Received: 14 November 2017
Revised: 2 March 2018
Accepted: 12 March 2018
DOI: 10.1002/ptr.6083
RESEARCH ARTICLE
Thai herbal antipyretic 22 formula (APF22) inhibits UVA‐mediated melanogenesis through activation of Nrf2‐regulated antioxidant defense Tasanee Onkoksoong1 | Saowanee Jeayeng1 | Naravat Poungvarin2 | Saowalak Limsaengurai1 | Onusa Thamsermsang3 | Pinpat Tripatara1 | Pravit Akarasereenont1,3
|
Uraiwan Panich1
1
Department of Pharmacology, Mahidol University, Bangkok 10700, Thailand
2
Department of Clinical Pathology, Mahidol University, Bangkok 10700, Thailand
3
Center of Applied Thai Traditional Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand Correspondence Uraiwan Panich, Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, 2 Prannok Rd., Bangkoknoi, Bangkok 10700, Thailand. Email:
[email protected] Funding information the Chalermphrakiat Grant, Faculty of Medicine Siriraj Hospital, Mahidol University; Mahidol University Grant; the Royal Golden Jubilee PhD, Grant/Award Number: PHD/ 0181/2554; Thailand Research Fund, Grant/ Award Numbers: DBG5380040 and RSA5980066
Thai herbal antipyretic 22 formula (APF22), a polyherbal formula, has been traditionally used to treat dermatologic problems including hyperpigmentation. Exposure of the skin to ultraviolet A (UVA) causes abnormal melanin production induced by photooxidative stress. This study thus aimed to investigate the protective effects of APF22 extracts and phenolic compounds, ferulic acid (FA), and gallic acid (GA; used as positive control and reference compounds), on melanogenesis through modulation of nuclear factor E2‐related factor 2 (Nrf2) signaling and antioxidant defenses in mouse melanoma (B16F10) cells exposed to UVA. Our results revealed that the APF22 extracts, FA, and GA reduced melanin synthesis as well as activity and protein levels of tyrosinase in UVA‐irradiated B16F10 cells. Moreover, APF22 extracts and both FA and GA were able to activate Nrf2‐antioxidant response element signaling and promote antioxidant defenses including glutathione, catalase, glutathione peroxidase, and the glutathione‐S‐transferase at both mRNA and enzyme activity levels in irradiated cells. In conclusion, APF22 extracts suppressed UVA‐mediated melanogenesis in B16F10 cells possibly via redox mechanisms involving activation of Nrf2 signaling and upregulation of antioxidant defenses. Moreover, pharmacological action of the APF22 extracts may be attributed to the phenolic compounds, FA, and GA, probably serving as the APF22's active compounds. KEY W ORDS
melanogenesis, nuclear factor E2‐related factor 2 (Nrf2), phenolics, polyherbal formula, ultraviolet A
1
|
I N T RO D U CT I O N
effective and safe topical skin products is warranted. Thai herbal antipyretic 22 formula (APF22) or Benchalokawichian has been tradition-
There are rising demands for herbal remedies to treat dermatologic
ally used not only as an antipyretic but also to treat skin disorders and
diseases and cosmetic problems. Although herbal medicine for topical
promote healthy skin (Juckmeta, Thongdeeying, & Itharat, 2014). This
uses has existed for centuries, development of herbal formula as
polyherbal formula has been included in the Thailand National List of
Abbreviations: APF22, Thai herbal antipyretic 22 formula; ARE, antioxidant response element; DMEM, Dulbecco's modified Eagle medium; DTNB, 5,5′‐dithio‐bis‐(2‐ nitrobenzoic acid); FA, ferulic acid; GSH, glutathione; GSSG, glutathione reductase; GST, glutathione S‐transferase; H2DCFDA, nonfluorescent dichlorofluorescein; Nrf2, nuclear factor E2‐related factor 2; PBS, phosphate‐buffered saline; ROS, reactive oxygen species; UPLC, ultra‐performance liquid chromatography; UVA, ultraviolet A; γ‐GCL, γ‐glutamate cysteine ligase; γ‐GCLC, γ‐glutamate cysteine ligase catalytic subunit; γ‐GCLM, γ‐glutamate cysteine ligase modifier subunit
Phytotherapy Research. 2018;1–9.
wileyonlinelibrary.com/journal/ptr
Copyright © 2018 John Wiley & Sons, Ltd.
1
2
ONKOKSOONG
Essential Medicines (herbal products list). The APF22 is composed of
ET AL.
possible active ingredients of the APF22 extracts and were previously
dried roots of 5 plants: Harrisonia perforata Merr., Capparis
shown to exert antimelanogenic actions (Panich et al., 2012;
micracantha DC., Clerodendrum petasites S.Moore., Ficus racemosa
Thangboonjit, Limsaeng‐u‐rai, Pluemsamran, & Panich, 2014). The
Linn., and Tiliacora triandra Diels. (Sakpakdeejaroen, Juckmeta, &
presence of FA and GA in APF extracts was evaluated using
Itharat, 2014). Several phytochemicals identified in the component
ultra‐performance
herbs of the APF22 included flavonoids and phenolic acid deriva-
we
tives such as ferulic acid (FA), gallic acid (GA), hispidulin, and
photoprotection against melanogenesis by assessing the effects of
kaempferol
2010;
the APF22, FA, and GA on modulation of the Nrf2‐antioxidant
Hazekamp, Verpoorte, & Panthong, 2001; Yadav, Nandy, Maity,
response element (ARE) signaling and antioxidant defenses includ-
Sarkar, & Saha, 2015). Previous in vitro and in vivo studies have
ing catalase (CAT), glutathione peroxidase (GPx) and the glutathi-
(Ahmed,
Siddesha,
Urooj,
&
Vishwanath,
explored
the
liquid
chromatography
antioxidant
(UPLC).
mechanisms
Furthermore,
involved
in
the
demonstrated beneficial effects of the APF22 and its component
one‐s‐transferase (GST) at both mRNA and enzyme activity levels
herbs on skin disorders and wound healing (Juckmeta et al., 2014;
in UVA‐irradiated B16F10 cells.
