The Aberrant Gene-End Transcription Signal of ... - Journal of Virology

The Aberrant Gene-End Transcription Signal of the Matrix M Gene of Human Parainfluenza Virus Type 3 Downregulates Fusion F Protein Expression and the F-Specific Antibody Response In Vivo Matthias Lingemann, Sonja Surman, Emérito Amaro-Carambot, Anne Schaap-Nutt, Peter L. Collins, Shirin Munir RNA Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA

ABSTRACT

Human parainfluenza virus type 3 (HPIV3), a paramyxovirus, is a major viral cause of severe lower respiratory tract disease in infants and children. The gene-end (GE) transcription signal of the HPIV3 matrix (M) protein gene is identical to those of the nucleoprotein and phosphoprotein genes except that it contains an apparent 8-nucleotide insert. This was associated with an increased synthesis of a readthrough transcript of the M gene and the downstream fusion (F) protein gene. We hypothesized that this insert may function to downregulate the expression of F protein by interfering with termination/reinitiation at the M-F gene junction, thus promoting the production of M-F readthrough mRNA at the expense of monocistronic F mRNA. To test this hypothesis, two similar recombinant HPIV3 viruses from which this insert in the M-GE signal was removed were generated. The M-GE mutants exhibited a reduction in M-F readthrough mRNA and an increase in monocistronic F mRNA. This resulted in a substantial increase in F protein synthesis in infected cells as well as enhanced incorporation of F protein into virions. The efficiency of mutant virus replication was similar to that of wild-type (wt) HPIV3 both in vitro and in vivo. However, the F-proteinspecific serum antibody response in hamsters was increased for the mutants compared to wt HPIV3. This study identifies a previously undescribed viral mechanism for attenuating the host adaptive immune response. Repairing the M-GE signal should provide a means to increase the antibody response to a live attenuated HPIV3 vaccine without affecting viral replication and attenuation. IMPORTANCE

The HPIV3 M-GE signal was previously shown to contain an apparent 8-nucleotide insert that was associated with increased synthesis of a readthrough mRNA of the M gene and the downstream F gene. However, whether this had any significant effect on the synthesis of monocistronic F mRNA or F protein, virus replication, virion morphogenesis, and immunogenicity was unknown. Here, we show that the removal of this insert shifts F gene transcription from readthrough M-F mRNA to monocistronic F mRNA. This resulted in a substantial increase in the amount of F protein expressed in the cell and packaged in the virus particle. This did not affect virus replication but increased the F-specific antibody response in hamsters. Thus, in wild-type HPIV3, the aberrant M-GE signal operates a previously undescribed mechanism that reduces the expression of a major neutralization and protective antigen, resulting in reduced immunogenicity. This has implications for the design of live attenuated HPIV3 vaccines; specifically, the antibody response against F can be elevated by “repairing” the M-GE signal to achieve higher-level F antigen expression, with no effect on attenuation.

H

uman parainfluenza viruses (HPIVs) are human respiratory tract pathogens present as four serotypes, namely, HPIV1, HPIV2, HPIV3, and HPIV4. HPIVs infect and cause respiratory illness in humans of all ages worldwide, but their greatest impact is on infants and young children (1). HPIV3 belongs to the genus Respirovirus of the subfamily Paramyxovirinae of the family Paramyxoviridae within the order Mononegavirales. HPIV3 is the most important respiratory pathogen among HPIVs and is second only to respiratory syncytial virus (RSV) as a major cause of lower respiratory tract disease in infants and young children requiring hospitalization. Around 60% of children are infected with HPIV3 by 2 years of age, and 80% experience infection by 4 years of age (2). No licensed vaccine or effective antiviral drugs are currently available for the prevention and treatment of HPIV3 infection. The genome of HPIV3 is 15,462 nucleotides (nt) long and contains 6 genes encoding the following proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), fusion glycoprotein (F), hemagglutinin-neuraminidase glycoprotein (HN), and the large polymerase protein (L) (3). The N, M, F, HN, and L genes each

3318

jvi.asm.org

code for the single indicated protein. The HPIV3 P gene contains several additional shorter coding regions that give rise to the C and D accessory proteins and potentially an additional accessory protein, V (4, 5). The HPIV3 genes are arranged in the order 3=-N-PM-F-HN-L-5=. The 3= and 5= ends of the genome consist of short extragenic leader and trailer regions, respectively. HPIV3 has a

Received 29 October 2014 Accepted 31 December 2014 Accepted manuscript posted online 14 January 2015 Citation Lingemann M, Surman S, Amaro-Carambot E, Schaap-Nutt A, Collins PL, Munir S. 2015. The aberrant gene-end transcription signal of the matrix M gene of human parainfluenza virus type 3 downregulates fusion F protein expression and the F-specific antibody response in vivo. J Virol 89:3318 –3331. doi:10.1128/JVI.03148-14. Editor: R. M. Sandri-Goldin Address correspondence to Shirin Munir, [email protected]. Copyright © 2015, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.03148-14

Journal of Virology

March 2015 Volume 89 Number 6

HPIV3 Suppresses F Protein Synthesis during Infection

FIG 1 (A) Alignment of the gene-end (GE), intergenic (IG) (underlined), and gene-start (GS) sequences (positive sense) of the genes of HPIV3 strain JS (GenBank accession no. Z11575). Asterisks indicate nucleotides that are 100% conserved in all genes. The consensus sequence is shown at the top of the alignment. The sequence in boldface type in the M-GE sequence indicates an 8-nt segment that is not found in the other HPIV3 GE sequences and appears to be an insertion. (B) The BPIV3 (GenBank accession no. AF178654) M-F gene junction showing the M-GE, IG, and F-GS sequences (positive sense).

closely related bovine counterpart, namely, bovine parainfluenza virus type 3 (BPIV3). Each HPIV3 gene initiates with a short gene-start (GS) sequence and terminates with a short gene-end (GE) sequence, which are cisacting signals controlling transcription initiation and polyadenylation/termination, respectively. Neighboring genes are separated by conserved trinucleotide (CTT in the positive sense) intergenic (IG) regions (Fig. 1A). The GS and GE sequences are also very conserved, except for the M-GE sequence, which contains an apparent 8-nt insert (Fig. 1A) (6, 7). Eight positions of the 10-nt GS sequence (AGGANNAAAG) are conserved among the HPIV3 genes, and apart from the apparent 8-nt insert in the M-GE sequence, 9 positions of the 12-nt GE sequence (AA[A/T]TA[A/T] [G/A]AAAAA) are conserved in all other HPIV3 GEs. A previous comparison of HPIV3 strains JS (the strain in the present study) and Washington/47885/57 with the BPIV3 Kansas strain showed that this 8-nt insert is present in HPIV3 but not in BPIV3 (8) (Fig. 1A and B). Other than this, the GE, IG, and GS sequences of the human and bovine viruses show a high degree of similarity (Fig. 1A and B). This suggests that, evolutionarily, this 8-nt sequence was likely acquired by HPIV3 after diverging from its bovine counterpart. The HPIV3 RNA-dependent RNA polymerase initiates transcription at a single entry site in the 3= leader of the negative-sense viral genome. Transcription is guided by the GS and GE sequences flanking each gene for initiation and polyadenylation/termination, respectively, to generate monocistronic polyadenylated mRNAs. The polymerase occasionally fails to terminate at the various gene junctions and instead continues transcription across the IG region and the downstream gene to create readthrough mRNAs. It was previously shown that elevated levels of HPIV3 M-F readthrough transcripts were made, compared to the levels of other readthrough mRNAs during wild-type (wt) HPIV3 infection, such that the molar ratio of readthrough M-F to monocistronic F mRNAs appeared to be ⬃2:3, whereas readthrough transcripts representing other gene junctions were mostly below the level of detection by Northern blotting (6). It was hypothesized that the apparent 8-nt insert in the M-GE sequence may reduce


transcription termination at this gene junction, thus increasing the synthesis of M-F readthrough transcripts at the expense of the monocistronic F gene mRNA. In principle, this would reduce F protein synthesis because the distal open reading frame (ORF) of a bicistronic eukaryotic mRNA would be expected to be translated inefficiently (9). Thus, the aberrant HPIV3 M-F gene junction had the potential to play a role in the regulation of F protein expression, but this had not been investigated previously. In the present study, we investigated the role of this unique 8-nt M-GE insert in regulating HPIV3 F protein expression and examined possible effects on viral fitness and immunogenicity. To accomplish this, reverse genetics was used to generate two recombinant viruses (MGeDel and MGeDel-2nt), each with a deletion of the M-GE 8-nt insert and differing slightly in the flanking nucleotides to control for possible sequence-specific effects. We demonstrate here that the M-GE 8-nt insert weakens this GE signal and promotes M-F readthrough at the expense of the monocistronic F mRNA. We also describe the effects of this transcriptional regulation on the amount of F protein expression, virus replication, virion morphogenesis, and the development of an F-specific antibody response to infection. MATERIALS AND METHODS Viruses and cells. Recombinant wt HPIV3 was derived from strain JS (GenBank accession no. Z11575), as previously described (10). All HPIV3 viruses were propagated in LLC-MK2 cells and incubated at 32°C with 5% CO2 (11). LLC-MK2 cells (ATCC CCL-7) and Vero cells (ATCC CCL-81) were maintained in Opti-MEM I medium with GlutaMax-I (Life Technologies, Grand Island, NY) supplemented with 5% fetal bovine serum (FBS; Thermo Scientific, Atlanta, GA). A549 cells (ATCC CCL-185) were maintained in Ham’s F-12 nutrient mixture (Life Technologies) supplemented with 10% FBS and 2 mM L-glutamine (Life Technologies). BHK BSR-T7/5 cells that constitutively express T7 RNA polymerase (12) were maintained in Glasgow’s minimal essential medium (MEM) (Life Technologies) supplemented with 10% FBS, 1⫻ MEM amino acid solution (Life Technologies), and 1⫻ Geneticin (Life Technologies). Geneticin was included in the medium at every other passage. Repair of the aberrant M-GE signal. The unique 8-nt insert in the M-GE sequence was deleted in the wt HPIV3 full-length antigenomic plasmid (pFLC wt HPIV3) by PCR-based mutagenesis. In order to conform to the “rule of six” (13, 14), it was necessary to insert two nucleotides into the genome (Fig. 2). We made one construct in which these two nucleotides were inserted immediately upstream of the M-GE signal (MGeDel mutant) and one in which they were inserted at positions 17 and 18 upstream of the M-GE signal (MGeDel-2nt mutant) (Fig. 2). These two versions were made in order to control for any effects of sequence context in the M-GE region. For the generation of these mutant viruses, it was necessary to have two unique restriction sites flanking the M-GE sequence. A unique BstEII site (nt positions 5261 to 5267, located in the F ORF) was already present in the HPIV3 genome downstream of the M-GE sequence (Fig. 2). The full-length wt HPIV3 antigenomic plasmid was modified by the insertion of a unique BsiWI restriction site in the downstream nontranslated region (NTR) of the P gene (nt 98 to 103 downstream of the P ORF and nt 12 to 7 upstream of the P-GE signal) (Fig. 2). This was done by PCR-based site-directed mutagenesis (QuikChange Lightning site-directed mutagenesis kit; Agilent Technologies, Santa Clara, CA) using the following mutagenesis primer pair: forward primer GCAGAATGAAACAACAGATATCGTACGATATACAAATAAGAAAA ACTTAG and reverse primer CTAAGTTTTTCTTATTTGTATATCGTA CGATATCTGTTGTTTCATTCTGC (the BsiWI restriction site is underlined). The MGeDel mutant was made by using an overlapping-PCR strategy (15). In the first step, two separate PCRs were performed to produce

Journal of Virology

jvi.asm.org

3319

Lingemann et al.

