The Atlantic salmon Z-DNA binding protein kinase phosphorylates translation initiation factor 2 alpha and constitutes a unique orthologue to the mammalian dsRNA-activated protein kinase R Veronica Bergan1, Rosemary Jagus2, Silje Lauksund1, Øyvind Kileng1 and Børre Robertsen1 1 The Norwegian College of Fishery Science, University of Tromsø, Norway 2 Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, MD, USA
Keywords Atlantic salmon; translation initiation factor 2 alpha; phosphorylation; protein kinase; Z-DNA binding Correspondence B. Robertsen, Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, N-9037 Tromsø, Norway Fax: +47 776 46020 Tel: +47 776 44487 E-mail:
[email protected] (Received 3 October 2007, revised 5 November 2007, accepted 12 November 2007) doi:10.1111/j.1742-4658.2007.06188.x
The translation initiation factor 2 alpha (eIF2a)-kinase, dsRNA-activated protein kinase (PKR), constitutes one of the major antiviral proteins activated by viral infection of vertebrates. PKR is activated by viral double-stranded RNA and subsequently phosphorylates the a-subunit of translation initiation factor eIF2. This results in overall down regulation of protein synthesis in the cell and inhibition of viral replication. Fish appear to have a PKR-like protein that has Z-DNA binding domains instead of dsRNA binding domains in the regulatory domain, and has thus been termed Z-DNA binding protein kinase (PKZ). We present the cloning of the Atlantic salmon PKZ cDNA and show its upregulation by interferon in Atlantic salmon TO cells and poly inosinic poly cytodylic acid in head kidney. We also demonstrate that recombinant Atlantic salmon PKZ, expressed in Escherichia coli, phosphorylates eIF2a in vitro. This is the first demonstration that PKZ is able to phosphorylate eIF2a. PKZ activity, as measured by phosphorylation of eIF2a, was increased after addition of Z-DNA, but not by dsRNA. In addition, we show that wild-type Atlantic salmon PKZ, but not the kinase defective variant K217R, has a direct inhibitory effect on protein synthesis after transient expression in Chinook salmon embryo cells. Overall, the results support a role for PKZ, like PKR, in host defense against virus infection.
A common strategy in the cellular response to stress signals is to shut down protein synthesis [1]. The cell contains several different latent translation initiation factor 2 alpha (eIF2a)-kinases that phosphorylate the a-subunit of the translation initiation factor eIF2 upon certain stimuli, such as viral infection, amino acid starvation, heme-depletion, and accumulation of misfolded proteins in the endoplasmic reticulum, leading
to inhibition of protein synthesis [2]. Under normal conditions, eIF2 associates with GTP and Met-tRNAi to form a complex with the 40S ribosomal subunit [3]. As initiation proceeds, eIF2 responds to alignment of the initiator tRNA with the initiation codon by initiating hydrolysis of GTP and releasing Met-tRNAi into the partial P-site. Recycling of eIF2-GDP to the active GTP-bound form requires the GTP exchange factor,
Abbreviations As, Atlantic salmon; As-IFN, Atlantic salmon interferon; b-gal, b-galactosidase; CHSE, Chinook salmon embryonic; dsRBD, dsRNA binding domain; EGFP, enhanced green fluorescence protein; eIF2a, translation initiation factor 2 alpha; EST, expressed sequence tag; Hu, human; IFN, interferon; PERK, protein kinase-like endoplasmic reticulum eIF2a kinase; PKR, dsRNA-activated protein kinase; PKZ, Z-DNA binding protein kinase; poly dG:dC, poly deoxyguanosine poly deoxycytidine acid; poly I:C, poly inosinic poly cytodylic acid; SG, stress granule; ZBP1, Z-DNA binding protein 1.
FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
1
Atlantic salmon Z-DNA binding protein kinase
eIF2B [4]. Phosphorylation of the a-subunit of eIF2 at Ser51 converts it from a substrate to an inhibitor of the guanine nucleotide exchange factor, eIF2B, which leads to inhibition of protein synthesis initiation. The interferon (IFN) induced dsRNA-activated protein kinase (PKR) has antiviral and antiproliferative activity [5]. The best-characterized function of PKR is the phosphorylation of eIF2a [6], but it has also been proposed to play a role in the signaling pathways involving nuclear factor kappa B, mitogen-activated protein kinase, signal transducer and activator of transcription-1, p53, IFN regulatory factor-1 and apoptosis signal-regulating kinase-1 [7–11]. PKR is composed of two distinct domains, the dsRNA binding domain (dsRBD) at the N-terminus containing two dsRNA binding motifs, dsRBD1 and 2, joined by a linker region to the kinase domain at the C-terminus [5]. After binding dsRNA, PKR undergoes conformational changes that relieve the autoinhibitory effects of the dsRBDs and results in dimerization and autophosphorylation of PKR at several sites [12]. However, dsRNA binding is not absolutely required for enzymatic activation [13]. Autophosphorylation ⁄ activation of PKR may be induced by polyanionic molecules such as heparin in vitro [14] or by replacement of the dsRBDs with an unrelated domain that is able to dimerize [15]. Furthermore, activation of PKR by a range of cellular stresses can activate PKR through the PKR-associated activator PACT ⁄ RAX in the absence of dsRNA [16,17]. Recently, cDNAs encoding PKR-like eIF2a-kinases have been isolated from goldfish and zebrafish that encode proteins with two Za binding motifs instead of dsRNA motifs in their N-terminal regulatory domains, and have been termed Z-DNA binding protein kinase (PKZ) [18,19]. Za domains specifically bind dsDNA or dsRNA in the left-handed Z conformation [20], a feature that is shared with the dsRNA editing enzyme ADAR1 [21,22], the Z-DNA binding protein 1 (ZBP1) also known as DLM-1 [23,24] and DAI [25], and the poxvirus virulence factor, E3L [26]. Left-handed Z-DNA is a high energy form of DNA that is formed by negative supercoiling as generated by a moving RNA polymerase [27,28]. Z-DNA binding proteins are therefore anticipated to be located at transcriptionally active sites within the cell. Many viruses transcribe their genes and replicate in the cytoplasm. PKZ may thus function as a detector of transcriptional activity within the cytoplasm, the cell compartment where DNA or RNA synthesis should not be present. Recently, ZBP1 was suggested to be a general DNAsensor in the cytoplasm to activate transcription of IFN genes [25]. 2
V. Bergan et al.
In the present study, we describe the cloning of the Atlantic salmon (As) PKZ cDNA and show PKZ upregulation by IFN in Atlantic salmon TO cells. We also demonstrate that recombinant AsPKZ, expressed in Escherichia coli, phosphorylates eIF2a in vitro. This is the first demonstration that PKZ, like PKR, is able to phosphorylate eIF2a. PKZ activity, as measured by phosphorylation of eIF2a, was increased after addition of Z-DNA, but not by dsRNA. To establish whether AsPKZ has an equivalent function to PKR, we examined its ability to shut down protein synthesis after transient expression in Chinook salmon embryonic (CHSE-214) cells.
Results Cloning and sequence analysis of the Atlantic salmon PKZ cDNA The AsPKZ cDNA was obtained by RT-PCR cloning from a RACE library generated from Atlantic salmon TO cells stimulated with recombinant salmon IFN [29]. TO cells originate from the head kidney, which constitutes the major hematopoietic organ of fish [30]. Primary and nested AsPKZ primers were designed from a partial expressed sequence tag (EST) from salmon (Table 1), and RACE-PCR revealed both truncated and full-length cDNA versions of the gene (data not shown). The major AsPKZ cDNA was 2621 nt, including a putative ORF encoding a protein of 513 amino acids (accession no. DQ182560). AsPKZ appears to have two Za DNA binding domains in the N-terminal part of the protein (amino acid positions 12–71 and 100–158), and a serine ⁄ threonine kinase catalytic domain in the C-terminal part (position 187–493). An alignment of the known fish PKZ proteins is shown in Fig. 1, highlighting the two putative Za domains and the kinase domain. The AsPKZ, like the PKZs from goldfish and zebrafish, has many features in common with the tetrapod PKRs. All eIF2a-kinases identified to date have an insert linking catalytic subdomains IV and V, which vary in length in different eIF2a-kinases, ranging from 15–30 amino acids in PKR to >200 in the protein kinase-like endoplasmic reticulum eIF2a kinase, PERK [31]. The inserts are essential for kinase function. The insert domain of AsPKZ, from position 245–318, is similar to that found in other PKZs, but smaller than the range found in tetrapod PKRs. AsPKZ contains the highly conserved LFIQMEF sequence at position 319–325 and an invariant lysine at position 217 that is essential for kinase activity, as well as two threonines at positions 405 and 410 that comprise important autophosphorylation sites [32]. FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