Waheed et al., 2015; Murti & Kumar, 2012). Moreover, arbutin, widely used as a skin‐lightening agent, was identified in C. petasites (Thongchai, Liawruangrath, & Liawruangrath, 2007). We previously reported that the extracts of the APF22 and its components
2
MATERIALS AND METHODS
|
provided inhibitory effects on UVA‐stimulated matrix metalloproteinase‐1 (MMP‐1) in correlation to their antioxidant actions in
2.1
keratinocyte HaCaT cells (Pluemsamran et al., 2013). Moreover,
Five herbal materials were thoroughly authenticated by two experi-
GA
&
enced applied Thai traditional specialists. Briefly, herbal roots were
Wongkajornsilp, 2012), FA, quercetin (Chaiprasongsuk, Onkoksoong,
washed with deionized water, dried by hot air oven, grinded into pow-
Pluemsamran,
hispidulin
der, and mixed together, respectively. All procedures were carried on
(Chaiprasongsuk et al., 2017), which could be active constituents iso-
by the Manufacturing Unit of Herbal Medicines and Products Ayurved
lated from the APF22 formula, were demonstrated to have abilities
Siriraj, Center of Applied Thai Traditional Medicine, Mahidol Univer-
to suppress UVA‐induced melanogenesis in our previous in vitro
sity controlled according to Good Manufacturing Practice certification.
and in vivo studies.
The APF22 finishing powder was extracted 3 times with 80% ethanol
(Panich,
Onkoksoong, Limsaengurai,
Limsaengurai, &
Panich,
Akarasereenont,
2016),
and
|
Herbal materials and extraction
Ultraviolet A (UVA) has been demonstrated to induce oxidative
(EtOH) at ratio 1:10 (w/v) by maceration in temperature room; after
stress in association with melanogenesis in various melanoma cells
that, the APF22 extract solution was concentrated by rotary evapora-
and melanocytes (Panich et al., 2011; Panich et al., 2012; Hu, Zhou,
tor between 50 and 55 °C and at a pressure 150 mbar (Buchi, Switzer-
Lei, Ding, & Xu, 2009). To protect the skin from environmental insults
land). The APF22 extracts were kept in amber bottles at −80 °C prior
and maintain skin homeostasis, adaptation mechanisms involve a cuta-
to lyophilization. The finished extracts were stored in amber
neous neuroendocrine system, which can mediate production of mel-
desiccator.
atonin having photoprotective actions partly through the modulation of redox signaling (Slominski et al., 2012; Slominski et al., 2017; Janjetovic et al., 2016). Although melanin plays a crucial protective role against UV damage in human skin, excessive melanogenesis involving formation of reactive oxygen species (ROS) following UV
2.2 | Identification of phenolic compounds present in APF22 extracts by UPLC
exposure could be harmful, particularly to people with light skin
APF22 crude powder (50 mg) was extracted with 50% methanol,
(Slominski, Tobin, & Shibahara, 2004). Hence, promotion of
vortexed, and centrifuged at 15,000 rpm for 10 min at 4 °C.
antioxidant defense systems to encounter UVA‐mediated oxidative
Polyvinylidene difluoride membrane 0.22 μm (Vertical Chromatogra-
stress could represent one of effective and safe pharmacologic
phy, Thailand) was used to remove unwanted residues in APF22
strategies
and
extract solution. UPLC analysis was performed using Waters
Nuclear factor E2‐related factor 2 (Nrf2), a crucial transcription
including caffeic acid, FA, GA, kojic acid, p‐coumaric acid, and vanillic
factor regulating the expression of various cytoprotective genes
acid were selected for identification of phenolic compounds in
including antioxidant and detoxification genes, has been shown to
APF22 extracts. The analytical procedure was performed using Waters
play a beneficial role in maintaining redox balance and cellular homeo-
Empower 2 software. Waters Acquity UPLC column BEH C18 (1.7 μm
stasis supporting physiological function and integrity of a series of skin
2.1 × 100 mm; Water, USA), a stationary phase, and mobile phases
cells including melanocytes and keratinocytes (Chaiprasongsuk et al.,
composing of 0.1% orthophosphoric acid in Milli‐Q water (solvent A)
2016; Janjetovic et al., 2016; Jian et al., 2016; Kim et al., 2013;
and 100% acetonitrile (solvent B) with flow rate 0.3 ml/min were
Plauth et al., 2016).
processed as follows: 0 min, 95% A/5% B; 5 min, 90% A/10% B;
to
protect
against
excessive
melanogenesis
photodamaged skin.
ACQUITY UPLC™ system (Water, USA). Briefly, six phenolic markers
This study thus aimed to investigate the protective effects of the 2
8 min, 80% A/20% B; and 10 min, 0% A/100% B. The overall chro-
APF22 extracts and phenolics, FA, and GA, on UVA (8 J/cm )‐induced
matographic fingerprints were detected at 280 nm, and identification
melanogenesis in B16F10 melanoma cells. FA and GA were used as
of phenolics including FA and GA in the APF22 extracts was repre-
positive control and reference compounds because they could be
sented in Figure 1.
ONKOKSOONG
3
ET AL.