FIG 2 Construction of antigenomic cDNAs of wt HPIV3 and the M gene-end (M-GE) mutant viruses (MGeDel and MGeDel-2nt) (sequences are in the positive sense). The nucleotide locations of the restriction sites (BsiWI and BstEII) used to introduce mutations into the wt HPIV3 genome are shown in parentheses. A unique BstEII site (nt positions 5261 to 5267, located in the F ORF) was already present in the wt HPIV3 genome downstream of the M-GE sequence. A unique BsiWI restriction site was introduced in the wt HPIV3 genome by substitution mutations spanning nt 3694 to 3699 in the downstream NTR of the P gene, which was located at nt 98 to 103 downstream of the P ORF and nt 12 to 7 upstream of the P-GE signal. The TAG stop codon of the M ORF is shown in boldface type. Sequence changes in the MGeDel and MGeDel-2nt mutant viruses compared to the wt HPIV3 sequence are boxed.

upstream and downstream fragments that had an overlapping region spanning the M-GE sequence. The primers used for these reactions introduced the 8-nt deletion and the two added nucleotides. The primer pairs for these two reactions were as follows: HPIV3s_BsiWI (ATATCGTACG ATATACAAATAAGAAAAACTTAG)/HPIV3a_MGeDel8 (CCTAAGTT TTT--------CTTATTTGTGCTTCGGCTTAATAG) (upstream fragment) and HPIV3s_MGeDel8 (GCCGAAGCACAAATAAG--------AAAAACT TAGGACAAAAGAG)/HPIV3a_BstEII (GTTGGTCACCACAAGAGTT AGAGTCTTC) (downstream fragment) (dashes denote the deletion of the 8-nt insert, underlining denotes either the BsiWI or BstEII restriction site, and boldface type denotes the two added nucleotides). In the second step, a PCR was performed in which the PCR products of the two previous reactions were used as the template along with the flanking primers HPIV3s_BsiWI and HPIV3a_BstEII to amplify the complete BsiWIBstEII fragment with the M-GE deletion. This BsiWI-BstEII fragment was then substituted into the full-length HPIV3 antigenomic plasmid. The second mutant, MGeDel-2nt, was generated by PCR-based sitedirected mutagenesis of the MGeDel antigenomic cDNA (QuikChange Lightning site-directed mutagenesis kit; Agilent Technologies). This was done with the forward primer GTCCGGACGTACGTCTATTAAGCCGA AGC--AAATAAGAAAAACTTAGG and the reverse primer CCTAAGTT TTTCTTATTT--GCTTCGGCTTAATAGACGTACGTCCGGAC (the 2 inserted CG nucleotides are shown in boldface type, and the 2 deleted nucleotides are shown as dashes). Virus recovery. The M-GE mutant viruses were recovered from transfected BHK BSR-T7/5 cells and propagated in LLC-MK2 cells as described previously (10). By using Lipofectamine 2000 (Life Technologies), BHK BSR-T7/5 cells were transfected with the viral full-length antigenomic plasmid and three support plasmids that provide the required viral proteins N, P, and L. After incubation at 32°C for 4 days, the culture medium supernatant was harvested and passaged onto LLC-MK2 cells twice until cytopathic effects were detected. Recovered virus was amplified by one passage in LLC-MK2 cells at 32°C. Virus titers were determined at 32°C by serial dilution on LLC-MK2 cells in 96-well plates. Inoculated cells were incubated for 7 days, and infection was detected by hemadsorption

3320

jvi.asm.org

(HAD) with guinea pig erythrocytes. Titers are expressed as log10 50% tissue culture infectious doses (TCID50)/ml. Viral genome sequencing was performed to confirm that the recovered recombinant viruses contained the correct genome sequence. Viral RNA was extracted from the virus stocks by using a viral RNA extraction kit (Qiagen, Valencia, CA), with the inclusion of a DNase digestion step to get rid of any contaminating plasmid DNA used for virus recovery. Overlapping fragments of the genome were amplified by reverse transcriptase PCR (RT-PCR) using the SuperScript first-strand synthesis system (Life Technologies) and the Advantage-HF PCR kit (Clontech, Mountain View, CA), followed by sequencing of the RT-PCR fragments. Sequences of the viral genomes were determined in their entirety, except for the 28 and 218 nucleotides at the 3=- and 5=-terminal ends, respectively. Control RT-PCRs lacking the reverse transcriptase indicated that the RT-PCR fragments were derived from viral RNA and not from the input antigenomic cDNA used for virus recovery. Multicycle replication kinetics. Confluent A549 or Vero cells in 6-well plates were infected with the recombinant viruses (wt HPIV3, MGeDel, or MGeDel-2nt) at an input multiplicity of infection (MOI) of 0.01 TCID50/cell in triplicate. At 24-h intervals, starting on day 1 through day 9, 500 ␮l (one-sixth of the volume) of the culture medium supernatant was collected from each well and replaced with fresh medium. The samples were flash-frozen and stored at ⫺80°C. The virus titer of each sample was determined in duplicate by a HAD assay on LLC-MK2 cells, as described above. Plaque assay. The wt HPIV3, MGeDel, or MGeDel-2nt stocks were 10-fold serially diluted, and confluent Vero cells in 24-well plates were inoculated with 100 ␮l per well of each dilution. After 1 h of incubation on a rocking platform at room temperature, 1 ml of overlay medium (OptiMEM I, 0.8% methylcellulose, 2% FBS, 2 mM L-glutamine, 1⫻ penicillinstreptomycin) was added, and the cells were incubated for 7 days at 32°C. The cells were fixed twice with ice-cold 80% methanol for 30 min at 4°C. The fixed cells were treated with blocking solution (5% nonfat milk in 1⫻ phosphate-buffered saline [PBS]) for 1 h. The plaques were stained for 1 h with a polyclonal rabbit anti-HPIV3 hyperimmune serum generated by

Journal of Virology



immunizing rabbits with sucrose-purified HPIV3 virions (MS456; kindly provided by Brian Murphy, NIAID, National Institutes of Health [NIH]) and washed once with blocking solution, followed by incubation with a anti-rabbit horseradish peroxidase-conjugated secondary antibody (Kirkegaard & Perry Labs [KPL], Inc., Gaithersburg, MD) for 1 h. Cells were washed twice with 1⫻ PBS, and the plaques were developed and visualized by adding a peroxidase substrate solution (KPL, Inc.). The stained 24-well plates from three experiments were scanned, and the sizes of a total number of 153, 84, and 128 plaques were measured for wt HPIV3, MGeDel, and MGeDel-2nt, respectively, with ImageJ (W. S. Rasband, U.S. National Institutes of Health, Bethesda, MD, USA [http: //imagej.nih.gov/ij/]). Quantitative RT-PCR (qRT-PCR). Vero cells grown in 6-well plates were inoculated with wt HPIV3, MGeDel, or MGeDel-2nt at an MOI of 5 TCID50/cell. Total RNA was isolated at 24 h postinfection (p.i.) with the RNeasy minikit (Qiagen), with additional on-column DNase digestion according to the manufacturer’s protocol. A total of 0.2 ␮g of RNA was used for reverse transcription of mRNA to cDNA by using an oligo(dT)12–18 primer and the SuperScript first-strand synthesis system for RT-PCR (Life Technologies). The cDNA was used as the template for real-time quantitative PCR with Power SYBR green PCR master mix (Life Technologies). Six different pairs of primers (see Fig. 4A) were used: (i) M-specific forward (positive-sense) primer GGGAAAATCAAACAATGG AACTAGTAATC and F-specific reverse (negative-sense) primer CTATT TGACTTTTTTGGTCCCTTCTCTC, which favor the amplification of M-F readthrough mRNA; (ii) M-specific forward primer GAACTGTAC CCATGGTCCAATAGACTAAG and reverse primer CCATTGACTTAG GAATTTTGAACAAGG, which amplify the M sequence derived from both monocistronic and readthrough mRNAs; (iii) F-specific forward primer GAATTGGTAATAGAATCAATCAACCACCTG and reverse primer GGATCAAGTGCAACAGAATTGTTTAGTG, which similarly amplify the F-specific sequence from both monocistronic and readthrough mRNAs; (iv) N-specific forward primer TTAACGCATTTGGAA GCAACTAATCG and P-specific reverse primer TTGATAGTTTTTAGCA TCGCTTTCCATC, which amplify cDNA derived from N-P readthrough mRNA and which served as a readthrough control; (v) P-specific forward primer GGTGTAATTCAATCCACATCAAAACTAGATTTATATC and reverse primer GTATCTGTGTTAATTTTGTGTCGTTGTCCA, which amplify P sequences from both monocistronic and readthrough transcripts and which served as a loading control for normalization; and (vi) HN-specific forward primer AATTGAAAGTATGGACGATATCTATG CGAC and reverse primer CATTTTATCCTTATATCACTGTAATCAGT AATATCAATTATTC, which amplify monocistronic and readthrough HN transcripts and which were included to assess possible transcriptional changes downstream of the M-GE mutation. The reactions were analyzed in real time on the 2900HT Fast real-time PCR system (Applied Biosystems, Foster City, CA). The PCR products were analyzed by agarose gel electrophoresis to confirm the specificity of amplification. The threshold cycle (CT) for each reaction was determined by the SDS RQ manager program (Applied Biosystems). P amplification was used as the assay endogenous control, which served as an infection and loading control. Fold changes in readthrough and total mRNAs for MGeDel and MGeDel-2nt relative to wt HPIV3 for each primer pair were calculated by the 2⫺⌬⌬CT method (16). Analysis of HPIV3 F protein expression by Western blotting. Western blot analysis was performed to compare the total amount of cellassociated F protein expressed by the MGeDel or MGeDel-2nt virus to that expressed by wt HPIV3. LLC-MK2 cells were seeded into 6-well plates and mock infected or infected with M-GE mutant viruses at an MOI of 5 TCID50/cell. After 24 h p.i., the cells were washed with PBS, lysed with 50 ␮l 1⫻ NuPAGE lithium dodecyl sulfate (LDS) sample buffer (Life Technologies), and homogenized with QIAshredder spin columns (Qiagen). For analysis of the HPIV3 F and HN proteins, 18 ␮l of each sample was reduced with a sample-reducing agent (Life Technologies), denatured (10 min at 70°C), and loaded onto a 4- to 12%-gradient Bis-Tris gel (Life