V. Bergan et al.
Atlantic salmon Z-DNA binding protein kinase
Table 1. Primers used for cloning, quantitative (Q)-RT-PCR and mutagenesis. Primer name
Sequence (5¢ to 3¢)
Purpose used
PKZ forw PKZ rev PKZ nested F PKZ nested R PKZ rec forw PKZ rec rev PKZK217Rfwd PKZK217Rrev PKZT405Afwd PKZT405Arev PKZT410Afwd PKZT410Arev As 18S F As 18S R
CAATGACCGATTCCAGCTCC CCCTTATTTATGCTAATCCAG ATGGGGACTGGCCTTGTTTGTT ATGCTAATCCAGTCCTTCAGTGTCC CACCATGCCTGCGACACCGGCA TTCATACAGTTTTCTGTGGTATTCC GGAGGAACATACGCCGTGCGGATTGTGAAGAATATGG CACGGCGTATGTTTCTCCATCCAATTTGTGTTGGGC GAGCATCAATGTACAGGGCTGTCAACAAAGGAAC CCTGTACATTGATGCTCCACTCAGAGTGGTGATC CAGGACTGTCAACAAAGGAGCACCATTCTACATG TCCTTTGTTGACAGTCCTGTACATTGATGCTCC TGTGCCGCTAGAGGTGAAATT GCAAATGCTTTCGCTTTCG
3¢-RACE, Q-RT-PCR 5¢-RACE, Q-RT-PCR Nested 3¢-RACE Nested 5¢-RACE Recombinant expression Recombinant expression Mutagenesis Mutagenesis Mutagenesis Mutagenesis Mutagenesis Mutagenesis Q-RT-PCR Q-RT-PCR
Fig. 1. Alignment of the known fish PKZs. As, ABA64562; Goldfish (Gf), AAP49830; Zebrafish (Zf), CAH68530; and Common carp (Ca), translated EST from CF662905. Identical amino acids are marked with an asterisk and gaps are indicated by ‘–’. Za domains (positions 12–71 and 100–158) and serine ⁄ threonine kinase subdomains (position 187–493), as defined by Hanks and Hunter [62], are indicated. The essential lysine (K) that confers kinase activity and the two putative residues for autophosphorylation required for PKR activity (T) are marked in gray. The highly conserved residues of the Za domains and the conserved LFIQMEF region are highlighted in bold.
Comparison of sequence data of the fish PKZ and members of the PKR family is shown in Table 2. The predicted AsPKZ has a molecular mass of 56.8 kDa, and shares only 34% and 39% overall amino acid FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
identity with zebrafish and goldfish PKZ respectively. When comparing the kinase regions of PKZ and PKR, excluding the kinase insert domain, AsPKZ shares 46–50% identity to the PKR sequences and 54–58% 3
Atlantic salmon Z-DNA binding protein kinase
V. Bergan et al.
Table 2. Comparison of the deduced properties of the AsPKZ protein sequence with various vertebrate PKR and PKZ sequences.
