The Betaine Aldehyde Dehydrogenase (BAD2) Gene Is not ...

The Betaine Aldehyde Dehydrogenase (BAD2) Gene Is not Responsible for the Aroma Trait of SA0420 Rice Mutant Derived by Sodium Azide Mutagenesis Shu-Ming Kuo1, Szu-Yi Chou2, Arthur Z. Wang3, Tung-Hai Tseng2, Fu-Shin Chueh4, Hungchen E. Yen1, Chang-Sheng Wang2* 1

Department of Life Sciences, National Chung-Hsing University, Taiwan, ROC. Laboratory of Molecular Genetics, Division of Agronomy, Taiwan Agricultural Research Institute, Council of Agriculture, Taiwan, ROC. 3 Department of Agronomy, National Chung-Hsing University, Taiwan, ROC. 4 Department of Biological Science and Technology, Asia University, Taiwan, ROC. *E-mail: [email protected] 2

Abstract Aroma is one of the important quality traits of rice and variety with aroma has a higher price. A novel mutation pool of Tainung 67 (TNG67), containing more than 3,000 mutants, has been developed by sodium azide mutagenesis at the Taiwan Agricultural Research Institute (TARI). An aroma mutant (SA0420), can generates aroma at various developmental stages in leaves and grains, was found in this mutation pool. The genetics of the aroma trait of SA0420 was determined by detecting the aroma of F2 progenies (n=730) of SA0420 X TNG67 and showed that it is conditioned by a single dominant locus (χ2 = 0.0164). This result is diverse from most of the published varieties in which the aroma traits are recessively controlled. The aroma locus of SA0420 was determined by SSR mapping and it showed that the locus is located on the chromosome 8 (Ku et al., unpublished data). Recently, an eight bps deletion on exon 7 of betaine aldehyde dehydrogenase (BAD2) was found in Kyeema and proposed to be the candidate of recessive fgr gene (10). In order to confirm whether it is a general rule for all aroma varieties or not, the BAD2 genes of twenty six (19 aroma and 7 non-aroma) rice varieties, including Basmati370, KDML105, IR5105, Milfor, SA0420 and TNG67 etc., were cloned and sequenced. The results showed that three dominant aroma mutants SA0420, SA0491.2, SA0562 and six recombinant inbred lines (RILs) with aroma trait contain the same deleted BAD2 gene, but other aroma rice lines, such as SA0418, SA0766, SA0766.1, SA1613 and a newly released variety TNG71, contain normal BAD2 genes. It indicates that the deletion in the BAD2 gene is not universal to all the aroma rice varieties. Our results demonstrate that the deletion of BAD2 gene is not responsible for the dominant aroma trait of SA0420 mutant and our mutation pool provides valuable resources for breeding rice variety with aroma. Key words: aroma, mutant, BAD2 gene, mutagenesis.

Introduction A large quantity of rice is produced in many areas worldwide to meet the demand of consumers. In fact, aromatic rice varieties are very popular in Southeast Asia. Recently, they have gained a wide acceptance in Europe and the U.S.A. The demand for aromatic rice is increasing in the local or international markets due to the better quality than the normal rice. 1

2-acetyl-1-pyrroline (2-AP) has been identified as the major aromatic compound in most aromatic rice(1, 2, 3). Previous genetic studies showed that most of aroma traits are recessively controlled and the fragrance gene (fgr) has been mapped on chromosome 8(4, 5, 6, 7, 8, 9). Recently, an eight base pairs deletion in the exon 7 causing a defect BAD2 (betaine aldehyde dehydrogenase, EC 1.2.1.8) protein with early stop of translation was detected and proposed to be the fgr gene candidate in rice variety, Kyeema(10). BAD (EC 1.2.1.8) is the enzyme involved in the last step of betaine synthesis (Figure 1)(11, 12, 13, 14) and was proposed to be responsible for salt tolerance of plant(15, 16). In this work, the BAD2 genes of twenty six rice mutant or varieties (19 aroma varieties and 7 non-aroma) were characterized to confirm whether deletion of BAD2 gene is a general rule for all aroma varieties or not. A novel different mechanism of aroma synthesis in aroma rice will be described in this study.

Materials A novel mutation pool of Tainung 67 (TNG67) variety, containing more than 3,000 mutants, has been developed by sodium azide mutagenesis at TARI (17). After mutagenesis the seeds were planted, self-pollinated, and bulk harvested for at least ten generations before screening. An aroma mutant, SA0420, produces aromatic flavor in leaves and grains at various stages of development was found in this mutation pool. SA0420 was found in this mutation pool and is one of major materials used in this study (Figure 2). Besides, other rice varieties from many origins including Basmati 370, KDML 105, IR5105, Milfor, TNG71, aromatic mutant SA0418, SA0491.2, SA0562, SA0766, SA0766.1, SA1613, and F8 recombinant inbred lines (RILs) derived from SA0420 x TNG67 were used in this study.