Technologies). The gel was run in morpholinepropanesulfonic acid (MOPS) buffer (Life Technologies). Proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane by using the iBlot protein transfer system (Life Technologies). Membranes were blocked for 1 h in Li-Cor blocking buffer (Li-Cor, Inc., Lincoln, NE). HPIV3 F was probed with rabbit hyperimmune serum that had been raised against a C-terminal peptide (CYRIQKRNRVDQNDKPYV) of the HPIV3 F protein, which was used at a 1:500 dilution in blocking buffer. The HPIV3 HN protein was probed on a separate blot with a rabbit hyperimmune serum diluted 1:250 in blocking buffer, which reacts with an N-terminal peptide (YWK HTNHGKDAGNELETC) of the HPIV3 HN protein (both the HPIV3 F and HN antibodies were kindly provided by Brian Murphy, NIAID, NIH). As an infection control, a separate blot was performed with 5 ␮l of the same cell lysate and probed with a 1:1,000 dilution of a rabbit HPIV3 hyperimmune serum (MS456) that could detect HPIV3 P and N. Each blot was also probed with a monoclonal mouse anti-alpha-tubulin antibody (Sigma-Aldrich, St. Louis, MO), which served as a loading control. The corresponding infrared-labeled secondary antibodies used for blots were a goat anti-rabbit immunoglobulin G (IgG) 680RD-labeled antibody (Li-Cor, Inc.) and a goat anti-mouse IgG 800CW-labeled antibody (LiCor, Inc.); both antibodies were used at a dilution of 1:10,000. The blots were scanned with an Odyssey infrared scanner and acquired and analyzed with the Odyssey imaging system (Li-Cor, Inc.). To determine the amount of F protein incorporated into the HPIV3 virions, LLC-MK2 cells in 225-cm2 flasks were infected as described above, the culture medium was harvested at 7 days p.i., and viruses were purified by 60 to 30% discontinuous sucrose gradient purification. Purified virus particles were lysed with radioimmunoprecipitation assay (RIPA) buffer (20 mM Tris-HCl [pH 8.0], 200 mM NaCl, 1 mM EDTA, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, Complete protease inhibitor [Roche, Indianapolis, IN]). Virion lysates were analyzed by Western blotting using the same set of antibodies as that used for the infectedcell lysates described above. To ensure equal loading of total virion proteins, a loading control Western blot was performed by using HPIV3 hyperimmune serum, as described above. Analysis of HPIV3 F protein expression on the plasma membrane by flow cytometry. A549 or Vero cells were seeded into 6-well plates and inoculated with wt HPIV3, MGeDel, or MGeDel-2nt at an MOI of 5 log10 TCID50/cell. The cells were harvested at 48 h p.i. with 1 mM EDTA in PBS at 37°C for 5 min and washed twice with ice-cold PBS. The cells were stained with amine-reactive dye (Live/Dead Fixable Dead Cell Stain kit; Life Technologies), according to the manufacturer’s protocol, to distinguish between live and dead cells. The cells were washed with fluorescence-activated cell sorter (FACS) buffer (1⫻ PBS with 2% FBS), and the HPIV3 F protein present on the cell surface was probed with mouse monoclonal anti-HPIV3 F antibody (clone 9-4-3, 1:200 in FACS buffer; Millipore, Billerica, MA). Cells were washed three times with FACS buffer, followed by staining with the secondary goat anti-mouse IgG Alexa Fluor 647 antibody (1:500 in FACS buffer; Life Technologies). The cells were fixed and permeabilized in BD Cytofix/Cytoperm solution (BD Biosciences, San Diego, CA). The samples were then stained for all HPIV3 proteins, as an infection control, with rabbit anti-HPIV3 hyperimmune serum (MS456, 1:1,000 in BD Cytoperm/Wash buffer), followed by secondary donkey anti-rabbit IgG Alexa Fluor 488 antibody (1:500 in BD Cytoperm/Wash buffer; Life Technologies). The stained cells were analyzed by flow cytometry on a BD Canto II flow cytometer (Flow Cytometry Section, Research Technologies Branch, NIAID, NIH), using BD FACSDiva software, and the acquired data were further analyzed with FlowJo software (TreeStar, Ashland, OR). Analysis of HPIV3 F protein expression by immunofluorescence microscopy. Vero cells were seeded onto round coverslips in 24-well plates and infected with the viruses (wt HPIV3, MGeDel, or MGeDel-2nt) at an MOI of 5 log10 TCID50/cell. At 48 h p.i., the cells were washed with PBS and fixed with 4% paraformaldehyde in PBS for 1 h at 4°C. Fixed cells were washed three times with PBS and blocked with 5% bovine serum

Journal of Virology

jvi.asm.org

3321

Lingemann et al.

albumin (BSA) in PBS for 1 h. Cells were then incubated with a primary antibody mixture of monoclonal mouse anti-HPIV3 F antibody (1:200; Millipore) and rabbit anti-HPIV3 hyperimmune serum (MS456, 1:1,000) in a solution containing 1⫻ PBS, 5% BSA, and 0.1% Triton X-100 for 1 h on a rocking platform. The cells were washed three times with a solution containing 1⫻ PBS, 5% BSA, and 0.1% Triton X-100. The secondary antibody mixture (goat anti-mouse Alexa Fluor 488 and goat anti-rabbit Alexa Fluor 647, each diluted at 1:2,000; Life Technologies) was added to the cells, and the cells were incubated for 30 min on a rocking platform. The cells were then washed three times with PBS and mounted with ProLong Gold (Life Technologies) that also contained 4=,6-diamidino-2-phenylindole (DAPI) for staining of the nuclei. Images were collected on a Leica TCS SP5 confocal microscope (Leica Microsystems, Mannheim, Germany), using a 63⫻ oil immersion objective with a numerical aperture (NA) of 1.4. Visualization was done by using an argon laser at 488 nm (for Alexa Fluor 488), a white-light laser at 647 nm (Alexa Fluor 647), and a diode laser at 405 nm (DAPI). The images of three channels were acquired sequentially and later merged. Images were processed with Leica LAS-AF software (version 3.2), Imaris 7.7.1 (Bitplan AG, Zurich, Switzerland), and Adobe Photoshop CS5 (Adobe Systems). Virus replication and immunogenicity in hamsters. All animal studies were approved by the NIH Institutional Animal Care and Use Committee (IACUC). Six-week-old Golden Syrian hamsters in groups of 18 were confirmed to be seronegative for HPIV3 by a hemagglutination inhibition (HAI) assay and were anesthetized and inoculated intranasally with a 100-␮l solution containing 6 log10 TCID50 of wt HPIV3, MGeDel, or MGeDel-2nt or were mock infected. At 3 and 5 days p.i., 6 hamsters from each group were euthanized per time point, nasal turbinate and lung tissues were collected separately, and virus replication was quantified by serial dilution on LLC-MK2 cells, followed by a HAD assay using guinea pig erythrocytes. At 28 days p.i., sera were collected from the remaining 6 hamsters in each group to assess immunogenicity by an F-protein-specific enzyme-linked immunosorbent assay (ELISA). At 5 weeks p.i., the hamsters were challenged with 6 log10 TCID50 of wt HPIV3. The animals were euthanized at 3 days postchallenge, lungs and nasal turbinates were collected, and viral titers were determined by a HAD assay, as described above. HPIV3 F-specific IgG ELISA. An indirect ELISA was developed to measure the amount of HPIV3 F-specific IgG in the sera of immunized hamsters at 28 days p.i. Immulon 1B microtiter plates (Thermo Scientific) were coated overnight at 4°C with affinity-purified HPIV3 F protein (kindly provided by Brian Murphy, NIAID, NIH) as an antigen that was diluted 1:100 in carbonate-bicarbonate buffer. From here onwards, all steps were performed at room temperature. After washing with 0.05% Tween 20 in PBS (PBS-T), the plates were blocked with 5% BSA in PBS for 30 min and washed again with PBS-T. The serum samples were 4-fold serially diluted in PBS-T, and 50 ␮l of each dilution was added to the coated plates in duplicate. The plates were incubated for 2 h on a shaking platform and then washed three times with PBS-T. To detect the bound F-specific IgG, a horseradish peroxidaseconjugated rabbit anti-hamster IgG antibody (1:10,000; Abcam, Cambridge, MA) was used. After 2 h of incubation, the plates were washed three times with PBS-T. The presence of F-specific antibodies was finally detected by a color reaction of the peroxidase with o-phenylenediamine dihydrochloride (OPD) (SigmaFAST OPD tablets; SigmaAldrich). The reaction was stopped by adding 50 ␮l 3 M HCl to the mixture, and the absorbance was measured at 492 nm by using the Synergy2 ELISA reader (BioTek, Winooski, VT). The average background value determined for the serum negative blank control was subtracted from the value for all samples, and the fold change in the level of anti-F antibodies induced by the MGeDel or MGeDel-2nt virus compared to the level induced by wt HPIV3 was calculated. HPIV3 clinical isolate sequences. The genome sequences of the HPIV3 clinical isolates analyzed in this study were derived from the following NCBI GenBank accession numbers: KF530225, KF530226,

3322

jvi.asm.org

KF530229, KF530230, KF530232, KF530233, KF530241, KF530242, KF530243, KF530245, KF530250, KF530251, KF530252, KF530253, KF687321, KF687340, KJ672546, KJ672547, KJ672565, KJ672595, and KJ672605.