Species
Accession number
Amino acids
Mass
pI
Pairwise identity kinase region
Salmo salar PKZ Carassius auratus PKZ Danio rerio PKZ Xenopus tropicalis PKR Gallus gallus PKR Homo sapiens PKR Canis familiaris PKR Equus caballus PKR Sus scrofa PKR Bos taurus PKR Oryctolagus cuniculus PKR Rattus norvegicus PKR Mus musculus PKR
ABA64562 AAP49830 CAH68530 AAI22034 Q75UT8 P19525 AAX58777 AAX47275 BAC66439 BAC66440 AAZ23127 NP_062208 NP_035293
513 513 511 553 550 551 532 540 537 533 547 513 515
56.8 58.0 58.6 62.8 62.3 62.1 60.6 61.5 60.8 60.2 61.8 58.3 58.3
5.55 5.73 5.38 7.38 8.42 8.40 8.69 8.97 8.68 8.51 8.57 7.35 8.58
– 57.6 53.8 46.2 47.5 49.4 50.4 47.5 49.1 48.1 49.4 50.0 50.6
100
Homo sapiens PKR Pan troglodytes PKR
97
Chlorocebus aethiops PKR 99
Macaca mulatta PKR Mesocricetus auratus PKR Mus musculus PKR
91 99
97
Rattus norvegicus PKR Bos taurus PKR
70
Sus scrofa PKR Oryctolagus cuniculus PKR
75
Canis familiaris PKR Equus caballus PKR Gallus gallus PKR Xenopus tropicalis PKR Salmo salar PKZ Carassius auratus PKZ
89 100
Danio rerio PKZ H.sapiens PERK
Fig. 2. Evolutionary relationships of kinase domain of PKR and PKZ. The evolutionary history was inferred using the Maximum Parsimony method [34]. Tree #1 out of the three most parsimonious trees (length = 999) is shown. For all parsimony-informative sites, the consistency index is 0.748657 and the retention index is 0.615132, and, for all sites and parsimony-informative sites, the composite index is 0.471047 and 0.460523, respectively. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches [63]. The Maximum Parsimony tree was obtained using the Close-Neighbour-Interchange algorithm [3] with search level 3 [63,64] in which the initial trees were obtained with the random addition of sequences (10 replicates). All positions containing gaps and missing data were eliminated from the dataset (Complete Deletion option). There were a total of 256 positions in the final dataset, out of which 165 were parsimony informative. Phylogenetic analyses were conducted in MEGA4 [33].
to the fish PKZ sequences (Table 2). The kinase regions were aligned using clustalw in mega4 [33] and the evolutionary relationships (Fig. 2) were estimated using the Maximum Parsimony method [34] illustrated as a bootstrap consensus tree. The kinase domain of human PERK was used as an outgroup for 4
this analysis. PKZ from Atlantic salmon (Salmo salar), which belongs to the order Salmoniformes, group with zebrafish (Danio rerio) and goldfish (Carassius auratus) PKZ, which belongs to the order Cypriniformes, in 89% of the replicate trees, and the PKZ branch is evolutionary separated from the PKR sequences from FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
V. Bergan et al.
Upregulation of AsPKZ transcripts by IFN and poly inosinic poly cytodylic acid (poly I:C) Mammalian PKR transcript levels are known to be upregulated by IFNa and the synthetic dsRNA poly I:C by two- to ten-fold [37]. To determine whether PKZ shares this feature, AsPKZ transcript levels were assessed by real time RT-PCR in cultured cells 3–24 h after IFN treatment and in salmon smolts 4–24 h after poly I:C treatment (Fig. 3). IFN gave a three-fold induction of PKZ transcripts in Atlantic salmon TO cells (Fig. 3A). In vivo, poly I:C injection gave up to an eight-fold increase of PKZ transcripts in head kidney 24 h after treatment (Fig. 3B). AsPKZ is thus established to be induced by IFN and poly I:C similar to mammalian PKR. Analysis of eIF2a kinase activity To analyze the putative eIF2a-kinase activity, AsPKZ cDNA was expressed in BL21 cells as a His-tag fusion protein, as described in the Experimental procedures. More than 90% of the AsPKZ produced was found in the insoluble fraction (inclusion bodies; Fig. 4A, lanes 1 and 2). Although this could be solubilized by denaturation in 6 m guanidine HCl, and affinity-purified using Ni-NTA affinity chromatography and renatured, AsPKZ thus prepared exhibited low and inconsistent eIF2a-kinase activity. By contrast, much higher eIF2akinase activity could be found after affinity chromatography of the smaller soluble pool of AsPKZ (Fig. 4A, lanes 3–5). Recombinant AsPKZ, as affinity purified from E. coli extracts, was able to autophosphorylate and to phosphorylate eIF2a in kinase assays performed in vitro in the absence of added activators (Fig. 4B, lane 2). This is consistent with the characteristics of recombinant human PKR isolated from E. coli [32,38–40]. The activation of recombinant PKR in the FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
