceae. In A. DeCandolle [ed.], Prodromus 10: 180–586. Victorius Masson, Paris, France. Britton, N. L. and Brown, A. 1913. An Illustrated Flora Of The Northern United States, Canada And The British Possessions Vol3. Charles Scribner's Sons, USA. Chuang, T. I., and Heckard, L. R. 1993. Chromosome numbers of neotropical Castilleja (Scrophulariaceae, tribe Pediculareae) and their taxonomic implications. Annals of the Missouri Botanical Garden 80: 974-986.
17
Drummond, A. J., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., StonesHavas, S., Thierer, T., Wilson, A. (2007). Geneious v3.8, Available from http://www.geneious.com. Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5), 1792-97. Farris, J. S., Kallersjo M., Kluge A. G., and Bult C. 1994. Testing significance of incongruence. Cladistics 10: 315-319.2 Felsenstein, J. 1985. Confidence limits on phylogenies - an approach using the bootstrap. Evolution 39: 783-791. Heckard, L. R. 1958. Documented chromosome numbers in plants. Madroño 14: 237. ______. 1968. Chromosome numbers and polyploidy in Castilleja (Scrophulariaceae). Brittonia 20: 212-226. Heckard, L. R., and Chuang T. I. 1977. Chromosome numbers, polyploidy, and hybridization in Castilleja (Scrophulariaceae) of the Great Basin and Rocky Mountains. Brittonia 29: 159-172. Hughes, C and Eastwood, R. 2006. Island radiation on a continental scale: Exceptional rates of plant diversification after uplift of the Andes. Proceedings of the National Academy of Sciences of the United States of America 103: 10334-10339.
18
Luteyn, J. L. 1999. Páramos, a checklist of plant diversity geographical distribution and botanical literature. Memoirs of The New York Botanical Garden vol. 84, The New York Botanical Garden Press, New York. Maddison, W. P. and Maddison, D. R. 2005. MacClade, ver. 4.08: analysis of phylogeny and character evolution. Sinauer, Sunderland. Malcolm, W. M. 1966. Root Parasitism of Castilleja coccinea. Ecology 47: 180–186. Molau, U. 1990. The genus Bartsia (Scrophulariaceae-Rhinanthoideae). Opera Botanica 102: 1-99. Nickrent, D. L. 2006. The parasitic plant connection: parasitic plant genera. Department of Plant Biology, Southern Illinois University, Carbondale, Illinois, USA. Website http://www.parasiticplants.siu.edu/ListParasites.html (accessed November 29, 2008). Olmstead, R. G., dePamphilis C. W., Wolfe A. D., Young N. D., Elisons W. J., and Reeves P. A. 2001. Disintegration of the Scrophulariaceae. American Journal of Botany 88: 348-361. Oxelman, B., Liden M., and Berglund D. 1997. Chloroplast rps16 intron phylogeny of the tribe Sileneae (Caryophyllaceae). Plant Systematics and Evolution 206: 393-410. Posada, D., and Crandall, K. A. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817-818. Rambaut, A., and Drummond A. J. 2004. Tracer. Available at http://tree.bio.ed.ac.uk/software/. Institute of Evolutionary Biology, Edinburgh.
19
Rodríguez, F., Oliver J. L., Marín A. and Medina J. R. 1990. The general stochastic model of nucleotide substitution. Journal of Theoretical Biology 142: 485–502. Ronquist, F., and Huelsenbeck J. P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. Stamatakis A., Hoover P., Rougemont J. 2008. A Rapid Bootstrap Algorithm for the RAxML Web-Servers Systematic Biology, 75(5): 758-771. Swofford, D. L. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4. Sinauer, Sunderland, Massachusetts, USA. Taberlet, P., Gielly L., Pautou G., and Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109. 15 Tank, D. C. and Olmstead, R. G. 2008. From annuals to perennials: phylogeny of subtribe Castillejinae (Orobanchaceae). American Journal of Botany. 95:608-625 Thieret, J. W. 1967. Supraspecific classification in the Scrophulariaceae: A review. SIDA 3: 87-106. Weber, H. C. 1980. Zur Evolution des Parasitismus bei den Scrophulariaceae und Orobanchaceae. Plant Systematics and Evolution 136: 217–232. Weber, H. C. 1987. Evolution of the secondary haustoria to a primary haustorium in the parasitic Scrophulariaceae/Orobanchaceae. Plant Systematics and Evolution 156: 127– 131.