KF530234, KF530247, KF530256, KJ672558,

KF530236, KF530249, KF530257, KJ672559,

RESULTS

Generation of recombinant HPIV3 in which the aberrant M-GE signal has been “repaired.” Reverse genetics was used to generate two mutant viruses, MGeDel and MGeDel-2nt, in which the 8-nt insert in the M-GE sequence was deleted, thus making the M-GE signal similar to the other HPIV3 GE signals. In order to maintain the “rule of six,” it was necessary to add two additional nucleotides, and these nucleotides were added to the upstream NTR of the M gene in two different versions in order to control for possible sequence context effects. Both of the M-GE deletion mutant viruses were readily recovered and replicated efficiently. After the viruses were propagated on LLC-MK2 cells for three passages, the viral genome sequences were determined and were found to be free of adventitious mutations. Repair of the M-GE signal has no effect on virus replication in vitro. The efficiency of replication in cell culture was determined by a multicycle growth curve in Vero cells, an African green monkey epithelial cell line lacking the ability to produce type I interferon (IFN) (17), and in A549 cells, a human lung epithelial cell line that is competent for IF⌵ induction. Cells were infected at an MOI of 0.01 TCID50/cell, aliquots of the culture medium were harvested daily, and viral titers were quantified by limiting dilution. All three viruses (wt HPIV3, MGeDel, and MGeDel-2nt) had similar growth kinetics and viral titers in both Vero and A549 cells (Fig. 3A). For all viruses, the titer reached a peak of ⬃8 log10 TCID50/ml at day 4 and day 3 p.i. in Vero and A549 cells, respectively. Upon visual microscopic examination of the infected cells, typical HPIV3-associated cytopathic effects, including focal rounding of cells, were observed for all viruses, with no evidence of mutant-specific differences (data not shown). The MGeDel and MGeDel-2nt mutant viruses form larger plaques. To investigate the ability of the mutant viruses to form plaques, Vero cells were inoculated with serially diluted viruses and incubated under a methylcellulose overlay. At 7 days p.i., the infected monolayers were immunostained to visualize the plaques. As shown in Fig. 3B, the plaques of both the MGeDel and MGeDel-2nt mutant viruses had significantly larger diameters and showed more intense staining than did those of wt HPIV3. Measurement of the sizes of individual isolated plaques, using the ImageJ program, revealed average increases of plaque diameter of 3.8-fold and 2.9-fold for the MGeDel and MGeDel-2nt viruses, respectively, compared to wt HPIV3 (Fig. 3C). Although there was some variation in plaque size within each well, the mean size differences compared to wt HPIV3 were highly significant (P ⬍ 0.0001). Since virus replication in cell culture was unaffected by the mutation, as described above, the larger plaque size presumably was not due to enhanced replication and instead may be indicative of increased cell surface viral protein expression that may promote cell-to-cell spread, which is also suggested by the higher intensity of immunostaining. The MGeDel and MGeDel-2nt mutants have reduced M-F readthrough transcription. We investigated the effect of deletion of the 8-nt insert on the expression of readthrough M-F mRNA versus monocistronic M and F mRNAs. This was done by using

Journal of Virology



FIG 3 Replication of wt HPIV3 and the M-GE mutant viruses in vitro. (A) Multistep growth kinetics. Monolayer cultures of Vero and A549 cells were infected with each virus at an MOI of 0.01 TCID50/cell in triplicate. The plates were incubated at 32°C, and aliquots of the culture supernatant were collected at 24-h intervals over 9 days. Virus titers, shown as log10 TCID50/ml, were determined by limiting dilution on LLC-MK2 cells using a hemadsorption assay. Mean titers and standard deviations are shown. (B) Plaque phenotype in Vero cells. wt HPIV3 and the MGeDel and MGeDel-2nt viruses were serially diluted on Vero cells and incubated at 32°C in overlay medium containing methylcellulose. Cells were fixed with methanol at 7 days p.i., and plaques were stained with rabbit HPIV3 hyperimmune serum, followed by staining with a peroxidase-conjugated secondary antibody. Representative examples of plaque phenotype are shown for each virus. (C) Fold change in the plaque size of mutants relative to wt HPIV3. The plaque sizes of single isolated plaques were measured by using ImageJ and calculated as the fold change relative to the size of wt HPIV3 plaques. The means ⫾ standard deviations are shown as a bar graph. The plotted data were obtained from three independent experiments with 2 replicates each. The sizes of a total number of 153, 84, and 128 plaques were measured for wt HPIV3, MGeDel, and MGeDel-2nt, respectively, obtained from three experiments. Statistical analysis was performed by using one-way analysis of variance with Tukey’s multiple-comparison posttest, and the significance of the difference between viruses is indicated (ⴱⴱⴱⴱ, P ⬍ 0.0001).

real-time quantitative RT-PCR. Total RNA was isolated from infected Vero cells and subjected to reverse transcription with an oligo(dT) primer. The use of oligo(dT) as a primer favors the reverse transcription of poly(A) tail-containing mRNAs and disfavors the reverse transcription of the viral genome and antigenome, although it is recognized that this preference is not absolute, since genomes and antigenomes contain short internal runs of poly(A) at various positions. The oligo(dT)-primed cDNA was used for a SYBR green real-time PCR assay to quantify the amounts of viral mRNAs (Fig. 4). Six different PCR primer pairs were used to detect various readthrough versus total (readthrough plus monocistronic) mRNAs (Fig. 4A). As shown in Fig. 4Ai, a primer pair consisting of forward and reverse primers from the M and F genes, respectively, amplifies M-F readthrough mRNA but not monocistronic M or F mRNA. Two other primer pairs have forward and reverse primers within the M gene (Fig. 4Aii) or the F gene (Fig. 4Aiii) and amplify total mRNA (monocistronic and readthrough) of the respective genes. Another primer pair (Fig. 4Aiv) has forward and reverse primers from the N and P genes, respectively, and preferentially amplifies readthrough N-P mRNA. This primer pair served as a control to confirm that the


effects on readthrough transcription were specific to the M-F junction. Another primer pair (Fig. 4Av) has forward and reverse primers within the P gene, whose transcription should not be affected by effects on the downstream M-F junction. This primer pair amplifies total (readthrough and monocistronic) P mRNA. Another primer pair (Fig. 4Avi) has forward and reverse primers within the HN gene, which serve to monitor effects on a gene downstream of the M-F junction. This primer pair amplifies total (readthrough and monocistronic) HN mRNA. The results for the M-F, M, F, N-P, and HN primer pairs were normalized to the results for the P amplicon from the same virus and are expressed as fold changes in expression levels relative to that of wt HPIV3 (Fig. 4B). (Note that semiquantitative RT-PCR showed that the levels of P mRNA in wt HPIV3 and the mutant viruses were indistinguishable [data not shown].) Any background signal arising from the genome/antigenome would be present with each of the primer pairs and thus should not affect comparisons. The levels of total (readthrough plus monocistronic) M and F mRNAs were found to be similar in both M-GE mutant viruses compared to wt HPIV3 (Fig. 4B). Thus, there did not appear to be any change in the total amount of transcription of either the M or

Journal of Virology

jvi.asm.org

3323

Lingemann et al.

FIG 4 Quantitative RT-PCR of M-F readthrough mRNA versus total F mRNA. (A) Schematic representation of primer binding sites for primer pairs designed to detect readthrough versus total (readthrough plus monocistronic) mRNA for the indicated genes. Upstream and downstream arrows represent forward and reverse primers, respectively. The M-F- and N-P-specific primers detect only the respective readthrough mRNAs, whereas the M-, F-, P-, and HN-specific primers detect both the monocistronic and readthrough mRNAs. (B) SYBR green-based real-time quantitative RT-PCR. Vero cells were infected with the indicated viruses at an MOI of 5 TCID50/cell and incubated for 24 h, after which total RNA was isolated. Reverse transcription was performed with oligo(dT)12–18 to favor reverse transcription of mRNA. PCRs were set up in triplicates. The CT was determined, the results for each sample (wt HPIV3, MGeDel, and MGeDel-2nt) were normalized to the value for the P amplicon from the same virus, and the fold change relative to the wt HPIV3 value was calculated by the 2⫺⌬⌬CT method. Data are shown as mean fold changes relative to wt HPIV3 values, with error bars indicating standard deviations. The data shown were derived from 3 independent experiments with 3 replicate reactions for each gene per virus per experiment. The statistical significance of the difference between the indicated viruses was determined by one-way analysis of variance with Tukey’s multiple-comparison posttest and is indicated (ⴱⴱⴱⴱ, P ⬍ 0.0001).