FIGURE 1 The chromatographic phenolic fingerprints of Thai herbal antipyretic 22 formula extracts and identification of phenolics in the extracts by ultra‐performance liquid chromatography analysis. Peak details 1: gallic acid (RT: 1.729 min), 2: vanellic acid (RT: 6.108 min), 3: caffeic acid (RT: 6.422 min), 4: p‐coumaric acid (RT: 8.250 min), and 5: ferulic acid (RT: 8.975 min) [Colour figure can be viewed at wileyonlinelibrary.com]
2.3
|
Cell cultures and treatment
B16F10 mouse melanoma cell line (ATCC, MD, USA) was a kind gift from Assoc. Prof. Wajjwalku, Faculty of Veterinary Medicine, Kasetsart University. B16F10 cells were grown in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin (100 units/ml)/streptomycin (100 μg/ml) and were maintained at 37 οC in a humidified air of 5% CO2 (PCO2 = 40 Torr;
(Panich et al., 2013). The melanin and tyrosinase activity monitored by dopachrome formation were measured spectrophotometrically at 475 by a spectrophotometer. The amount of melanin (μg/mg protein) was calculated by comparing with a standard curve generated using synthetic melanin. The tyrosinase activity (unit/mg protein) was calculated by comparison to a standard curve using tyrosinase (2034 U/mg).
a Forma Scientific CO2 Water‐Jacketed Incubator). Cells were treated with APF22 extracts prepared by the method of dynamic maceration as previously described (Pluemsamran et al., 2013) and with phenolics (FA and GA, used as positive control and reference compounds). The APF22 extracts and test phenolics were dissolved in 80% ethanol, and the final concentration of ethanol in culture medium did not exceed 0.05% (v/v) in phosphate‐buffered saline or medium. Cells were pretreated with the APF22 extracts (up to 30 μg/ml) or test phenolics (up to 5 μg/ml) in phosphate‐buffered saline for 30 min prior to irradiation with a single dose of UVA (8 J/cm2). Determination of UV intensity required and the UVA source
2.5
|
Determination of oxidant formation
The assay is based on oxidation of nonfluorescent dichlorofluorescein (H2DCFDA) by intracellular ROS to fluorescent 2, 7‐DCF. Following UVA irradiation, cells were incubated with phenol red‐free DMEM and loaded with 5‐μM H2DCFDA at 37 °C for 1 hr. DCF fluorescence intensity indicating ROS formation was measured for 30 min at excitation and emission wavelengths of 485 and 530 nm, respectively, using a fluorescence plate reader.
were previously described (Panich et al., 2011). The dose of UVA and concentrations of the APF22 and the phenolics used in this study were noncytotoxic to B16F10 cells. Following UVA irradiation, cells were washed, further incubated in serum‐free medium, and harvested at different time points as indicated in Section 3. Cell lysates were prepared using the lysis buffer containing 50‐mM Tris HCl, 10‐mM ethylene diaminetetraacetic acid, 1% (v/v) Triton X‐100, phenylmethylsulfonyl fluoride (100 mg/ml), and pepstatin A (1 mg/ml) in DMSO and leupeptin (1 mg/ml) in H2O, pH 6.8. The total lysates collected were either assayed immediately or kept frozen at −80 °C.
2.6 | Determination of intracellular glutathione content GSH level was spectrophotometrically measured using glutathione reductase (GR): (5,5′‐dithio‐bis‐2‐(nitrobenzoic acid; DTNB) enzymatic recycling method following the kit protocol (Sigma‐Aldrich, MO, US) as previously described (Chaisiriwong et al., 2016). The assay is based on conversion of glutathione disulfide to GSH by GR in the presence of nicotinamide adenine dinucleotide phosphate hydrogen (NADPH)) and GSH oxidation by the sulfhydryl reagent DTNB to produce the yellow TNB (5′‐thio‐2‐nitrobenzoic acid) measured at
2.4 | Determination of melanin content and tyrosinase activity
412 nm. The rate of TNB production is directly proportional to this recycling reaction in turn directly proportional to the concentration of GSH. The GSH level was calculated by comparing the value
Melanin content and tyrosinase activity were determined in B16F10
obtained with a standard curve of GSH and was expressed in nmol/
cells harvested at 1 hr‐postirradiation as previously described
mg protein.
4
ONKOKSOONG
2.7 | Determination of activities of antioxidant enzymes (CAT, GPx, and GST)
ET AL.
GS‐DNB conjugate determined at 340 nm. One unit of GST activity was defined as the amount of enzyme catalyzing 1 nmol of GS‐DNB conjugate/min and was expressed as nmol/min/mg protein.
CAT activity was measured following the kit protocol from Cayman chemical (Ann Arbor, MI). CAT reacted with methanol in the presence of H2O2 to produce formaldehyde, which was then measured colorimetrically with 4‐amino‐3‐hydrazino‐5‐mercapto‐2, 3, 4‐triazole (Purpald) as the chromogen. The optical density was read on a spectrophotometer at 540 nm. One unit of CAT was defined as the amount of enzyme generating 1.0 nmol of formaldehyde per minute and was expressed as nmol/min/mg protein. GPx activity was assessed following manufacture's protocol (Trevigen, USA).
2.8
|
Western blot analysis
Preparation of total protein, cytosolic and nuclear extracts, and western blot analysis of tyrosinase protein and Nrf2 nuclear translocation were performed as previously described (Chaiprasongsuk et al., 2016).
2.9 | Luciferase reporter gene analysis for transcriptional activity of Nrf2
GPx activity was measured indirectly by a coupled reaction with GR.