20
Wolfe, A. D. , Randle C. P., Liu, L. and Steiner, K. E. 2005. Phylogeny and Biogeography of Orobanchaceae. Folia Geobotánica 40: 115-134. Young, N. D., Steiner K. E., and dePamphilis C. W. 1999. The evolution of parasitism in Scrophulariaceae/Orobanchaceae: plastid gene sequences refute an evolutionary transition series. Annals of the Missouri Botanical Garden 86: 876-893.
21
Tables and Figures Table 1. Origins of plant material
Species Castilleja Mutis ex L.f. Subg. Castilleja Sect. Castilleja [29] Castilleja auriculata Eastw. var. auriculata C. integrifolia L.f. subsp. integrifolia C. integrifolia L.f. (2) C. integrifolia L.f. (9) C. integrifolia L.f. (13) C. integrifolia L.f. (14) C. integrifolia L.f. (20) C. integrifolia L.f. (21) C. fissifolia L.f. (15) C. fissifolia L.f. (17) C. fissifolia L.f. (27) C. fissifolia L.f. (28) C. divaricata Benth. (3) C. divaricata Benth. (11) C. divaricata Benth. (22) C. divaricata Benth. (25) C. linariifolia Benth. C. tenuiflora Benth. var. tenuiflora Subg. Colacus (Jeps.) T. I. Chuang & Heckard Sect. Oncorhynchus (Lehm.) T. I. Chuang & Heckard [16] Castilleja ambigua Hook. & Arn. subsp. ambigua C. attenuata (A. Gray) T. I. Chuang & Heckard C. brevistyla (Hoover) T. I. Chuang & Heckard C. campestris (Benth.) T. I. Chuang & Heckard subsp. campestris C. densiflora (Benth.) T. I. Chuang & Heckard subsp. densiflora C. exserta (A. Heller) T. I. Chuang & Heckard subsp. exserta C. lacera (Benth.) T. I. Chuang & Heckard C. lasiorhyncha (A. Gray) T. I. Chuang & Heckard C. lineariloba (Benth.) T. I. Chuang & Heckard C. rubicundula (Jeps.) T. I. Chuang & Heckard subsp. rubicundula C. tenuis (A. Heller) T. I. Chuang & Heckard Sect. Pilosae T. I. Chuang & Heckard [8] Castilleja arachnoidea Greenm. C. nana Eastw. C. pilosa Rydb. Subg. Euchroma Sect. Affines [2] Castilleja affinis Benth. subsp. affinis Sect. Euchroma (Nutt.) Benth. [30] Castilleja arvensis Cham. & Schltdl. C. conzattii Fernald C. nivibractea G. L. Nesom C. scorzonerifolia Kunth C. zempoaltepetlensis G. L. Nesom
ITS
GenBank accession number rps16
trnL-F
EF103715
EF103787
EF103865
EF103716
EF103789
EF103867
—
EF103788
EF103866
EF103714
EF103786
EF103864
Halse 4905 (WTU) Egger 550 (WTU) Egger 562 (WTU) Beardsley s.n. (WTU)
EF103686 EF103687 — EF103681
EF103752 EF103753 EF103754 EF103746
EF103830 EF103831 EF103832 EF103824
Egger 559 (WTU)
EF103689
EF103756
EF103834
Egger 623 (WTU)
EF103688
EF103755
EF103833
Egger 400 (WTU) Beardsley 98 – 27 (WTU) Egger 555 (WTU) Egger 570 (WTU)
EF103683 EF103684 — EF103685
EF103749 EF103750 EF103747 EF103751
EF103827 EF103828 EF103825 EF103829
Tank 01 – 13 (WTU)
EF103682
EF103748
EF103826
Tank 01 – 34 (WTU) Tank 01 – 48 (WTU) Colwell s.n. (WTU)
EF103691 — EF103690
EF103759 EF103758 EF103757
EF103837 EF103836 EF103835
Beardsley 98 – 48 (WTU)
EF103708
EF103779
EF103857
EF103698
EF103767
EF103845
EF103697
EF103766
EF103844
—
EF103774
EF103852
EF103696
EF103765
EF103843
EF103703
EF103773
EF103851
DNA voucher or source
Egger & Tank 1187 (WTU) Egger & Tank 1207 (WTU) Uribe 17 (Andes-H) Uribe 39 (Andes-H) Uribe 32 (Andes-H) Uribe 33 (Andes-H) Uribe 20 (Andes-H) Uribe 21 (Andes-H) Uribe 14 (Andes-H) Uribe 19 (Andes-H) Uribe 27 (Andes-H) CG-035 (Andes-H) Uribe 15 (Andes-H) Uribe 11 (Andes-H) Uribe 22 (Andes-H) Uribe 42 (Andes-H) Tank 01 – 49 (WTU) Egger & Tank 1197 (WTU)
Egger & Tank 1185 (WTU) Egger & Tank 1208 (WTU) Egger & Tank 1209 (WTU) Egger & Tank 1195 (WTU) Egger & Tank 1199 (WTU)
22
Sect. Hispidae [13] Castilleja chromosa A. Nelson C. hispida Benth. var. hispida C. parviflora Bong. C. peckiana Pennell C. peirsonii Eastw. Sect. Septentrionales [22] Castilleja elata Piper C. elmeri Fernald C. integra A. Gray var. integra C. lutescens (Greenm.) Rydb. C. miniata Douglas ex Hook. C. occidentalis Torr. C. septentrionalis Lindl.