F gene in response to a modification of the M-GE signal. In contrast, the level of the readthrough M-F mRNA was significantly (P ⬍ 0.0001) reduced for the mutants compared to wt HPIV3 (Fig. 4B). Since the amount of M-F readthrough mRNA was sharply reduced, while the amount of total (readthrough plus monocistronic) F mRNA was not affected, this indicates that the mutant viruses had a reciprocal increase in monocistronic F mRNA levels. The N-P control PCR showed no change in N-P readthrough mRNA synthesis for these upstream genes, indicating that the effect was specific to the M-F junction, as would be expected. Also, the total transcript level of the HN gene, located downstream of the mutation site, was unaffected. This indicated that while the repair of the M-GE signal shifted the balance from the synthesis of readthrough M-F mRNA to the synthesis of monocistronic F mRNA, it did not quantitatively affect the flow of transcription down the genome or otherwise affect upstream or downstream genes. The MGeDel and MGeDel-2nt viruses have higher levels of F protein in infected cells and virus particles. Since the deletion of the 8-nt insert in the M-GE signal resulted in a shift from the synthesis of M-F readthrough mRNA to monocistronic F mRNA, which should be more efficiently translated (9), the mutant viruses might have increased synthesis of F protein. The expression of F protein in virus-infected cells was investigated by three different approaches: (i) Western blot analysis of total cell lysates and purified virions, (ii) flow cytometry of infected cells to examine cell surface F protein expression, and (iii) immunofluorescence microscopy to determine the sites of accumulation and the relative abundance of F protein in infected cells. For all three experiments, cells were infected at an MOI of 5 TCID50/cell to obtain efficient infection. For Western blot analysis, cells were harvested at 24 h p.i., and

3324

jvi.asm.org

lysates were subjected to polyacrylamide gel electrophoresis under denaturing and reducing conditions. Following blot transfer, the F protein was detected with rabbit polyclonal antibodies raised against a synthetic peptide corresponding to the C-terminal end of HPIV3 F (Fig. 5A). These antibodies detected the uncleaved F0 precursor and the larger F1 subunit of the cleaved F protein (18, 19). For all viruses, the F0 precursor was found to be much more abundant than F1 in the infected-cell lysate and showed a substantial increase for MGeDel and MGeDel-2nt compared to wt HPIV3 (Fig. 5A). Since the expression of the F1 form was overall much weaker for all viruses, the differences between viruses were not very discernible due to weakly stained bands. Infections and Western blot experiments were done three times. The increase in F protein expression levels ranged from 2.3- to 4.7- and 4.6- to 12.2fold for MGeDel and MGeDel-2nt, respectively, compared to wt HPIV3 (F0 quantification). The fold increase in F expression levels varied between replicates due to the low expression levels and weak bands of F in the wt HPIV3 lysates. Nevertheless, an increase in the F protein expression level was observed for the mutants in all experiments. Parallel Western blots with the same lysates were probed with rabbit polyclonal antibodies raised against a synthetic peptide corresponding to the N-terminal end of HPIV3 HN or a rabbit polyclonal hyperimmune serum. This antiserum reacted with a number of bands specific to HPIV3, including the viral P and N proteins. The accumulation of the latter viral proteins was not different between wt HPIV3 and the mutant viruses (Fig. 5A), consistent with the idea that the total amount of transcription was unchanged and that genes other than M and F were unaffected. The blots were also probed with tubulin-specific antibody, which confirmed the equivalence of sample loading (Fig. 5A). To investigate whether the increase in the level of intracellular F protein expression by the M-GE mutant viruses resulted in an

Journal of Virology



FIG 5 Analysis of HPIV3 F, HN, P, and N proteins present in infected cells and virions by Western blotting. (A) Level of expression of the F protein in virusinfected cells. LLC-MK2 cells were infected (MOI ⫽ 5 TCID50/cell) with the indicated viruses and harvested at 24 h p.i. by lysis in LDS sample buffer. The samples were denatured, reduced, subjected to polyacrylamide gel electrophoresis, and analyzed by Western blotting. Portions of blots that reacted with several different antibodies are shown. The HPIV3 F protein was detected with rabbit antibodies raised against a synthetic peptide corresponding to the C-terminal region of the HPIV3 F protein (top blot). Parallel Western blots were probed with antibodies raised against a synthetic peptide corresponding to the N-terminal region of the HPIV3 HN protein (second blot from the top); rabbit HPIV3 hyperimmune serum, revealing the P and N proteins (third blot from the top); or anti-tubulin antibody as a loading control (bottom blot). (B) Incorporation of the F protein into HPIV3 virions. LLC-MK2 cells were infected as described above, and the virus-containing supernatant was harvested at 7 days p.i. and subjected to sucrose gradient centrifugation to obtain purified virions. Equal amounts of protein derived from the indicated sucrosepurified virions were denatured, reduced, and subjected to polyacrylamide gel electrophoresis and Western blotting. Viral proteins were detected with the antibodies described above. Representative examples of the Western blot profiles from three independent experiments are shown. Arrows indicate the positions of the proteins (right), and the positions of molecular mass markers (kDa) are shown on the left.

increased incorporation of F into the virus particle, virions were purified from the culture medium by sucrose gradient centrifugation and analyzed on Western blots. In the virions, most of the F protein detected was the F1 subunit, with trace amounts of F0 protein (Fig. 5B). This comparison showed that both M-GE mutants had a marked increase in the incorporation of F protein into virus particles compared to wt HPIV3. The fold increase in F protein incorporation ranged from 2.9- to 5.8- and from 3.2- to 5.1fold for MGeDel and MGeDel-2nt, respectively, relative to wt HPIV3 (F1 quantification), whereas the incorporation of the P, N, and HN proteins was unaffected (Fig. 5B). Next, flow cytometry was performed to quantify cell surface expression of the HPIV3 F protein. Infected Vero and A549 cells were harvested at 48 h p.i., stained with a mouse monoclonal antibody (MAb) that reacts with the native form of HPIV3 F, incubated with fluorescently tagged anti-mouse IgG antibodies, fixed, permeabilized, stained for HPIV3 proteins by using rabbit HPIV3 hyperimmune serum, and incubated with anti-rabbit IgG antibodies conjugated to a different fluorescent marker. The cells were analyzed by flow cytometry that was gated on live, single, infected cells stained with antivirion antibodies (Fig. 6A and C), followed by gating on cells positive for the F-specific antibody (Fig. 6B and D). For each cell type and for each virus, the HPIV3-


positive cells resolved as a clear single peak of cells with surface expression of the F protein (Fig. 6B and D). In both cell types, the MGeDel and MGeDel-2nt mutants expressed substantially more cell surface F protein than did wt HPIV3. Specifically, in Vero cells, the mutants expressed 4.3- and 4.7-fold more F protein (P ⬍ 0.0001), respectively, and in A549 cells, they expressed 2.5and 3.1-fold more F protein, respectively (P ⬍ 0.0001) (Fig. 6E and F). The difference between the mutants and wt HPIV3 may have been less pronounced in A549 cells because the overall level of expression in A549 cells was 2- to 3-fold higher than that in Vero cells (Fig. 6E) and may have been approaching an upper limit. To further characterize the expression pattern and cellular localization of the F protein in infected cells, immunofluorescence staining for F protein was performed. Vero cells were infected and at 48 h p.i. were fixed with paraformaldehyde, permeabilized, and stained with the mouse F-specific MAb and rabbit HPIV3 hyperimmune serum, followed by staining with the corresponding fluorochrome-conjugated secondary antibodies. The cell nuclei were stained with DAPI. wt HPIV3-infected cells had relatively weak staining for F protein, with the protein being localized mostly as aggregates (Fig. 7). In contrast, the expression level of the F protein in cells infected with the M-GE mutant viruses was substantially higher, and the F protein was present as diffuse staining as well as localized aggregates (Fig. 7). As expected, cells infected with the M-GE mutants or wt HPIV3 had similar staining patterns and intensities when stained with the HPIV3 hyperimmune serum because it probes for multiple HPIV3 proteins in addition to F. Effect of deletion of the 8-nt M-GE insert on virus replication and immunogenicity in hamsters. The replication and immunogenicity of the M-GE mutants were compared to those of wt HPIV3 in the Golden Syrian hamster model. Six-week-old hamsters in groups of 18 were inoculated intranasally with 6 log10 TCID50 of wt HPIV3, MGeDel, or MGeDel-2nt. On days 3 and 5 p.i., 6 animals per time point from each group were euthanized, and nasal turbinates and lungs were collected. Tissue homogenates were prepared, and viral titers were determined by limiting dilution and HAD. The virus titers are reported as log10 TCID50 per gram of either the nasal turbinate (upper respiratory tract [URT]) or lung (lower respiratory tract [LRT]) tissue. The virus titers for each individual animal as well as the means for each experimental group are shown in Fig. 8. On day 3 p.i., the mean titers of wt HPIV3, MGeDel, and MGeDel-2nt were 6.7, 6.9, and 7.1 log10 TCID50/g in the URT and 6.2, 6.4, and 6.5 log10 TCID50/g in the LRT, respectively (Fig. 8). On day 5 p.i., the mean titers of wt HPIV3, MGeDel, and MGeDel2nt were 5.9, 6.8, and 6.1 log10 TCID50/g in the URT and 6.0, 6.2, and 6.1 log10 TCID50/g in the LRT, respectively (Fig. 8). In the LRT, the virus titers showed little change from day 3 p.i. to day 5 p.i., and there were no significant differences between wt HPIV3 and the M-GE mutants. In the URT, the titers of wt HPIV3 and the MGeDel-2nt virus were lower on day 5 than on day 3 p.i., whereas that of MGeDel stayed almost the same as that on day 3 p.i. The titer of the MGeDel virus in the URT on day 5 p.i. was found to be significantly (P ⬍ 0.01) higher than that of wt HPIV3, but no other significant differences between MGeDel and wt HPIV3 were observed. In addition, the titers of MGeDel-2nt and wt HPIV3 were not significantly different for either anatomical location on either day. Sera were collected from the 6 remaining hamsters per group 4

Journal of Virology

jvi.asm.org

3325

Lingemann et al.

FIG 6 Analysis of the expression of HPIV3 F on the surface of Vero and A549 cells by flow cytometry. Monolayer cultures of Vero and A549 cells were infected with the indicated viruses (MOI ⫽ 5 TCID50/cell) and harvested with EDTA at 48 h p.i. The cells were stained without permeabilization by using Aqua Live/Dead dye, followed by staining with an F-specific mouse MAb and by Alexa Fluor 647 (AF647)-conjugated secondary goat anti-mouse antibodies. Next, the cells were fixed, permeabilized, and stained with rabbit hyperimmune serum against purified HPIV3 virions, followed by staining with Alexa Fluor 488-conjugated secondary donkey anti-rabbit antibodies. The cells were gated to include only single, live cells, followed by visualization of antibody staining. (A and C) Representative histograms showing staining by antibodies against HPIV3 virions (HPIV3-AF488) of Vero (A) and A549 (C) cells that had been infected with wt HPIV3, the MGeDel mutant, or the MGeDel-2nt mutant or that had been mock infected. The boxes indicate HPIV3-positive cells that were gated for further analysis. (B and D) Representative histograms showing cell surface staining of the gated HPIV3-positive cells from panels A and C, respectively, with an F-specific MAb. Mock-infected cells were stained and analyzed in parallel; the histogram shows the stained mock control gated on single live cells. The x axis shows the intensity of antibody staining, and the y axis is the percent cell count normalized to the maximum count. (E) Cell surface F protein median fluorescence intensity (MFI) for each virus in each cell line derived from three independent experiments. (F) Fold change in cell surface F protein expression levels for M-GE mutants relative to wt HPIV3 from the data shown in panel E. The indicated values are means obtained from 3 independent experiments, and error bars represent standard deviations. The statistical significance of the difference between the indicated viruses was determined by one-way analysis of variance with Tukey’s multiplecomparison posttest and is indicated (ⴱⴱⴱⴱ, P ⬍ 0.0001).