Methods 1. Segregation test The genetic of aroma was scored by smelling the leaves fragrance using potassium hydroxide (KOH) method (18) on the F2 population for three seasons. 2. Bioinformatics Sequences of the candidate genes were obtained and blast in NCBI (http://www.ncbi.nlm.nih.gov/) and TIGR (http://www.tigr.org/tdb/e2k1/osa1/). The TIGR website has a collection of databases for use in searching with the WU-BLAST 2.0 programs that was latest release on May 10, 2005. Multiple sequence alignment was performed using the ClustalW and BOXSHADE version 3.2 on SDSC (http://workbench.sdsc.edu/) (19). And promoter was predicted by “Promoter Prediction” program on Web site the BDGP Promoter Prediction 2

(http://www.fruitfly.org/seq_tools/promoter.html). 3. DNA extraction, PCR, sequence analysis Genomic DNA was extracted from rice leaf (20). All the PCR were performed with a PTC-200 Gradient cycler (MJ Research Co.) with Takara Ex Taq™ DNA Polymerase Kit containing 100 ng genomic DNA, 4μM of each primer. Cycling conditions were 3 min at 94 ℃ followed by 25 cycles of 94 ℃ for 30 s, 62 ℃ for 1 min and 72 ℃ for 30 s followed by a final extension of 72 ℃ for 2 min. PCR products were sequenced by the 3730 DNA Analyzer (Applied Biosystems).

Results and Discussion 1. Segregation test The genetics of the aroma trait of SA0420 was determined by detecting the aroma of F2 progenies of SA0420 X TNG67 for three seasons the results showed that the aroma trait is conditioned by a single dominant locus (χ2 = 0.0164) (Table 1). 2. Bioinformatics and PCR primer design In the rice genome, BAD1 and BAD2 are located on chromosome 4 and chromosome 8, respectively (15, 10) by database search in NCBI (http://www.ncbi.nlm.nih.gov/) and TIGR (http://www.tigr.org/tdb/e2k1/osa1/). In addition, a third betaine aldehyde dehydrogenase-like gene (BAD30593) is located on chromosome 7 was annotated in NCBI. Its deduced amino acid sequence shares 75% identity with Arabidopsis betaine aldehyde dehydrogenase (AAG50992), and named as BAD3 in this work (Table 2). All the three rice BAD genes were cloned by PCR with specific primers designed by the aid of Vector NTI v9.0 software and their results are listed in Table 3. 3. Gene cloning and sequencing The BAD2 genes were cloned from 19 aromatic and 5 non-aromatic rice varieties and sequenced. The expected 1,179 bps of genomic DNA fragments were amplified by B1-5 and B2-8R primers (Table 3, Figure 3). For comparison, sequences of BAD2 genes of Nipponbare and 93-11 were obtained from NCBI. Multiple sequence alignment of BAD2 genes from 26 rice varieties was conducted by using “ClustalW” of SDSC (http://workbench.sdsc.edu/). The result showed that three dominant aroma mutants SA0420, SA0491.2, SA0562 and six F8 RILs with aroma trait contain the same deletion in BAD2 gene (Figure 4). However, the BAD2 genes sourced from other aroma rice lines, such as SA0418, SA0766, SA0766.1, SA1613, and a newly released variety with recessive aroma trait, TNG71, are normal ones without deletion. These results suggest that the deletion in the BAD2 gene is not universal to all the aroma rice varieties. Additionally, phylogenetic tree generated by using BioEdit v7.0.5 software 3