The Cignal™ Antioxidant Response Reporter (SABiosciences, MD, USA),
Oxidized glutathione was generated upon reduction of hydroperoxide
which expressed a luciferase gene driven by multiple ARE (TCACAG
by GPx and was recycled to reduced state by the oxidation of NADPH
TGACTCAGCAAAATT) repeats was used to measure transcriptional
to nicotinamide adenine dinucleotide phosphate (NADP+) accompanied
activity of Nrf2‐ARE. Transfecting plasmid DNA into B16F10 cells using
by a decrease in absorbance at 340 nm. One unit of GPx was determined
Lipofectamine® LTX with Plus™ Reagent (Invitrogen, USA) was per-
as the amount of enzyme causing the oxidation of 1 nmol of NADPH to
formed as previously described (Chaiprasongsuk et al., 2016). The
NADP+ per minute and represented as units/mg protein.
luciferase activity was measured by Dual‐Glo® Luciferase Reporter
GST activity was determined following manufacture's protocol
Assay System (Promega, USA) according to the manufacturer's proto-
from Cayman chemical (Ann Arbor, USA). Briefly, GST catalyzed conju-
col. The luciferase activity was normalized to the Renilla luciferase
gation of GSH to 1‐chloro‐2, 4‐dinitrobenzene (CDNB) to produce the
activity as a promoter activity.
FIGURE 2 Thai herbal antipyretic 22 formula (APF22) extracts, ferulic acid, and gallic acid protected against ultraviolet A (UVA)‐mediated melanogenesis in B16F10 cells. (a) Melanin content and (b) tyrosinase activity in the cells pretreated with test compounds were measured at 1 hr after UVA irradiation (8 J/cm2). (c) Tyrosinase protein expression was assessed by western blot analysis at 24 hr after UVA irradiation. Data are presented as the mean percentage relative to control (100%, nonirradiated and untreated cells) ± SD from at least three independent experiments. The statistical significance of differences between the control and UVA‐irradiated cells was determined by Student's t test and between UVA‐irradiated and compounds‐treated cells by one‐way ANOVA followed by Dunnett's test. ###p < .001 versus unirradiated control cells. *p < .05; **p < .01; ***p < .001 versus irradiated cells without compound treatment [Colour figure can be viewed at wileyonlinelibrary.com]
ONKOKSOONG
5
ET AL.
2.10 | Measurement of mRNA expression by quantitative real‐time reverse transcriptase‐ polymerase chain reaction
antimelanogenic effects and antioxidant actions of APF22 extracts, FA, and GA. Exposure to UVA (8 J/cm2) caused a significant increase in intracellular oxidant formation and decrease in GSH levels at 1 hr after UVA irradiation as compared with nonirradiated cells, although
RNA extractions and reverse transcription were performed as previously described (Panich et al., 2012; Pluemsamran, Onkoksoong, & Panich, 2012). Sequences of PCR primer sets for CAT, γ‐GCLC, γ‐ GCLM, GPx, GST, and GAPDH (in 5′‐3′ direction) were as follows:
pretreatment with the APF22, FA, and GA dose‐dependently suppressed ROS levels (Figure 3a) and restored GSH contents (Figure 3b) as compared with irradiated B16F10 cells without pretreatment with test compounds.
CAT sense (product sizes = 148 bp), CCTTCGACC CAAGCAACATG, and antisense, CGAGCACGGTAGGGACAGTTC; γ‐GCLC sense (prod-
TTGGAGTTGCACAGCTGGATTC, and antisense, TGGTTTTACCTGTG
3.3 | APF22 extracts, FA, and GA protected against UVA‐mediated reduction of antioxidant enzyme activities
CCCACTG; GPx sense (product sizes = 72 bp), CCTGTACCAGTCCA
We then examined the inhibitory effects of APF22 extracts, FA, and
ATACCATCCT, and antisense, TCCTGCTGGTCCTTCCCATA; GST
GA on UVA‐mediated a compromised antioxidant defense capacity
sense (product sizes = 72 bp), CCTGTACCAGTCCAATACCATCCT,
in B16F10 cells irradiated with UVB by assessing activities of CAT,
and antisense, TCCTGCTGGTCCTTCCCATA; GAPDH sense (product
GPx, and GST. Our previous study demonstrated that UVA irradiation
uct sizes = 160 bp), GCTGTCTTGCAGGGAATGTT, and antisense, ACACACCTTCCTTCCCATTG; γ‐GCLM sense (product sizes = 200 bp),
size = 124 bp), GAAATCCCATCACCATCTTCC, and antisense, AAAT GAGCCCCAGCCTTCTC. Amplification of a single product was verified using the melt curve analysis. The mRNA level was normalized with reference to the amount of housekeeping gene transcript (GAPDH mRNA). The mean Ct for mRNA expression in cDNA was normalized to that for GAPDH gene expression from the same cDNA samples.
2.11
|
Statistical Analysis
Data were expressed as means ± standard deviation from at least three biological replicates (n ≥ 3) assayed on different days. The statistical significance of differences between control (nonirradiated and untreated cells) and UVA‐irradiated groups was calculated by independent t test (Student's; two populations) and between irradiated groups and individual treatment groups by one‐way analysis of variance (ANOVA) followed by Dunnett's test using Prism (GraphPad Software Inc., San Diego, CA).
3
|
RESULTS
3.1 | APF22 extracts, FA, and GA protected against UVA‐induced melanogenesis To determine the antimelanogenic actions of APF22 extracts, FA, and GA, we assessed their inhibitory effects on melanin content as well as the activity and protein levels of tyrosinase in B16F10 cells irradiated with a UVA dose of 8 J/cm2. Our observations revealed that although UVA irradiation significantly stimulated melanogenesis in B16F10 cells, treatment with APF22 extracts, FA, and GA prior to UVA exposure led to a dose‐dependent reduction in melanin synthesis (Figure 2a) and tyrosinase activity (Figure 2b) at 1‐hr postirradiation and tyrosinase protein expression at 24‐hr postirradiation (Figure 2c).