weeks following inoculation to investigate the magnitudes of the F-specific serum antibody responses to the mutant and wt viruses. For this purpose, we developed an F-specific ELISA with purified HPIV3 F protein as the solid-phase antigen. Each serum sample was analyzed in duplicate. The captured F-specific IgG was detected with a peroxidase-conjugated rabbit anti-hamster IgG secondary antibody. The data are reported as fold changes relative to wt HPIV3 (Fig. 9) based on the absorbance at 492 nm. The IgG response varied among animals within the same group, as shown, but on average, there was a significant (P ⬍ 0.001) 50% increase in the level of F-specific IgG in hamsters immunized with the MGeDel and MGeDel-2nt viruses compared to the level in ham-

3326

jvi.asm.org

sters immunized with wt HPIV3. These results showed that the increased expression level of the F protein observed for the M-GE mutants resulted in an increased stimulation of F-specific serum antibodies during in vivo infection. To determine the serum virus-neutralizing activity, sera from immunized hamsters were analyzed by a 60% plaque reduction neutralization test (PRNT60) using green fluorescent protein (GFP)-expressing HPIV3 in the presence of guinea pig complement, as previously described (20). No significant differences in neutralization activity were detected for the three viruses (data not shown), which may reflect the dominance of HN as the major neutralization antigen.

Journal of Virology



FIG 9 HPIV3 F-specific serum IgG ELISA. Sera from wt HPIV3-, MGeDel-, and MGeDel-2nt-infected hamsters were collected at 28 days p.i., diluted 1:16, and analyzed by an indirect ELISA using plates coated with affinity-purified HPIV3 F protein. The values for each individual animal are shown as fold changes relative to the means for wt HPIV3 based on the absorbance at 492 nm. The group means and standard deviations are indicated as horizontal bars for each group. The statistical significance of the difference in the IgG titers among viruses was determined by one-way analysis of variance and Tukey’s multiplecomparison posttest, and significant differences are indicated (ⴱⴱⴱ, P ⬍ 0.001).

FIG 7 Immunofluorescence confocal microscopy of infected cells. Monolayer cultures of Vero cells were infected with the indicated viruses (MOI ⫽ 5 TCID50/cell) and fixed at 48 h p.i. The cells were permeabilized and stained with an HPIV3 F-specific murine MAb (green) or a rabbit HPIV3 hyperimmune serum (red). The nuclei were stained with DAPI to localize the cells. The images were acquired with a Leica TCS SP5 confocal microscope using a 63⫻ oil immersion objective with an NA of 1.4 and a 2⫻ zoom. Bar, 20 ␮m.

At 5 weeks postinoculation, the 6 remaining hamsters in each group were challenged with wt HPIV3 to assess protective immunity. Each animal received 6 log10 TCID50 of wt HPIV3 by intranasal inoculation. On day 3 postchallenge, all of the animals were

FIG 8 Replication of viruses in the upper respiratory tract (URT) and lower respiratory tract (LRT) of Golden Syrian hamsters. Animals were infected intranasally with 6 log10 TCID50 of the indicated viruses in 100 ␮l per animal. Six animals from each group were euthanized at 3 days p.i. (A) and 5 days p.i. (B), and nasal turbinates (URT) and lungs (LRT) were collected and processed for virus titration. The tissue virus titer for each individual animal is shown, and the average for each group is indicated by a horizontal bar. The differences in virus titers were statistically compared by one-way analysis of variance and Tukey’s multiple-comparison test. The significance of differences is indicated (ⴱⴱ, P ⬍ 0.01).


euthanized, nasal turbinates and lungs were collected and processed into tissue homogenates, and viral titers were determined by limiting dilution, as described above. In the mock-inoculated control group, challenge wt HPIV3 replicated to mean titers of 6.7 log10 TCID50/g (standard deviation [SD] ⫽ 0.3 log10 TCID50/g) in the URT and 6.2 log10 TCID50/g (SD ⫽ 0.2 log10 TCID50/g) in the LRT. In contrast, the animals that had been inoculated on day 0 with wt HPIV3, MGeDel, or MGeDel-2nt had no detectable challenge virus replication (assay limit of detection, ⱕ1.5 log10 TCID50/g). Thus, wt HPIV3 and each of the M-GE mutants induced complete protection against a short-term challenge infection irrespective of the amount of expressed F protein. DISCUSSION

For the Mononegavirales, the gene order and the polar gradient of transcription are major factors determining the relative molar amounts of expressed viral proteins. The polar gradient occurs because, during sequential transcription, a fraction of the polymerase molecules at each gene junction fails to reinitiate at the next gene and instead falls off and is unavailable to transcribe downstream genes (21). In addition to this basal regulation, a number of mononegaviruses have developed mechanisms to further fine-tune the expression of specific genes at the level of transcription or translation. An example is the L gene of some viruses such as vesicular stomatitis virus (VSV) and rabies virus, whose expression is reduced due to the long IG sequence preceding the L-GS signal (22, 23). For VSV (Indiana), specific sequences outside the conserved gene junction also have an impact on this regulation (24). Other proteins, such as the paramyxovirus C proteins, are expressed less efficiently because ribosomes that access the P/C mRNA are partitioned between the P and C ORFs (21). In other cases, such as the RSV small hydrophobic SH protein, the use of a suboptimal translational start site reduces expression (25). We also note that several paramyxoviruses related to HPIV3 have various mechanisms involving the M-F gene junction that are designed to downregulate the expression of monocistronic F mRNA and F protein. For instance, in the case of parainfluenza virus type 5, a single nucleotide within the M-GE sequence located

Journal of Virology

jvi.asm.org

3327

Lingemann et al.

5 positions upstream of the oligo(U) tract enhances M-F readthrough transcription (26). For Sendai virus (SeV), the GS signal of the F gene has a reduced efficiency, resulting in the reduced transcription of the F gene as well as of downstream genes (27). Interestingly, simian virus 41 completely lacks any apparent M-GE signal, and the M gene is transcribed exclusively as an M-F bicistronic mRNA with reduced monocistronic F transcription (26, 28). HPIV1, on the other hand, has several cis-acting elements, including the M-F intergenic sequence, the F-GS signal, and a long upstream NTR in the F gene, which together attenuate M gene transcription termination, promote higher levels of M-F readthrough, and result in reduced expression levels of F protein in infected cells (29). Thus, downregulation of F protein expression appears to be a common goal of a number of HPIV3-related viruses. The amount of F protein expressed during infection is important because it is an essential component of the virion that mediates the fusion of the virus envelope with the host cell membrane for virus entry, and when expressed in infected cells, F also promotes cell-to-cell fusion and virus spread. However, there may be a number of reasons why it might be favorable for the virus to restrain the production of F protein. In the case of SeV, replacement of the suboptimal GS signal of the F gene resulted in increased F protein production, increased replication in vitro and in vivo, and increased pathogenesis (27). It was hypothesized that it may be in the virus’s favor to reduce pathogenicity in order to better coexist with the host and thereby facilitate spread. Another possible advantage of reduced F protein production is that a reduction in the abundance of a major protective antigen might reduce the magnitude of the host immune response, delaying viral clearance and facilitating reinfection, but this had not been previously demonstrated. wt HPIV3 was previously shown to have an aberrant M-GE signal with an apparent 8-nt insert, and this was associated with increased synthesis of M-F readthrough mRNA (6). Recently, we scanned the image of the previously reported Northern blot and estimated that the ratio of M-F readthrough to monocistronic F mRNAs is ⬃2:3 (6). We previously speculated that this aberrant M-GE signal might have the effect of reducing the synthesis of monocistronic F mRNA, although this and other possible effects of the aberrant M-GE signal could not be investigated prior to the advent of reverse genetics systems. The present study used reverse genetics to “repair” the apparent 8-nt insert, with two slightly different viruses being created to control for possible effects of sequence context. We then examined the global effects on gene transcription, viral protein synthesis, the incorporation of viral proteins into virions, viral fitness in vitro and in vivo, and immunogenicity and protective efficacy. We evaluated the effects of the deletion of the 8-nt insert from the M-GE signal on viral transcription using qRT-PCR. Primer pairs were designed to span gene pairs and thus detect readthrough mRNAs or to prime within genes and thus detect total (readthrough plus monocistronic) mRNA. We analyzed the expression of the M, F, M-F, P, N-P, and HN transcripts. This analysis showed that the amount of M-F readthrough mRNA was reduced 4-fold or more (P ⬍ 0.0001) with the two M-GE mutant viruses compared to wt HPIV3, whereas the total amount of F mRNA (readthrough plus monocistronic) remained unchanged. The observation that the amount of M-F readthrough mRNA was greatly decreased whereas the total amount of F mRNA was unchanged indicates that there was a commensurate increase in the