(http://www.mbio.ncsu.edu/BioEdit/page2.html) showed that rice varieties with BAD2 genes deletion belong to a group differs with those have normal BAD2 genes (Figure 5). There may have a different mechanism that controls the aroma production in the novel dominant aroma mutants, SA0420, SA0418, SA0766, SA0766.1, SA1613, derived from sodium azide mutagenesis. The BAD2 genes of SA0420, SA0418, KDML 105, and TNG67 rice varieties were also cloned and sequenced. The promoter region of BAD2 was predicted on -1187 to -1137 by “Promoter Prediction” program on Web site the BDGP Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) (Figure 6). Besides, the promoter regions of BAD1 and BAD3 were also cloned and sequenced but no significant diversity was found indicating that BAD genes are not responsible for the aroma phenotype in these materials. The results will be described elsewhere. Based on our results, it strongly suggests that the deletion of BAD2 gene is not a general rule for the mechanism of aroma synthesis in all the aroma rice varieties. Even though, SA0420 contains same deletions in the BAD2 gene, the deletion must not be critical factor for aroma synthesis. It is due to its aroma trait conditioned by a single dominant locus. Our results differ with the report of Bradbury et al. (10). Furthermore, the mutation rate of aromatic rice mutant SA0418 is highest and identified with 93-11. The result indicated the revolution of SA0418 seemed toward Indica-rice (Figure 6). Besides, there are still many aroma mutants with various flavors in our mutation pool providing valuable resources for breeding rice variety with aroma. 4. Biochemical pathways related to BAD and the synthesis of aroma compound 2-AP It is a long distance between BAD and 2-AP in the biochemical pathways. In plants betaine is synthesized by the two-step oxidation of choline via the intermediate betaine aldehyde, catalyzed by choline monooxygenase and betaine aldehyde dehydrogenase (BAD) (15, 16, 21) . The pathway of betaine synthesis from BAD is connected L-glutamate with serine, glycine, etc., and they are connected with 5-aminolevulinic acid (ALA). The synthesis of Δ1-pyrroline 5-carboxylate (P5C) from L-glutamate is catalyzed by enzymes in many steps. P5C has been shown to be a precursor of aroma in rice and an intermediate in biosynthesis and degradation of L-proline (22, 13). Proline is synthesized not only from glutamate, but also from arginine or ornithine. Thus an indirect relationship is between BAD and 2-AP (Figure 1). Non-aromatic rice variety has normal BAD2 protein that yields large amount of betaine. Proline betaine inhibition of proline accumulation in leaf is associated with betaine accumulation in the plant tissues. Thus less aroma compound 2-AP is synthesized. On the contrary, an eight bps deletion within 7th exon of BAD2 in the aromatic rice variety Kyeema etc. render the BAD2 protein for non-function and less betaine is synthesized thus. Then proline accumulate and provide synthesis of 2-AP (Figure 1) (22, 12, 10).

4

5. Molecular mapping of a gene for aroma in rice Genetic mapping of molecular markers and the aroma phenotype demonstrated that the markers RM515 and SSRJ07 on chromosome 8 flanked fgr. The physical distance between RM515 and SSRJ07 is 386.6 Kb. A gene with homology to the gene that encodes BAD has significant polymorphisms in the coding region of aroma genotypes relative to non-aroma genotypes was reported (10). To this day their result was the finest mapping on genomic DNA level, but they did not show gene expression, protein expression, or transgenic results of BAD2. The evidence for supporting that fgr is BAD2 gene on functional gene level is exiguous. The fgr gene was linked to the RFLP clone RG28 on chromosome 8 at a genetic distance of 4.5 cM already (4). The reasons that aroma gene was cloned not yet over the past twelve years are shown below. First, the concentration of the volatile aroma component in rice is ppb level. Aroma is detected by no more than a biosensor or human nose. Concentrations of 2-acetyl-1-pyrroline are determined by a GC-MS instrument, but it consumes large amounts of plant material (3). Second, most of aromatic rice varieties are recessively controlled that it is difficult for genetic analysis. Third, the aroma produced in rice is in a quantitative but not a qualitative manner. The highest resolution of fine mapping is about 1 cM so far. It contains many genes on chromosome for the 1 cM distance. It is possible that the real aroma gene is flanked BAD2 on chromosome 8.

Conclusions There are three reasons to support that the BAD2 gene is not responsible for the aroma trait of the SA0420 mutant in our rice mutation pool. First, SA0420 is conditioned by a single dominant locus but contains the deletion of BAD2 as reported by Bradbury et al.. Second, the deletion of BAD2 gene is not universal to all the rice varieties with aroma trait. For example, mutants SA0418, SA0766, SA0766.1, SA1613, and TNG71 variety with aroma are of normal BAD2 gene. Third, our results suggest that aroma rice of different origins may have various regulation or mechanism.

Acknowledgements This work was supported by the National Science Council (NSC 94-2317-B-055-006) to C. S. Wang.