3.2 | APF22 extracts, FA, and GA protected against UVA‐mediated cellular ROS formation and GSH depletion ROS production and GSH loss, a crucial determinant of cellular oxidative stress, were determined to investigate an association between
FIGURE 3 Thai herbal antipyretic 22 formula (APF22) extracts, ferulic acid, and gallic acid protected against ultraviolet A (UVA)‐ induced oxidant formation and glutathione (GSH) depletion in B16F10 cells. (a) Oxidant formation and (b) GSH content in the cells pretreated with test compounds were measured at 1 hr after UVA irradiation (8 J/cm2). Oxidant production was determined by oxidation of DCFH‐ DA to fluorescent DCF, which was measured at 485‐nm excitation and 530‐nm emission. Cellular GSH content was measured on the basis of a spectrophotometric GR:DTNB enzymatic recycling method. Data are presented as the mean percentage relative to control (100%, nonirradiated and untreated cells) ± SD from at least three independent experiments. The statistical significance of differences between the control and UVA‐irradiated cells was determined by Student's t test and between UVA‐irradiated and compounds‐treated cells by one‐way analysis of variance followed by Dunnett's test. ##p < .001; ###p < .001 versus nonirradiated control cells. *p < .05; **p < .01; ***p < .001 versus irradiated cells without compound treatment [Colour figure can be viewed at wileyonlinelibrary.com]
6
ONKOKSOONG
led to a significant downregulation of antioxidant protein levels at 6‐hr postirradiation (Chaiprasongsuk et al., 2016). The findings from this study also suggested that UVA (8 J/cm2) irradiation drastically reduced
ET AL.
3.5 | APF22 extracts, FA, and GA protected against UVA‐mediated downregulation of detoxification and antioxidant enzyme genes
activities of CAT, GPx, and GST activities at 6‐hr postirradiation as compared with nonirradiated cells. Nevertheless, pretreatment with the APF22 extracts, FA, and GA before UVA irradiation resulted in a pronounced increase in the CAT (Figure 4a), GPx (Figure 4b), and GST (Figure 4c) activities in a dose‐dependent manner in irradiated
To confirm the photoprotection by the test compounds against UVA‐ mediated inactivation of Nrf2, we further explored their effects on Nrf2 downstream target genes including those encoding detoxification enzymes and antioxidant proteins (CAT, γ‐GCLC, γ‐GCLM, GPx, and GST) in B16F10 cells at 2‐hr postirradiation. As shown in
B16F10 cells.
Figure 6, pretreatment with APF22 extracts, FA, and GA prior to
3.4 | APF22 extracts, FA, and GA protected against UVA‐mediated reduction of Nrf2 nuclear translocation and Nrf2‐ARE transcriptional activity
UVA exposure enhanced the mRNA levels of CAT (Figure 6a), γ‐ GCLC and γ‐GCLM (Figure 6b), GPx (Figure 6c), and GST (Figure 6 d) as compared with the irradiated cells without compound pretreatment.
Because we observed that test compounds were able to inhibit
Furthermore, the results from all experiments performed in this
UVA‐dependent reduced activities of GPx and GST, important down-
study revealed that treatment of B16F10 cells with APF22 extracts
stream antioxidant enzymes of Nrf2, in B16F10 cells, we then exam-
and both FA and GA at the highest concentrations (30 μg/ml and
ined
with
5 μg/ml, respectively) did not influence melanogenesis (Figure S1) as
modulation of Nrf2 activation. Our previous study demonstrated that
well as the antioxidant defense capacity and transactivation of Nrf2
UVA exposure resulted in time‐dependent changes in Nrf2 nuclear
(Figure S2) in nonirradiated cells.
whether
their
antimelanogenic
actions
associated
translocation and a transient suppression of Nrf2 activity occurred as early as 1‐hr postirradiation (Chaiprasongsuk et al., 2016). Our observations in this study also revealed a marked reduction of Nrf2
4
|
DISCUSSION
nuclear translocation and transcriptional activity in irradiated cells compared with nonirradiated cells, although pretreatment with
Development of effective depigmenting agents from promising medic-
APF22 extracts, FA, and GA before UV exposure resulted in a recov-
inal plants and herbal formulas has been of great interest because phy-
ery of nuclear/cytosolic Nrf2 ratio (Figure 5a) and ARE luciferase
tochemicals, which potentially are their active constituents, provide
activity (Figure 5b) at 1‐hr postirradiation as compared with irradiated
various pharmacological activities including antioxidant activity. Fur-
B16F10 cells in the absence of test compounds.
thermore, compounds acting as Nrf2 inducers have been proposed
FIGURE 4 Thai herbal antipyretic 22 formula (APF22) extracts, ferulic acid, and gallic acid protected against ultraviolet A (UVA)‐mediated reduction of antioxidant enzyme activities in B16F10 cells. Enzyme activities of (a) catalase, (b) glutathione peroxidase (GPx), and (c) glutathione‐S‐transferase (GST) in the cells pretreated with test compounds were measured at 6 hr after UVA irradiation (8 J/cm2). Data are presented as the mean percentage relative to control (100%, nonirradiated and untreated cells) ± SD from at least three independent experiments. The statistical significance of differences between the control and UVA‐irradiated cells was determined by Student's t test and between UVA‐irradiated and compounds‐treated cells by one‐way analysis of variance followed by Dunnett's test. ##p < .001; ###p < .001 versus nonirradiated control cells. *p < .05; **p < .01; ***p < .001 versus irradiated cells without compound treatment [Colour figure can be viewed at wileyonlinelibrary.com]
ONKOKSOONG
7
ET AL.