Myers s.n. (WTU) Tank 01 – 2 (WTU) Olmstead 01 – 83 (WTU) Tank 01 – 29 (WTU) Tank 01 – 52 (WTU)
— EF103699 EF103701 EF103700 EF103702
EF103770 EF103768 EF103771 EF103769 EF103772
EF103848 EF103846 EF103849 EF103847 EF103850
Tank 01 – 37 (WTU) Olmstead 01 – 78 (WTU) Tank 01 – 58 (WTU) Myers s.n. (WTU) Colwell s.n (WTU) Colwell s.n . (WTU) Beardsley and Olmstead, 2002 (as C. sulphurea Rydb.)
EF103713 EF103709 EF103704 EF103711 EF103712 EF103710
EF103784 EF103780 EF103775 EF103782 EF103783 EF103781
EF103862 EF103858 EF103853 EF103860 EF103861 EF103859
AF478944
—
AF479008
—
EF103785
EF103863
EF103705
EF103776
EF103854
EF103707 EF103706
EF103778 EF103777
EF103856 EF103855
EF103680
EF103745
EF103823
EF103692 — EF103695
EF103761 EF103760 EF103764
EF103839 EF103838 EF103842
EF103694 EF103693
EF103763 EF103762
EF103841 EF103840
EF103723 —
EF103799 EF103802
EF103877 EF103880
— EF103724
EF103800 EF103801
EF103878 EF103879
EF103722 — — EF103721
EF103798 EF103795 EF103796 EF103797
EF103876 EF103873 EF103874 EF103875
EF103725
EF103803
EF103881
EF103717
EF103790
EF103868
EF103718
EF103791
EF103869
EF103719 EF103720
EF103792 EF103793
EF103870 EF103871
—
EF103794
EF103872
EF103726 EF103727 EF103728 EF103729
EF103804 EF103805 EF103806 EF103807
EF103882 EF103883 EF103884 EF103885
EF103730 EF103731 EF103732 EF103733
EF103808 EF103809 EF103810 EF103811
EF103886 EF103887 EF103888 EF103889
Sect. Stenanthae [1] Castilleja exilis A. Nelson Egger 763 (WTU) Sect. Viscidulae [11] Castilleja applegatei Fernald subsp. pinetorum RH 40 (WTU) (Fernald) T. I. Chuang & Heckard C. pruinosa Fernald Donahue 007 (WTU) C. xanthotricha Pennell Olmstead 00 – 39 (WTU) Subg. Gentrya (Breedlove & Heckard) T.I. Chuang & Heckard [1] Castilleja racemosa (Breedlove & Heckard) T. I. Chuang & Heckard Breedlove 19200 (JEPS) Subg. Pallescentes Sect . Pallescentes (Rydb.) T. I. Chuang & Heckard [6] Castilleja oresbia Greenm. Tank 01 – 27 (WTU) C. plagiotoma A. Gray Ertter 3430 (WTU) C. praeterita Heckard & Bacig. Tank 01 – 56 (WTU) Sect . Pallidae [17] Castilleja cusickii Greenm. Tank 01 – 28 (WTU) C. lemmonii A. Gray ank 01 – 51 (WTU) Cordylanthus Nutt. ex Benth. Subg. Cordylanthus Sect. Anisochelia A. Gray [6] Cordylanthus capitatus Nutt. ex Benth. Arnot 739 (WTU) C. eremicus (Coville & C. V. Morton) Munz J. L. 1781 (WTU) subsp. eremicus C. kingii S. Watson subsp. kingii Egger 712 (WTU) C. wrightii A. Gray subsp. wrightii Egger 748 (WTU) Sect. Cordylanthus [6] Cordylanthus pilosus A. Gray subsp. pilosus Ertter 3937 (WTU) C. pringlei A. Gray Smith 9395 (WTU) C. rigidus (Benth.) Jeps. subsp. rigidus Collum 408 (WTU) C. tenuis A. Gray subsp. tenuis Egger 862a (WTU) Sect. Ramosi (Pennell) T. I. Chuang & Heckard [1] Cordylanthus ramosus Nutt. ex Benth. Smith 3567 (WTU) Subg. Hemistegia (A. Gray) Jeps. [4] Cordylanthus maritimus Nutt. subsp. canescens (A. Gray) Tiehm 12253 (WTU) T. I. Chuang & Heckard C. mollis A. Gray subsp. hispidus (Pennell) Egger 860 (WTU) T. I. Chuang & Heckard C. palmatus (Ferris) J. F. Macbr. Egger 725 (WTU) C. tecopensis Munz & J. C. Roos Egger 588 (WTU) Subg. Dicranostegia (A .Gray) T. I. Chuang & Heckard [1] Cordylanthus orcuttianus A. Gray Egger 887b (WTU) Orthocarpus Nutt. [9] Orthocarpus tolmiei Hook. & Arn. subsp. tolmiei Egger 749 (WTU) O. luteus Nutt. Colwell s.n. (WTU) O. purpureo-albus A. Gray ex S. Watson Holmgren 7389 (WTU) O. bracteosus Benth. Olmstead 98 – 07 (WTU) Caplow & Beck 95072 O. barbatus J. S. Cotton (WTU) O. cuspidatus Greene subsp. cuspidatus Egger 637 (WTU) O. pachystachyus A. Gray Taylor 15721 (JEPS) O. imbricatus Torr. ex S. Watson Weber 12222 (WTU)
23
O. tenuifolius (Pursh) Benth. Triphysaria Fisch. & C. A. Mey. [5] Triphysaria eriantha (Benth.) T. I. Chuang & Heckard subsp. rosea (A. Gray) T. I. Chuang & Heckard T. floribunda (Benth.) T. I. Chuang & Heckard T. micrantha (Greene ex A. Heller) T. I. Chuang & Heckard T. pusilla (Benth.) T. I. Chuang & Heckard T. versicolor Fisch. & C.A. Mey. subsp. faucibarbata (A. Gray) T. I. Chuang & Heckard Clevelandia Greene [1] Clevelandia beldingii (Greene) Greene Ophiocephalus Wiggins [1] Ophiocephalus angustifolius Wiggins Seymeria Pursh Seymeria laciniata Standl. Pedicularis L. Pedicularis attolens A. Gray Lamourouxia Kunth Lamourouxia rhinanthifolia Kunth Bartsia L Sect. Bartsia (1) B. alpina L. Sect. Bellardia (3) B. trixago L. Sect. Orthocarpiflorae (4) B. laniflora Benth. (24) B. laniflora Benth. (26) B. laniflora Benth. (31) B. laticrenata Benth. B. santolinifolia (Kunth) Benth. (16) B. santolinifolia (Kunth) Benth. (18) B. santolinifolia (Kunth) Benth. (19) B. santolinifolia (Kunth) Benth. (29) Sect. Strictae (5) B. stricta (Kunth) Benth (1) B. stricta (Kunth) Benth (4) B. stricta (Kunth) Benth (12) B. stricta (Kunth) Benth (23) B. ramosa Molau (30) B. pedicularioides Benth. Sect. Laxae (6) B. inaequalis Benth. Brandisia Hook. f. & Thomson Brandisia hancei Hook. f. Euphrasia L. Euphrasia grandiflora Hochst. Lathraea L. Lathraea squamaria L. Odontites Ludw. Odontites serotina (Lambert) Dumort Parentucellia Viv. Parentucellia viscosa (L.) Caruel
Egger 960 (WTU)
EF103734
EF103812
EF103890
Egger 551 (WTU)
EF103735
EF103813
EF103891
Egger 1254 (WTU) Egger 953b (WTU)
EF103736 EF103737
EF103814 EF103815
EF103892 EF103893
Nass 5702 (WTU) Olmstead 541 (WTU)
EF103738 EF103739