Relative expression
A 5 4 3 2 1 0 0
6
3
8 10 Time (hours)
12
14
24
B 14 12 Relative expression
mammals, birds and amphibians. PKR sequences from Atlantic salmon, rainbow trout (V. Bergan, unpublished data) and zebrafish (B. Joshi and R. Jagus, unpublished data) have been identified and sequenced. Fish PKR sequences also group to the PKZ branch in Neighbour-Joining [35], Maximum Parsimony [34] and Minimal Evolution [36] analysis (results not shown), suggesting that fish PKR and PKZ originate from the same ancestral gene. Interestingly, fish PKZ sequences have lower isoelectric points than tetrapod PKRs, reflecting the high content of acidic amino acids in the kinase insert region (Table 2). The isoelectric point of AsPKZ is 5.5, whereas that of human PKR is 8.4. The functional significance of this is unclear.
Atlantic salmon Z-DNA binding protein kinase
10 8 6 4 2 0 0
12
24 48 Time (hours)
72
96
Fig. 3. Effect of poly I:C and interferon on AsPKZ expression. Realtime RT-PCR of PKZ transcripts in As (A) TO cells or (B) head kidney at different time intervals (h) after treatment with poly I:C or recombinant As interferon. All values are relative to the mean Ct value at time zero, which is set to 1. Error bars indicate SD: (A) n = 3, (B) n = 5.
E. coli cytoplasm is thought to arise from the binding of endogenous RNAs [38,39]. Type 1 protein phosphatase (PP1ca) has been shown to dephosphorylate affinity column-bound PKR and generate a form more useful for in vitro analysis [39]. Dephosphorylation of Ni-NTA-bound AsPKZ prior to elution by imidazole generates a form with reduced autophosphorylation and eIF2a-kinase activity. The ability of the dephosphorylated AsPKZ to respond to added Z-DNA and poly I:C was determined by incubation with poly deoxyguanosine poly deoxycytidine acid (poly dG:dC) converted to the Z form with different cobalt hexamine chloride concentrations, as described in the Experimental procedures, and with poly I:C. Although poly dC:dG (6 lm equivalent to 4 lgÆmL)1) alone did not affect the activity of AsPKZ (Fig. 4B, lane 4), poly dG:dC converted to the Z form with cobalt hexamine chloride increased autophosphorylation as well as phosphorylation of eIF2a (Fig. 4B, lanes 5–8). By contrast to the effects of poly dG:dC, cobalt hexamine chloride alone did not activate PKZ (Fig. 4B, lane 9). 5
Atlantic salmon Z-DNA binding protein kinase
A
1
2
V. Bergan et al.
3
4
5
B
m 97.4 kD
His-AsPKZ
Co Hex M 0 Poly dG:dC PP1 eIF2
0
0
0
25 50
65 80 80
66.2 kD 55 kD 42.7 kD 40 kD 31 kD
AsPKZ
P
eIF2
P
AsPKZ
P
eIF2
P
0 0.25 0.5 1
rPKZ + rec S51A
Poly I:C 0 PP1 eIF2
rPKZ + pur eIF2
D
rPKZ alone
C
rPKZ + rec eIF2
21.5 kD
His-AsPKZ-P eIF2 -P
Fig. 4. AsPKZ functions as an eIF2a-kinase. (A) His-AsPKZ was mainly found in the insoluble fraction (inclusion bodies) of the bacterial lysate (lane 1). The soluble fraction (lane 2) was Ni-NTA purified as three fractions (lanes 3–5). The most concentrated fraction was used to measure kinase activity (B, C). Ni-NTA purified His-AsPKZ from bacterial supernatants was pretreated with protein phosphatase 1 to reduce background autophosphorylation of the kinase. AsPKZ was incubated with c32P-labeled ATP in the presence (+) or absence ()) of recombinant eIF2a and either (B) 6 lM (4 lgÆmL)1) poly dG:dC conformed to Z-DNA by pretreatment with increasing levels (lM) of cobalt hexamine chloride, or (C) in the presence of increasing levels (lgÆmL)1) of the dsRNA poly I:C. (D) Substrate specificity of AsPKZ for eIF2a was tested using either recombinant human eIF2a, purified rat liver eIF2 or recombinant FLAG-tagged S51A variant form of rat eIF2a. Radiolabeled proteins were mixed with equal volumes of 2X SDS ⁄ PAGE sampling buffer, fractionated by 12.5% SDS ⁄ PAGE and subjected to imaging on a Typhoon scanner using the IMAGEQUANT software. The amount of protein in each lane correspond to 25 ng His-AsPKZ, 50 ng recombinant human eIF2a (B–D), 125 ng purified rat liver eIF2 (D) or 50 ng recombinant FLAG-tagged recombinant eIF2a (S51A) (D).