3328

jvi.asm.org

amount of monocistronic F mRNA associated with the repair of the M-GE signal. The magnitudes of the effect differed slightly between the two different mutant viruses, which was not further investigated but might reflect experimental variability or sequence context effects on the M-GE signal. Overall, the qRT-PCR data showed that the elongated M-GE sequence in wt HPIV3 serves as a weak transcription termination signal and promotes M-F readthrough transcription at the expense of monocistronic F mRNA, with no change in the total amount of F transcript. The levels of total P, N-P, total M, and total HN transcripts were the same in the M-GE mutant viruses compared to wt HPIV3, indicating that the presence or absence of the 8-nt insert in the M-GE signal did not affect genes other than M and F and did not increase or decrease the overall level of transcription. The production of an increased level of M-F readthrough mRNA at the expense of monocistronic F mRNA by wt HPIV3 would be expected to result in a reduced production of F protein, since the distal ORF in a readthrough mRNA would be expected to be inefficiently translated compared to the same ORF contained in a monocistronic mRNA. Consistent with this expectation, the repaired M-GE mutant viruses expressed substantially higher levels of cell-associated F protein detected by various methods, including Western blotting, flow cytometry, and immunofluorescence microscopy, than did wt HPIV3. The total amount of cell-associated F protein detected by Western blotting was markedly increased in the M-GE mutant viruses. The more abundant F protein expressed by the M-GE mutants appeared to be correctly processed and incorporated into the plasma membrane, as indicated by the significant increase in the cell surface expression of F protein detected by flow cytometry. Furthermore, this resulted in an increase in the amount of F protein packaged into virions, compared to wt HPIV3. These data clearly demonstrate that the aberrant M-GE signal present in wt HPIV3 results in reduced F protein expression in infected cells, on the surface of infected cells, and in HPIV3 virions. In contrast, the levels of expression of the P, N, and HN proteins, representing upstream and downstream genes, were unchanged, consistent with the finding that the levels of the corresponding mRNAs were unchanged. It might have been expected that in wt HPIV3, the higher level of M-F readthrough would be associated with an increased transcription of downstream genes compared to the mutants. This is because the sequential transcription of mononegaviruses is attenuated at each gene junction due to polymerase falloff, and increased readthrough would avoid attenuation at the junction in question and provide more polymerase to downstream genes. However, an increased expression of downstream genes in wt HPIV3 was not observed. Previous studies of the relative molar amounts of intracellular mRNAs of Sendai virus (30), measles virus (31), and respiratory syncytial virus (32) showed that the transcription gradient was mostly not steep or consistent, and in many cases, adjacent genes yielded comparable levels of mRNA. This indicates that factors other than transcriptional attenuation at gene junctions played a major role in controlling relative gene expression and presumably overshadowed the effects of the M-GE signal. Somewhat surprisingly, the increased F protein synthesis and increased incorporation of F into virions did not affect the replication efficiency of the M-GE mutant viruses during multicycle growth in vitro compared to wt HPIV3. This was true for both IFN-lacking (Vero) and IFN-competent (A549) cells. There was

Journal of Virology



also no detectable increase in cytopathic effects for the mutant viruses versus wt HPIV3 in monolayer cultures in liquid medium. However, under a methylcellulose overlay, the M-GE mutants exhibited a significant increase in plaque diameter and intense plaque staining compared to wt HPIV3. The increase in the intensity of plaque staining with an antibody raised against purified virions presumably was due to increased F protein expression and was consistent with the other evidence of increased F expression described above. The increase in plaque size may be indicative of increased cell-to-cell spread by fusion, although this was not associated with increased cytopathic effects in liquid medium. There also was no consistent effect on virus replication in vivo or any effect on pathogenicity in vivo. In hamsters, replication in the URT was significantly increased on day 1 for one of the two mutant viruses but not for both viruses and not in the lungs on that day for either virus or in either anatomical compartment for either virus on day 3. This general lack of increased viral replication in vitro and in vivo is contrary to expectations based on a previous study with SeV, where the replacement of the suboptimal F-GS signal and the resulting increase in F protein expression resulted in increased viral replication and pathogenicity in mice (27). The difference in the results for these two viruses may lie in the observation that in the SeV study, there was also an increase in the expression of the downstream genes, including HN. This is consistent with the expectation that the replacement of a suboptimal GS signal would result in increased transcription for that gene and all downstream genes. In contrast, in the present study, repair of the aberrant M-GE signal of HPIV3 shifted synthesis from M-F readthrough mRNA to monocistronic F mRNA but did not change the total amount of transcription of any gene. Since the HN protein of a number of paramyxoviruses stabilizes the prefusion form of HPIV3 F (33) and is known to enable F-mediated fusion by interacting with the F protein (34–37), it is likely that increased F protein production may result in increased viral replication only if HN protein production is increased proportionately. The surface glycoproteins HN and F are the major virus neutralizing antigens, and antibodies against them provide protection against reinfection. Although the M-GE mutation had no effect on virus replication, we did find that the increased amount of F protein made by the M-GE mutant viruses during infection resulted in a significant increase in F-specific serum IgG antibody titers. We did not observe an increase in neutralizing antibody titers in vitro. HPIV3 has two neutralization antigens, F and HN, and the contribution of HN to the titer of serum neutralization antibodies is greater than that of F (38–40). A primary infection usually induces a greater antibody response against the HN protein, and reinfection is required to stimulate a higher level of serum antibodies against the F protein (40). Therefore, the neutralizing activity of the increased levels of F-specific antibodies was likely obscured in vitro by the more potent contribution of the HNspecific antibodies. Also, we previously showed that immunization of cotton rats with a recombinant vaccinia virus expressing the HN protein alone induced the same amount of neutralizing antibody as did the combination of this recombinant virus with one expressing the F protein (whereas the response to the recombinant virus expressing F alone was ⬃3-fold less) (39). Thus, at least with these antigens, the in vitro neutralization assay is not sufficiently sensitive to distinguish between a neutralizing response to HN alone and one to HN plus F and therefore is not


sufficiently sensitive to distinguish between responses to various levels of F in the presence of HN. However, as noted above, the glycoprotein-specific ELISA allowed the increased amount of F antibody to be detected unobscured by the response to HN. These data indicate that the 8-nt sequence in the M-GE signal of wt HPIV3 downregulates F expression during infection sufficiently to significantly reduce the induction of serum antibodies against this major neutralization and protective antigen. The F protein likely also contains epitopes for cellular immune responses, and these too might be reduced by a downregulation of the expression of F protein, although this was not investigated. The effect of the elevated F-specific IgG response on protection against HPIV3 was examined by challenging immunized animals with wt HPIV3. However, we found that all of the animals immunized with wt HPIV3 or the M-GE mutants showed full protection against a challenge infection performed 5 weeks after primary immunization. This was not unexpected, since the hamster is semipermissive for HPIV3 infection and viral replication is relatively easy to restrict. Therefore, the effect of increased F-specific antibody levels on protection could not be evaluated. However, we believe that the increase in F-specific serum antibody levels would be significant for the native human host. In a challenge study in adult humans, of those who had evidence of previous infection with HPIV3, 71% of challenged subjects had evidence of HPIV3 infection, and 50% of infected individuals had HPIV3 disease (41). Primary HPIV3 infection in humans is less well characterized, but in the case of its extensively characterized relative, RSV, immunity to a primary infection is not robust. Thus, we believe that in the native host, an increased antibody response against the F neutralization antigen would have an impact on primary infection and on protection against reinfection. As noted above, the apparent 8-nt insert is present in the M-GE signals of the JS and Washington strains of HPIV3, which were isolated several decades ago. The present study used the JS strain for the generation of deletion mutants. We investigated whether this 8-nt insert was present in more recently isolated clinical strains associated with disease. Nucleotide sequences of 29 clinical isolates from recently submitted GenBank sequences (submitted by the J. Craig Venter Institute, MD, USA) were analyzed by multiple-sequence alignment (MegAlign, Lasergene Suite; DNASTAR, Inc., Madison, WI) (Fig. 10). These sequences belong to clinical isolates originating from different continents over a period of 8 years (2004 to 2012) and thus represent currently circulating HPIV3 strains associated with disease. The genome nucleotide alignment showed that the 8-nt insert was present in the M-GE signal of each of the viruses and was also highly conserved among the isolates (Fig. 10). The only variable nucleotide was the first position of the 8-nt sequence, which was A (positive sense) in 9 strains (and also in the Washington strain [6, 8]) and G (positive sense) in the JS strain as well as in the remaining 20 strains. This information indicates that the elongated M-GE signal in HPIV3 is indeed present and conserved in currently circulating strains causing disease. In summary, the present study shows that the presence of the unique 8-nt insert in the M-GE signal of wt HPIV3 substantially shifts F gene transcription from monocistronic F mRNA to readthrough M-F mRNA. This results in reduced production of F protein in HPIV3-infected cells and reduced incorporation of F protein into HPIV3 virions. A number of related paramyxoviruses also appear to have various different mechanisms that have the common effect of

Journal of Virology

jvi.asm.org

3329

Lingemann et al.

FIG 10 Alignment of the M-GE, IG, and F-GS sequences (positive sense) of HPIV3 strain JS, WASH (Washington), and 29 HPIV3 clinical isolates. The isolates were sequenced with a next-generation sequencing platform by the J. Craig Venter Institute and submitted to GenBank. The isolates originated from Australia (AUS), France (FRA), Mexico (MEX), Argentina (ARG), South Africa (ZAF), Peru (PER), and the United States (USA) between 2004 and 2012 (indicated in the strain name). The HPIV3 JS and Washington/47885/57 strains were included in the alignment as reference sequences. Asterisks indicate nucleotides that are 100% conserved in all isolates. Shaded nucleotides differ from the consensus sequence. The IG sequence is underlined in the consensus sequence. All genome sequences are available from the NCBI website (http://www.ncbi.nlm.nih.gov/) under the indicated accession numbers. a, the sequence of the Washington/ 47885/57 strain was not available in GenBank and was reported previously (6).

downregulating the expression of the F gene (26–29). In the case of HPIV3, this did not appear to have any effect on virus replication or pathogenicity. However, the HPIV3 F-specific serum antibody response was shown to be increased for the M-GE mutants, indicating that the 8-nt insert in the wt HPIV3 M-GE signal has the previously undescribed effect of reducing the host antibody response to this major neutralization and protective antigen. These findings are directly relevant to the development of live vaccines against HPIV3. Specifically, these findings indicate that repairing the M-GE signal in an HPIV3 vaccine strain would lead to an increased host response against the F protein, a major viral protective antigen, without any effect on virus replication or attenuation. ACKNOWLEDGMENTS We thank Bo Liang for advice; Fatemeh Davoodi for serological prescreening of hamsters; and Natalie Mackow, Henrick Schomacker, and the Comparative Medicine Branch, NIAID, NIH, for assistance with the animal experiments. We also thank David Stephany (Flow Cytometry Section, Research Technologies Branch, NIAID, NIH) and Margery Smelkinson and Juraj Kabat (Biological Imaging Section, Research Technologies Branch, NIAID, NIH) for their invaluable technical assistance and suggestions. This study was supported by the Intramural Research Program of the NIAID, NIH.