References 1. Buttery, R. G., L. C. Ling, B. O. Juliano and J. G. Turnbaugh. 1983. Cooked rice aroma and 2-acetyl-1-pyrroline. J. Agric. Food Chem. 31:823-826. 2. Mahatheeranont, S. S. Keawsa-ard and K. Dumri. 2001. Quantification of the rice aroma compound, 2-acetyl-1-pyrroline, in uncooked Khao Dawk Mali 105 brown rice. J. Agric. 5

Food Chem. 49:773-779. 3. Widjaja, R., J. D. Craske, and M. Wootton. 1996. Comparative studies on volatile components of non-fragrant and fragrant rices. J. Sci. Food Agric. 70:151-161. 4. Ahn, S. N., C. N. Bollich, and S. D. Tanksley. 1992. Theor. Appl. Genet. 84:825-828. 5. Jin, Q. S., B. Q. Qiu, W. C. Yan, and R. B. Luo. 1996. Tagging of a gene for aroma in rice by RAPD and RFLP (II). Acta Agriculturae Zhejiangensis 8:9-23. 6. Lorieux, M., M. Petrov, N. Huand, E. Guiderdoni, and A. Ghesquie´re. 1996. Aroma in rice: genetic analysis of a quantitative trait. Theor. Appl. Genet. 93:1145-1151. 7. Cordeiro, G. M., M. J. Christopher, R. J. Henry, and R. F. Reinke. 2002. Identification of microsatellite markers for fragrance in rice by analysis of the rice genome sequence. Mol. Breed. 9:245-246. 8. Dong, Y., E. Tsuzuki, and H. Terao. 2001. Trisomic genetic analysis of aroma in three Japanese native rice varieties (Oryza sativa L.). Euphytica 117:191-196. 9. Jin, Q. S., D. Waters, G. M. Cordeiro, R. J. Henry, and R. F. Reinke. 2003. A single nucleotide polymorphism (SNP) marker linked to the fragrance gene in rice (Oryza sativa L.). Plant Sci. 165:359-364. 10. Bradbury, L., T. L. Fitzgerald, R. J. Henry, Q. S. Jin, and D. Waters. 2005. Plant Biotechnol. J. 3:363-370. 11. Hanson, A. D. and C. E. Nelsen. 1978. Betaine accumulation and [14C] formate metabolism in water-stressed barley leaves. Plant Physiol. 62:305-312. 12. Kishor, P. B.K, S. Sangam, R. N. Amrutha, P. Sri Laxmi, K. R. Naidu, K. R. S. S. Rao, Sreenath Rao, K. J. Reddy, P. Theriappan and N. Sreenivasulu. 2005. Regulation of proline biosynthesis, degradation, uptake and transport in higher plants: Its implications in plant growth and abiotic stress tolerance. Curr. Sci. 88: 424-438. 13. Delauney, A. J. and D. P. S. Verma. 1993. Proline biosynthesis and osmoregulation in plants. Plant J. 4:215-223. 14. Brownleader, M. D., J. B. Harborne and P. M. Dey. 1997. Carbohydrate metabolism : Primary metabolism of monosaccharides. In “Plant Biochemistry”, ed. P. M. Dey and J. B. Harborne, pp. 111-141. California : Academic Press. 15. Nakamura T, S. Yokota, Y. Muramoto, K. Tsutsui, Y. Oguri, K. Fukui, and T. Takabe. 1997. Expression of a betaine aldehyde dehydrogenase gene in rice, a glycinebetaine nonaccumulator, and possible localization of its protein in peroxisomes. Plant J. 11:1115-20. 16. Weretilnyk, E. A., and A. D. Hanson.1990. Molecular cloning of a plant betaine aldehyde dehydrogenase, an enzyme implicated in adaptation to salinity and drought. Proc. Natl. Acad. Sci. USA. 87:2745-2749. 17. Wang, C. S., T. H. Tseng, and C. Y. Lin. 2002. Rice biotech research at the Taiwan Agriculture Research Institute. APBN. 6:950-956. 6

18. Sood, B. C. and E. A. Siddiq. 1978. A rapid technique for scent determination in rice. Indian J. Genet. Plant Breed. 38:268-271. 17. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. 20. McCarty, D. R. 1986. A simple method for extraction of RNA from maize tissue. Maize Genet. Coop. Newslett. 60:61. 21. Rhodes, D., and A. D. Hanson. 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44:357-384. 22. Yoshihashi, T., N. T. T. Hung, and H. Inatomi. 2002. Precursors of 2-acetyl-1-pyrroline, a potent flavor compound of an aromatic rice variety. J. Agric. Food Chem. 50:2001-2004.

7

Fig. 2. Phenotype characteristics of rice cultivar TNG67 and its aromatic mutant SA0420. SA0420 can generate aroma at various stages of development in leaf and grains.

8

Fig. 4. Multiple sequence alignment of rice BAD2 genes from 26 rice varieties or mutant lines. Sequence analysis was performed using the ClustalW of SDSC (Thompson et al., 1994). *: identical or conserved in all sequences in the alignment; blue: BAD2 exon 7; black: intron; green: non-aromatic rice varieties; pink: aromatic rice varieties with BAD2 deletion; red: aromatic rice varieties without BAD2 deletion.