By contrast, poly I:C at a concentration in the range 0.25–1 lgÆmL)1 had no effect on AsPKZ activity (Fig. 4C). The specificity of AsPKZ for Ser51 in eIF2a was also tested (Fig. 4D). AsPKZ was able to phosphorylate recombinant human wt eIF2a (Fig. 4D, lane 2) and purified rabbit eIF2 (Fig. 4D, lane 3) but not the recombinant non-phosphorylatable variant eIF2a (S51A; Fig. 4D, lane 4). Thus, AsPKZ is similar to PKR with respect to substrate specificity for Ser51 in eIF2a [41]. The reduced intensity of the AsPKZ band in lane 4 probably reflects the inhibition of PKZ autophosphorylation by the non-phosphorylatable eIF2a (S51A). This is equivalent to the reduction of PKR autophosphorylation seen in PKR in the presence of PKR pseudosubstrates, such as the vaccinia virus K3L product, or by inhibitors of PKR, such as the vaccinia virus E3L gene product [42]. 6
Inhibition of protein synthesis in fish cells Over-expression of PKR is known to inhibit protein synthesis and cell growth in several different cell types, including yeast, insect and mammalian cells [43,44], and has been demonstrated to inhibit the expression of a cotransfected reporter gene in cultured cells [45]. Since AsPKZ has eIF2a-kinase activity, it is likely that AsPKZ has the same effect. Accordingly, we designed vector constructs expressing AsPKZ or variants of AsPKZ fused to the enhanced green fluorescence protein (EGFP) for transient transfection into CHSE-214 cells. Defective variants of AsPKZ were generated on the basis of what is known for PKR [46]. cDNA encoding the variant K217R of AsPKZ was constructed, equivalent to the kinase defective human (Hu)PKR variant K296R. In addition, cDNAs encoding two variants FEBS Journal (2007) ª 2007 The Authors Journal compilation ª 2007 FEBS
V. Bergan et al.
Atlantic salmon Z-DNA binding protein kinase
pT410A
pT405A
pK217R
C
pPKZwt
A
monitoring the intensity of EGFP fluorescence in transfected cells (Fig. 5B), and from Western blot of cell extracts from transfected cells (Fig. 5C). Western blot analysis confirmed that AsPKZ was expressed at full length (Fig. 5C), since the 87 kDa protein seen in the blot contained the AsPKZ variant (57 kDa) coupled to the 30 kDa EGFP-tag. Expression of wt AsPKZ was barely detectable, despite the fact its inhibitory activity was high, consistent with the known autoregulatory effects of PKR, and consistent with the effect of PKZ on reporter gene expression (Fig. 5A). The transfection assays also confirmed that a fairly
pDest
T405A and T410A, equivalent to the autophosphorylation defective variants T446A and T451A of HuPKR, were made. A vector constitutively expressing b-galactosidase (b-gal) was used as a reporter for protein synthesis. Expression of wt AsPKZ strongly inhibited b-gal expression (95%) compared to the control for the empty pDestEGFP-C1 vector (Fig. 5A). The K217R variant showed almost normal expression (