3330

jvi.asm.org

REFERENCES 1. Henrickson KJ. 2003. Parainfluenza viruses. Clin Microbiol Rev 16:242– 264. http://dx.doi.org/10.1128/CMR.16.2.242-264.2003. 2. Parrott RH, Vargosko A, Luckey A, Kim HW, Cumming C, Chanock R. 1959. Clinical features of infection with hemadsorption viruses. N Engl J Med 260:731–738. http://dx.doi.org/10.1056/NEJM195904092601501. 3. Karron RA, Collins PL. 2013. Parainfluenza viruses, p 996 –1023. In Knipe DM, Howley PM, Cohen JI, Griffin DE, Lamb RA, Martin MA, Racaniello VR, Roizman B (ed), Fields virology, 6th ed, vol 1. Lippincott Williams & Wilkins, Philadelphia, PA. 4. Galinski MS, Troy RM, Banerjee AK. 1992. RNA editing in the phosphoprotein gene of the human parainfluenza virus type 3. Virology 186: 543–550. http://dx.doi.org/10.1016/0042-6822(92)90020-P. 5. Pelet T, Curran J, Kolakofsky D. 1991. The P gene of bovine parainfluenza virus 3 expresses all three reading frames from a single mRNA editing site. EMBO J 10:443– 448. 6. Spriggs MK, Collins PL. 1986. Human parainfluenza virus type 3: messenger RNAs, polypeptide coding assignments, intergenic sequences, and genetic map. J Virol 59:646 – 654. 7. Luk D, Masters PS, Sanchez A, Banerjee AK. 1987. Complete nucleotide sequence of the matrix protein mRNA and three intergenic junctions of human parainfluenza virus type 3. Virology 156:189 –192. http://dx.doi .org/10.1016/0042-6822(87)90453-3. 8. Bailly JE, McAuliffe JM, Skiadopoulos MH, Collins PL, Murphy BR. 2000. Sequence determination and molecular analysis of two strains of bovine parainfluenza virus type 3 that are attenuated for primates. Virus Genes 20:173–182. http://dx.doi.org/10.1023/A:1008130917204. 9. Kozak M. 2005. Regulation of translation via mRNA structure in pro-

Journal of Virology



10. 11.

12.

13. 14. 15. 16. 17. 18. 19. 20.

21.

22. 23.

24.

25.

26.

karyotes and eukaryotes. Gene 361:13–37. http://dx.doi.org/10.1016/j .gene.2005.06.037. Durbin AP, Hall SL, Siew JW, Whitehead SS, Collins PL, Murphy BR. 1997. Recovery of infectious human parainfluenza virus type 3 from cDNA. Virology 235:323–332. http://dx.doi.org/10.1006/viro.1997.8697. Hall SL, Stokes A, Tierney EL, London WT, Belshe RB, Newman FC, Murphy BR. 1992. Cold-passaged human parainfluenza type 3 viruses contain ts and non-ts mutations leading to attenuation in rhesus monkeys. Virus Res 22:173–184. http://dx.doi.org/10.1016/0168-1702(92)90049-F. Buchholz UJ, Finke S, Conzelmann KK. 1999. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J Virol 73:251–259. Kolakofsky D, Pelet T, Garcin D, Hausmann S, Curran J, Roux L. 1998. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. J Virol 72:891– 899. Calain P, Roux L. 1993. The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J Virol 67:4822– 4830. Heckman KL, Pease LR. 2007. Gene splicing and mutagenesis by PCRdriven overlap extension. Nat Protoc 2:924 –932. http://dx.doi.org/10 .1038/nprot.2007.132. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262. Mosca JD, Pitha PM. 1986. Transcriptional and posttranscriptional regulation of exogenous human beta interferon gene in simian cells defective in interferon synthesis. Mol Cell Biol 6:2279 –2283. Iwata S, Schmidt AC, Titani K, Suzuki M, Kido H, Gotoh B, Hamaguchi M, Nagai Y. 1994. Assignment of disulfide bridges in the fusion glycoprotein of Sendai virus. J Virol 68:3200 –3206. Nagai Y. 1995. Virus activation by host proteinases. A pivotal role in the spread of infection, tissue tropism and pathogenicity. Microbiol Immunol 39:1–9. Liang B, Munir S, Amaro-Carambot E, Surman S, Mackow N, Yang L, Buchholz UJ, Collins PL, Schaap-Nutt A. 2014. Chimeric bovine/human parainfluenza virus type 3 expressing respiratory syncytial virus (RSV) F glycoprotein: effect of insert position on expression, replication, immunogenicity, stability, and protection against RSV infection. J Virol 88: 4237– 4250. http://dx.doi.org/10.1128/JVI.03481-13. Lamb RA, Parks GD. 2013. Paramyxoviridae, p 957–995. In Knipe DM, Howley PM, Cohen JI, Griffin DE, Lamb RA, Martin MA, Racaniello VR, Roizman B (ed), Fields virology, 6th ed, vol 1. Lippincott Williams & Wilkins, Philadelphia, PA. Stillman EA, Whitt MA. 1998. The length and sequence composition of vesicular stomatitis virus intergenic regions affect mRNA levels and the site of transcript initiation. J Virol 72:5565–5572. Finke S, Cox JH, Conzelmann KK. 2000. Differential transcription attenuation of rabies virus genes by intergenic regions: generation of recombinant viruses overexpressing the polymerase gene. J Virol 74:7261–7269. http://dx.doi.org/10.1128/JVI.74.16.7261-7269.2000. Barr JN, Whelan SP, Wertz GW. 2002. Transcriptional control of the RNA-dependent RNA polymerase of vesicular stomatitis virus. Biochim Biophys Acta 1577:337–353. http://dx.doi.org/10.1016/S0167-4781(02) 00462-1. Collins PL, Karron RA. 2013. Respiratory syncytial virus and metapneumovirus, p 1086 –1123. In Knipe DM, Howley PM, Cohen JI, Griffin DE, Lamb RA, Martin MA, Racaniello VR, Roizman B (ed), Fields virology, 6th ed, vol 1. Lippincott Williams & Wilkins, Philadelphia, PA. Rassa JC, Parks GD. 1998. Molecular basis for naturally occurring elevated readthrough transcription across the M-F junction of the paramyxovirus SV5. Virology 247:274 –286. http://dx.doi.org/10.1006 /viro.1998.9266.


27. Kato A, Kiyotani K, Hasan MK, Shioda T, Sakai Y, Yoshida T, Nagai Y. 1999. Sendai virus gene start signals are not equivalent in reinitiation capacity: moderation at the fusion protein gene. J Virol 73:9237–9246. 28. Tsurudome M, Bando H, Kawano M, Matsumura H, Komada H, Nishio M, Ito Y. 1991. Transcripts of simian virus 41 (SV41) matrix gene are exclusively dicistronic with the fusion gene which is also transcribed as a monocistron. Virology 184:93–100. http://dx.doi.org/10 .1016/0042-6822(91)90825-V. 29. Bousse T, Matrosovich T, Portner A, Kato A, Nagai Y, Takimoto T. 2002. The long noncoding region of the human parainfluenza virus type 1 f gene contributes to the read-through transcription at the m-f gene junction. J Virol 76:8244 – 8251. http://dx.doi.org/10.1128/JVI.76.16.8244-8251.2002. 30. Homann HE, Hofschneider PH, Neubert WJ. 1990. Sendai virus gene expression in lytically and persistently infected cells. Virology 177:131– 140. http://dx.doi.org/10.1016/0042-6822(90)90467-6. 31. Plumet S, Duprex WP, Gerlier D. 2005. Dynamics of viral RNA synthesis during measles virus infection. J Virol 79:6900 – 6908. http://dx.doi.org/10 .1128/JVI.79.11.6900-6908.2005. 32. Krempl C, Murphy BR, Collins PL. 2002. Recombinant respiratory syncytial virus with the G and F genes shifted to the promoter-proximal positions. J Virol 76:11931–11942. http://dx.doi.org/10.1128/JVI.76.23 .11931-11942.2002. 33. Porotto M, Salah ZW, Gui L, DeVito I, Jurgens EM, Lu H, Yokoyama CC, Palermo LM, Lee KK, Moscona A. 2012. Regulation of paramyxovirus fusion activation: the hemagglutinin-neuraminidase protein stabilizes the fusion protein in a pretriggered state. J Virol 86:12838 –12848. http://dx.doi.org/10.1128/JVI.01965-12. 34. Connolly SA, Leser GP, Jardetzky TS, Lamb RA. 2009. Bimolecular complementation of paramyxovirus fusion and hemagglutininneuraminidase proteins enhances fusion: implications for the mechanism of fusion triggering. J Virol 83:10857–10868. http://dx.doi.org/10.1128 /JVI.01191-09. 35. Moscona A, Peluso RW. 1991. Fusion properties of cells persistently infected with human parainfluenza virus type 3: participation of hemagglutinin-neuraminidase in membrane fusion. J Virol 65:2773–2777. 36. Porotto M, Fornabaio M, Kellogg GE, Moscona A. 2007. A second receptor binding site on human parainfluenza virus type 3 hemagglutininneuraminidase contributes to activation of the fusion mechanism. J Virol 81:3216 –3228. http://dx.doi.org/10.1128/JVI.02617-06. 37. Porotto M, Murrell M, Greengard O, Moscona A. 2003. Triggering of human parainfluenza virus 3 fusion protein (F) by the hemagglutininneuraminidase (HN) protein: an HN mutation diminishes the rate of F activation and fusion. J Virol 77:3647–3654. http://dx.doi.org/10.1128 /JVI.77.6.3647-3654.2003. 38. Brideau RJ, Oien NL, Lehman DJ, Homa FL, Wathen MW. 1993. Protection of cotton rats against human parainfluenza virus type 3 by vaccination with a chimeric FHN subunit glycoprotein. J Gen Virol 74(Part 3):471– 477. 39. Spriggs MK, Murphy BR, Prince GA, Olmsted RA, Collins PL. 1987. Expression of the F and HN glycoproteins of human parainfluenza virus type 3 by recombinant vaccinia viruses: contributions of the individual proteins to host immunity. J Virol 61:3416 –3423. 40. van Wyke Coelingh KL, Winter CC, Tierney EL, Hall SL, London WT, Kim HW, Chanock RM, Murphy BR. 1990. Antibody responses of humans and nonhuman primates to individual antigenic sites of the hemagglutinin-neuraminidase and fusion glycoproteins after primary infection or reinfection with parainfluenza type 3 virus. J Virol 64:3833–3843. 41. Kapikian AZ, Chanock RM, Reichelderfer TE, Ward TG, Huebner RJ, Bell JA. 1961. Inoculation of human volunteers with parainfluenza virus type 3. JAMA 178:537–541. http://dx.doi.org/10.1001/jama.1961 .03040450001001.

Journal of Virology

jvi.asm.org

3331