FIGURE 5 Thai herbal antipyretic 22 formula (APF22) extracts, ferulic acid, and gallic acid protected against ultraviolet A (UVA)‐mediated reduction of nuclear factor E2‐related factor 2 (Nrf2) nuclear translocation and Nrf2‐antioxidant response element (ARE) transcriptional activity in B16F10 cells. (A) Nrf2 nuclear translocation and (B) Nrf2‐ARE activity in the cells pretreated with test compounds were measured at 1 hr after UVA irradiation (8 J/cm2). Nrf2 nuclear translocation was evaluated by western blot analysis. Nrf2 was detected at 68 kDa, TATA‐binding protein (TBP), the loading control for nuclear protein, at 37 kDa and α‐Tubulin, the loading control for cytosol protein, at 50 kDa. Nrf2‐ARE activity was determined by a dual luciferase assay. Data are presented as the mean percentage relative to control (100%, nonirradiated and untreated cells) ± SD from at least three independent experiments. The statistical significance of differences between the control and UVA‐irradiated cells was determined by Student's t test and between UVA‐irradiated and compounds‐treated cells by one‐way analysis of variancce followed by Dunnett's test. . ##p < .001; ###p < .001 versus nonirradiated control cells. *p < .05; **p < .01 versus irradiated cells without compound treatment [Colour figure can be viewed at wileyonlinelibrary.com] for prevention and inhibition of skin photooxidative damage and hyper-
H2O2 involved in triggering melanogenesis (Kasraee et al., 2012; Park,
pigmentation. Because the APF22 extracts have been used in tradi-
Sekhon, Yoon, Kim, & Min, 2016). GST is also a crucial detoxifying
tional medicine for skin care and previously demonstrated to promote
enzyme participating in the defense mechanisms against photodamaged
antioxidant defense capacity in keratinocyte HaCaT cells in response
skin and melanogenesis (Panich et al., 2013; Rodríguez‐Yanes, Cuevas,
to UVA irradiation (Pluemsamran et al., 2013), this study thus explored
González, & Mallol, 2014).
the antimelanogenic effects of APF22 extracts and the phenolics, FA
This study observed that the APF22 extracts, FA, and GA had abil-
and GA, which could be their possible active constituents as identified
ities to elevate activities of CAT, GPx, and GST in B16F10 cells sub-
by UPLC analysis, in UVA‐irradiated B16F10 cells. We also evaluated
jected to UVA (8 J/cm2). Furthermore, we further examined the
the underlying redox mechanisms involving Nrf2 signaling against
effects of test compounds on Nrf2‐ARE signaling responsible for tran-
UVA‐dependent melanogenesis in B16F10 cells.
scriptional regulation of several cytoprotective proteins including CAT,
We demonstrated that the APF22 extracts, FA, and GA exerted
GPx, and GST. Because UVA irradiation was previously demonstrated
antimelanogenic effects on UVA‐irradiated B16F10 cells by suppres-
to cause an early and transient inactivation of Nrf2‐mediated antioxi-
sion of melanin synthesis as well as enzyme activity and protein levels
dant response, this study suggested that pretreatment with APF22
of tyrosinase in correlation with reduction of ROS formation and pro-
extracts and their possible active compounds (both FA and GA) was
motion of GSH levels. We also observed that mushroom tyrosinase
able to potentially protect against UVA‐dependent a decrease in
inhibitory activities of GA were comparable with those of arbutin
nuclear translocation and transcriptional activity of Nrf2 and mRNA
and kojic acid, which are well‐known tyrosinase inhibitors (data not
levels of its downstream antioxidants including CAT, γ‐GCLC and
shown). In addition, it is recognized that antioxidant defenses play a
γ‐GCLM, GPx, and GST in B16F10 cells. It is proposed that activation
role in maintenance of redox status responsible for preserving
of Nrf2 signaling represents a defense mechanisms involved in protec-
integrity and function of melanocytes in response to photooxidative
tion of the skin cells including melanocytes against environmental
stress. CAT and GPx are important antioxidant enzymes that remove
stressors including UV irradiation (Gęgotek & Skrzydlewska, 2015;
8
ONKOKSOONG
ET AL.
FIGURE 6 Thai herbal antipyretic 22 formula (APF22) extracts, ferulic acid, and gallic acid protected against ultraviolet A (UVA)‐mediated downregulation of detoxifying and antioxidant genes in B16F10 cells. The mRNA levels of (a) catalase (CAT) (b) γ‐GCLC and γ‐GCLM, (c) glutathione peroxidase (GPx), and (d) glutathione‐S‐transferase (GST) were measured by real‐time RT‐PCR analysis at 2‐hr postirradiation. Data are presented as the mean percentage relative to control (100%, nonirradiated and untreated cells) ± SD from at least three independent experiments. The statistical significance of differences between the control and UVA‐irradiated cells was determined by Student's t test and between UVA‐irradiated and compounds‐treated cells by one‐way analysis of variance followed by Dunnett's test. ##p < .001; ###p < .001 versus nonirradiated control cells. *p < .05; **p < .01; ***p < .001 versus irradiated cells without compound treatment [Colour figure can be viewed at wileyonlinelibrary.com] Zhao, Shah, & Qiang, 2017; Jian et al., 2016). Moreover, FA and GA,
Jongputtharaksa and Ms. Poorada Booncharoen for assistance in pre-
which could be the possible active compounds in APF22 formula,
paring the herbal extracts and Ms. Apisara Pattanakamchai for assis-
were demonstrated to suppress oxidative stress‐related various
tance in the UPLC analysis.
pathologies including melanogenesis, hepatic and cardiovascular injury, and neurotoxicity via activating Nrf2 and upregulating antioxi-
CONFLIC T OF INT E RE ST
dant defense system (Chaiprasongsuk et al., 2016; Song et al., 2016;
The authors have no conflicts of interest to declare.