EF103816 EF103817
EF103894 EF103895
Heckard 3958 (JEPS)
EF103740
EF103818
EF103896
Moran 15394 (JEPS)
EF103741
EF103819
EF103897
Egger & Tank 1201 (WTU)
EF103742
EF103820
EF103898
Tank 01 – 50 (WTU)
EF103743
EF103821
EF103899
Egger & Tank 1190 (WTU)
EF103744
EF103822
EF103900
Pending
AM503879
—
—
K. Steiner 3473 (CAS)
AY911211
—
—
V. Mirre & M. Popp 11112005-01
—
—
EU040319
Steward et al. 895 (S)
—
AJ609205
—
B. Goncalves 5157 (LISI)
—
—
EU040339
Pending
AM503877
—
—
YANG 0422
AY881141
—
AY881136
C. dePamphilis 90.89 [PAC]
AY911244
—
—
Uribe 25 (Andes-H) Uribe 22 (Andes-H) AD-016 (Andes-H) Pending Uribe 13 (Andes-H) Uribe 40 (Andes-H) Uribe 41 (Andes-H) CG-050 (Andes-H) Uribe 16c (Andes-H) Uribe 38 (Andes-H) Uribe 36 (Andes-H) Uribe 23a (Andes-H) CG-016 (Andes-H) Pending
24
Table 2.
Primer sequences and references for the primer pairs included in this study. All sequences in 5' to 3' orientation. Region
1
ITS
Genome
Nuclear
Primer sequences
ITS5 GGAAGTAAAAGTCGTAACAAGG
Reference
Baldwin (1992)
ITS4 TCCTCCGCTTATTGATATGC
2
rps16
Chloroplast
rps16F GTGGTAGAAAGCAACGTGCGACTT
Oxelman et al. (1997)
rps16R2 TCGGGATCGAACATCAATTGCAAC
3
trnL/F
Chloroplast
trnC CGAAATCGGTAGACGCTACG trnF ATTTGAACTGGTGACACGAG
25
Taberlet et al. (1991)
Table 3.
Evolutionary models found using Modeltest v.3.6 (Posada and Crandall, 1998) for Bayesian Inference analyses
Genus
Bartsia
Castilleja
Marker
Evolutionary Model
Rate Matrix
Proportion of
Gamma shape
(A-C, A-G,A-T,C-G,C-T,G-T)
invariable sites
parameter
ln Likelihood
ITS
SYM+G
1.02, 2.12, 0.81, 0.20, 4.57, 1.00
0
0.9221
-2488.95
rps16
GTR+G
1.63, 0.92, 0.27, 0.84, 1.24, 1,00
0
0.0833
-1678.01
trnL-F
GTR+I
0.32, 0.61, 0.24, 0.22, 0.72, 1.00
0.7859
-1595.1653
ITS
GTR+I+G
1.07, 1.54, 1.42, 0.28, 4.38, 1.00
0.2656
-5949.918
rps16
GTR+G
0.94, 0.90, 0.38, 0.57, 1.13, 1.00
0
0.5612
-2934.095
trnL-F
GTR+G
0.73, 0.64, 0.21, 0.35, 0.96, 1.00
0
0.4918
-3220.48
26
Table 4. Especies diversity for each locality Specie Bartsia laniflora Benth. B. ramosa Molau B. santolinifolia (Kunth) Benth. B. strcita (Kunth) Benth. Castilleja divaricata Benth. C. fissifolia L.f. C. integrifolia L.f.
Chingaza Present Present Present Absent Absent Absent Present
El Cocuy Absent Absent Present Absent Absent Absent Present
Locality Cruz Verde Absent Absent Absent Present Present Present Absent
27
Sumapaz Present Absent Absent Present Present Present Present
El Tablazo Absent Absent Absent Present Present Present Absent
Table 5.
Tree lenght (TL), Consistency Index (CI), Rescaled Consistency Index (RC), Homoplasy Index (HI), Retention Index (RI) and Parsimony Informative characters (PIC) for Maximum Parsimony analyses.