Yu, Zhao, & Niu, 2016). This study revealed that APF22 extracts, FA, and GA could indirectly regulate Nrf2 activity probably via modulation of ROS levels but not direct action on Nrf2 because treatment with the test compounds alone for 30 min did not substantially alter Nrf2 activity and its downstream target genes monitored at later time‐points in nonirradiated cells. Thus, we proposed here that APF22 and antioxidant phenolics (FA and GA) provided an early protection against UVA‐induced melanogenesis probably via indirectly upregulating Nrf2‐ARE signaling. In summary, APF22 extracts and test phenolics, FA and GA, inhibited UVA‐induced melanogenesis probably through upregulation of Nrf2‐regulated antioxidant defenses in B16F10 cells. The pharmacological actions of AFP22 formula may be attributed to antioxidant properties of phenolics including FA and GA, which could be the biologically active compounds in the herbal formula. ACKNOWLEDGEMEN TS This work was supported by Thailand Research Fund (Grant RSA5980066 and DBG5380040); “Mahidol University” Grant; the “Chalermphrakiat” Grant, Faculty of Medicine Siriraj Hospital, Mahidol University; and the Royal Golden Jubilee PhD. Scholarship Program (Grant PHD/0181/2554). We would like to acknowledge Ms. Tanta
ORCID Uraiwan Panich
http://orcid.org/0000-0002-4889-6729
RE FE RE NC ES Ahmed, F., Siddesha, J. M., Urooj, A., & Vishwanath, B. S. (2010). Radical scavenging and angiotensin converting enzyme inhibitory activities of standardized extracts of Ficus racemosa stem bark. Phytotherapy Research, 24, 1839–1843. Chaiprasongsuk, A., Lohakul, J., Soontrapa, K., Sampattavanich, S., Akarasereenont, P., & Panich, U. (2017). Activation of Nrf2 reduces UVA‐mediated MMP‐1 upregulation via MAPK/AP‐1 signaling cascades: The photoprotective effects of sulforaphane and hispidulin. The Journal of Pharmacology and Experimental Therapeutics, 360, 388–398. Chaiprasongsuk, A., Onkoksoong, T., Pluemsamran, T., Limsaengurai, S., & Panich, U. (2016). Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2‐dependent antioxidant responses. Redox Biology, 8, 79–90. Chaisiriwong, L., Wanitphakdeedecha, R., Sitthinamsuwan, P., Sampattavanich, S., Chatsiricharoenkul, S., Manuskiatti, W., & Panich, U. (2016). A case‐control study of involvement of oxidative DNA damage and alteration of antioxidant defense system in patients with basal cell carcinoma: Modulation by tumor removal. Oxidative Medicine and Cellular Longevity, 2016, 5934024.
ONKOKSOONG
9
ET AL.
Gęgotek, A., & Skrzydlewska, E. (2015). The role of transcription factor Nrf2 in skin cells metabolism. Archives of Dermatological Research, 307, 385–396.
against induction of matrix metalloproteinase‐1 in UVA‐irradiated keratinocyte HaCaT cells. Evidence‐Based Complementary and Alternative Medicine, 2013, 739473.
Hazekamp, A., Verpoorte, R., & Panthong, A. (2001). Isolation of a bronchodilator flavonoid from the Thai medicinal plant Clerodendrum petasites. Journal of Ethnopharmacology, 78, 45–49.
Rodríguez‐Yanes, E., Cuevas, J., González, S., & Mallol, J. (2014). Oral administration of Polypodium leucotomos delays skin tumor development and increases epidermal p53 expression and the anti‐oxidant status of UV‐irradiated hairless mice. Experimental Dermatology, 23, 526–528.
Hu, Z. M., Zhou, Q., Lei, T. C., Ding, S. F., & Xu, S. Z. (2009). Effects of hydroquinone and its glucoside derivatives on melanogenesis and antioxidation: Biosafety as skin whitening agents. Journal of Dermatological Science, 55, 179–184. Janjetovic, Z., Jarrett, S. G., Lee, E. F., Duprey, C., Reiter, R. J., & Slominski, A. T. (2016). Melatonin and its metabolites protect human melanocytes against UVB‐induced damage: Involvement of NRF2‐mediated pathways. Scientific Reports, 7, 1274. Jian, Z., Tang, L., Yi, X., Liu, B., Zhang, Q., Zhu, G., … Li, C. (2016). Aspirin induces Nrf2‐mediated transcriptional activation of haem oxygenase‐ 1 in protection of human melanocytes from H2O2‐induced oxidative stress. Journal of Cellular and Molecular Medicine, 20, 1307–1318. Juckmeta, T., Thongdeeying, P., & Itharat, A. (2014). Inhibitory effect on β‐hexosaminidase release from RBL‐2H3 cells of extracts and some pure constituents of benchalokawichian, a Thai herbal remedy, used for allergic disorders. Evidence‐Based Complementary and Alternative Medicine, 2014, 828760. Kasraee, B., Nikolic, D. S., Salomon, D., Carraux, P., Fontao, L., Piguet, V., … Saurat, J. H. (2012). Ebselen is a new skin depigmenting agent that inhibits melanin biosynthesis and melanosomal transfer. Experimental Dermatology, 21, 19–24. Kim, T. K., Kleszczynski, K., Janjetovic, Z., Sweatman, T., Lin, Z., Li, W., … Slominski, A. T. (2013). Metabolism of melatonin and biological activity of intermediates of melatoninergic pathway in human skin cells. The FASEB Journal, 27, 2742–2755. Murti, K., & Kumar, U. (2012). Enhancement of wound healing with roots of Ficus racemosa L. in albino rats. Asian Pacific Journal of Tropical Biomedicine, 2, 276–280. Panich, U., Onkoksoong, T., Limsaengurai, S., Akarasereenont, P., & Wongkajornsilp, A. (2012). UVA‐induced melanogenesis and modulation of glutathione redox system in different melanoma cell lines: the protective effect of gallic acid. Journal of Photochemistry and Photobiology. B, 108, 16–22. Panich, U., Pluemsamran, T., Tangsupa‐a‐nan, V., Wattanarangsan, J., Phadungrakwittaya, R., Akarasereenont, P., & Laohapand, T. (2013). Protective effect of AVS073, a polyherbal formula, against UVA‐induced melanogenesis through a redox mechanism involving glutathione‐related antioxidant defense. BMC Complementary and Alternative Medicine, 13, 159.
Sakpakdeejaroen, I., Juckmeta, T., & Itharat, A. (2014). Development and validation of RP‐HPLC method to determine anti‐allergic compound in Thai traditional remedy called Benjalokawichien. Journal of the Medical Association of Thailand, 97, S76–S80. Slominski, A., Tobin, D. J., & Shibahara, S. (2004). Melanin pigmentation in mammalian skin and its hormonal regulation. Physiological Reviews, 84, 1155–1228. Slominski, A. T., Zmijewski, M. A., Semak, I., Kim, T. K., Janjetovic, Z., Slominski, R. M., & Zmijewski, J. W. (2017). Melatonin, mitochondria, and the skin. Cellular and Molecular Life Sciences, 74, 3913–3925. Slominski, A. T., Zmijewski, M. A., Skobowiat, C., Zbytek, B., Slominski, R. M., & Steketee, J. D. (2012). Sensing the environment: regulation of local and global homeostasis by the skin's neuroendocrine system. Advances in Anatomy, Embryology, and Cell Biology, 212, 1–115. Song, Y., Wen, L., Sun, J., Bai, W., Jiao, R., Hu, Y., … Ou, S. (2016). Cytoprotective mechanism of ferulic acid against high glucose‐induced oxidative stress in cardiomyocytes and hepatocytes. Food & Nutrition Research, 2016, 30323. Thangboonjit, W., Limsaeng‐u‐rai, S., Pluemsamran, T., & Panich, U. (2014). Comparative evaluation of antityrosinase and antioxidant activities of dietary phenolics and their activities in melanoma cells exposed to UVA. Siriraj Medizinhistorisches Journal, 66, 5–10. Thongchai, W., Liawruangrath, B., & Liawruangrath, S. (2007). High‐ performance liquid chromatographic determination of arbutin in skin‐whitening creams and medicinal plant extracts. Journal of Cosmetic Science, 58, 35–44. Waheed, M., Muhammad, F., Javed, I., Akhtar, M., Saleemi, M. K., Khaliq, T., … Anwar, M. I. (2015). Dermatoprotective effects of some plant extracts (genus Ficus) against experimentally induced toxicological insults in rabbits. Toxicology and Industrial Health, 31, 982–989. Yadav, R. K., Nandy, B. C., Maity, S., Sarkar, S., & Saha, S. (2015). Phytochemistry, pharmacology, toxicology, and clinical trial of Ficus racemosa. Pharmacognosy Reviews, 9, 73–80. Yu, C. L., Zhao, X. M., & Niu, Y. C. (2016). Ferulic acid protects against lead acetate‐induced inhibition of neurite outgrowth by upregulating HO‐1 in PC12 cells: involvement of ERK1/2‐Nrf2 pathway. Molecular Neurobiology, 53, 6489–6500.
Panich, U., Tangsupa‐a‐nan, V., Onkoksoong, T., Kongtaphan, K., Kasetsinsombat, K., Akarasereenont, P., & Wongkajornsilp, A. (2011). Inhibition of UVA‐mediated melanogenesis by ascorbic acid through modulation of antioxidant defense and nitric oxide system. Archives of Pharmacal Research, 34, 811–820.
Zhao, B., Shah, P., & Qiang, L. (2017). Distinct role of Sesn2 in response to UVB‐induced DNA damage and UVA‐induced oxidative stress in melanocytes. Photochemistry and Photobiology, 93, 375–381.
Park, D. J., Sekhon, S. S., Yoon, J., Kim, Y. H., & Min, J. (2016). Color reduction of melanin by lysosomal and peroxisomal enzymes isolated from mammalian cells. Molecular and Cellular Biochemistry, 413, 119–125.
SUPPORTI NG INFORMATION
Plauth, A., Geikowski, A., Cichon, S., Wowro, S. J., Liedgens, L., Rousseau, M., … Sauer, S. (2016). Hormetic shifting of redox environment by pro‐oxidative resveratrol protects cells against stress. Free Radical Biology & Medicine, 99, 608–622. Pluemsamran, T., Onkoksoong, T., & Panich, U. (2012). Caffeic acid and ferulic acid inhibit UVA‐induced matrix metalloproteinase‐1 through regulation of antioxidant defense system in keratinocyte HaCaT cells. Photochemistry and Photobiology, 88, 961–968. Pluemsamran, T., Tripatara, P., Phadungrakwittaya, R., Akarasereenont, P., Laohapand, T., & Panich, U. (2013). Redox mechanisms of AVS022, an oriental polyherbal formula, and its component herbs in protection
Additional Supporting Information may be found online in the supporting information tab for this article.
How to cite this article: Onkoksoong T, Jeayeng S, Poungvarin N, et al. Thai herbal antipyretic 22 formula (APF22) inhibits UVA‐mediated melanogenesis through activation of Nrf2‐regulated antioxidant defense. Phytotherapy Research. 2018;1–9. https://doi.org/10.1002/ptr.6083