Genus
Marker
TL
CI
RC
Hi
RI
PIC
ITS
264
0.913
0.764
0.087
0.837
73
rps16
78
0.987
0.961
0.013
0.974
30
trnL-F
49
0.939
0.821
0.061
0.875
15
ITS
981
0.526
0.386
0.474
0.735
238
rps16
241
0.846
0.785
0.154
0.927
68
trnL-F
237
0.81
0.739
0.19
0.912
80
Bartsia
Castilleja
28
Table 6.
Genus
Bartsia
Castilleja
Summary of fixed parameter values used in maximum likelihood analyses
Nucleotide frequency
Rate Matrix
Proportion of
Gamma shape
(A,C,G,T)
(A-C, A-G,A-T,C-G,C-T,G-T)
invariable sites
parameter
ITS
0.23, 0.26, 0.27, 0.23
1.029, 2.132, 0.921, 0.182, 4.623, 1.000
0.030921
1.004
-2486.241552
rps16
0.33, 0.16, 0.19, 0.32
1.618, 0.948, 0.264, 0.851, 1.240, 1.000
0.744
1223.536
-1678.001133
trnL-F
0.34, 0.19, 0.18, 0.29
0.318, 0.603, 0.235, 0.218, 0.708, 1.000
0.796421
1432.026
-1595.191841
ITS
0.19, 0.32, 0.31, 0.18
0.998, 1.391, 1.667, 0.223, 4.494, 1.000
0.194584
0.543
-5937.423071
rps16
0.33, 0.17, 0.19, 0.31
0.945, 0.925, 0.404, 0.597, 1.162, 1.000
0.278818
1.206
-2926.364056
trnL-F
0.35, 0.18, 0.18, 0.29
0.746, 0.599, 0.233, 0.340, 1.024, 1.000
0.316227
1.197
-3217.246237
Marker
29
ln Likelihood
Fig. 1. Strict consensus of MP analysis for the ITS marker. Numbers on top of the branches indicate bootstrap percentages.
30
Fig. 2. One of the most parsimonious trees recovered from the MP analysis. Numbers on top of the branches indicate bootstrap percentages.
31
Fig. 3. Best tree found for the ITS marker using the Maximum Likelihood analysis. The numbers indicate bootstrap percentages.
32
Fig. 4. Strict consensus tree using MP analyses for the rps16 intron. Numbers along the branches are bootstrap percentages.
33
Fig. 5. One of the most parsimonious trees found for the intron rps16 using the maximum parsimony analysis. Bootstrap percentage if shown on top of the branches.
34
Fig. 6. Best tree of the ML analysis for the intron rps16, with bootstrap support on top of the branches.
35
Fig. 7. Tree resulting from the strict consensus of the MP analysis inferred from the trnL/F region. Bootstrap support is shown on top of the branches.
36
Fig. 8. On of the most parsimonious trees obtained for the trnL/F region using the MP analysis. Branches are supported by bootstrap percentages.
37
Fig. 9. Topology recovered for the trnL/F region based on maximum likelihood analysis. The numbers along the branches indicate bootstrap percentages.
38
Fig. 10. Result yielded from the Bayesian Inference analyses. A matrix containing three markers was used. Posterior probabilities are shown on top of the branches.
39
Fig. 11. Strict consensus tree for the ITS marker, using MP analyses. Bootstrap support is shown on top of the branches.
40
Fig. 12. One of the most parsimonious trees found using MP analyses for the ITS marker. The numbers on the branches indicate bootstrap percentages.
41
Fig. 13. Best result obtained after using ML analysis for the ITS marker. Bootstrap support for the branches is shown.
42
Fig. 14. Strict consensus tree using MP analysis for the rps16 intron. Bootstrap support is show on the branches.
43
Fig. 15. Maximum likelihood analysis. Best tree for the rps16 intron. Bootstrap percentages are shown along the branches.
44
Fig. 16. One of the most parsimonious trees recovered using MP analysis for the rps16 intron. On top of the branches percentages for bootstrap are shown.
45
Fig. 17. One of the most parsimonious trees recovered for the trnL/F region using MP analysis. The numbers indicate bootstrap percentages.
46
Fig. 18. Strict consensus tree for the MP analysis inferred from the trnL/F region. Bootstrap percentages are supporting the branches.
47
Fig. 19. Maximum likelihood analysis of the trnL/F region yielded a best tree, which is shown here. The numbers on top of the branches indicate bootstrap percentages.
48
Fig. 20. Bayesian Inference analyses resulted in a best tree for the combined matrix. Posterior probabilities are shown on top of the branches.
49