9

Nippon. TNG67 KDML105 SA0420 SA0418 93-11

CAACATATTAT---------------------C---GGATG------------------- (-1339) CAACATATTAT---------------------C---GGATG------------------CAACATATTAT---------------------C---GGATG------------------CAACATATTAT---------------------C---GGATG------------------CTACATGCCATAGTATTAGGTTGGTTTTTTTTGGACGGATGAACTATGTAACTAATCAAA CTACATACCATAGTATTAGGTTGGTTTTTTT-GGATGGATGAACTATGTAACTAATCAAA * **** ** *****


--------------CGATACATAC------------------------------------ (-1329) --------------CGATACATAC-------------------------------------------------CGATACATAC-------------------------------------------------CGATACATAC-----------------------------------TGAAATAACATAATCTATACACATAAGCTTCATGTGCACACCAACTAGTAAATATCATGA TGAAATAACATAATCTATACACATAAGCTTCATGTGCACACCAACTAGTAAATATCATGA * ***** *


---------------------------------TAGTACTATA----------------- (-1319) ---------------------------------TAGTACTATA-------------------------------------------------TAGTACTATA-------------------------------------------------TAGTACTATA----------------TAAATTCTGGAAAATATTGACATGTACTCCTAATAGTACCACACATATTGTCAAAGTCTC TAAATTCTGGAAAATATTGACATGTACTCCTAATAGTACCACACATATTGTCAAAGTCTC ****** * *

10


----------------------------------AATCTAT------------------- (-1312) ----------------------------------AATCTAT----------------------------------------------------AATCTATAAATCTAG--------------------------------------------AATCTATAAATCTAG----------ATATTCAAGTTTATTATATTTTAGTCGTAGAAAGAATCTACTAGTTTTAAGAGTAAAAAT ATATTCAAGTTTATTATATTTTAGTCGTAGAAAGAATCTACTAGTTTTAAGAGTAAAAAT ******


----------------------TATTAAGAC----ATGCCATAGTATT------------ (-1290) ----------------------TATTAAGAC----ATGCCATAGTATT---------------------------------TATTAAGAC----ATGCCATAGTATT---------------------------------TATTAAGAC----ATGCCATAGTATT-----------ATGTCAGAAATTTTATCATTTTTGTTACGACTAAAATATAATAGAATTGAAGATAAGATT ATGTCAGAAATTTTATCATTTTTGTTACGACTAAAATATAATAGAATTGAAGATAAGATT * *** *** ** **** ***


----------------------AAGTAATTAATTTTTT-GTTTACAATTTGATGTGCATA (-1253) ----------------------AAGTAATTAATTTTTT-GTTTACAATTTGATGTGCATA ----------------------AAGTAATTAATTTTTTTGTTTACAATTTGATGTGCATA ----------------------AAGTAATTAATTTTTTTGTTTACAATTTGATGTGCATA TTAGGTATAGATGTAATATCGGAAGTAATTAATTTTTT-GTTTACAATTTGATGTGCATA TTAGGTATAGATGTAATATCGGAAGTAATTAATTTTTT-GTTTACAATTTGATGTGCATA **************** *********************


BDGP promoter prediction CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAAGAATT (-1133) CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAAGAATT CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAATAATT CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAATAATT CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAAGAATT CCCAGCAAGCCTCCATATATGACGTCGGGAGTTTGACTGCGATATAACGGTAAAAGAATT ******************************************************* ****

11


AAGTGGGACCATGTATTGATAGTGTAGTATGTAACTATTACTTCCTCCGTTTTACAATGT (-653) AAGTGGGACCATGTATTGATAGTGTAGTATGTAACTATTACTTCCTCCGTTTTACAATGT AAGTGGGACCATGTATTGATAGTGTAGTATGTAACTATTACTTCCTCCGTTTCACAATGT AAGTGGGACCATGTATTGATAGTGTAGTATGTAACTATTACTTCCTCCGTTTCACAATGT AAGTGGGACCATGTATT----------------------ACTCCCTCCGTTTCACAATGT AAGTGGGACCATGTATT----------------------ACTCCCTCCGTTTCATAATGT *****************

*** ********* * *****


TTAAATAAGATGAACGGCCAAATATTTTTTAAAAAAATCAACGGCGT------------- (-306) TTAAATAAGATGAACGGCCAAATATTTTTTAAAAAAATCAACGGCGT------------TTAAATAAGATGAACGGTCAAATATTTTTTAAAAAAATCAACGGCGT------------TTAAATAAGATGAACGGTCAAATATTTTTTAAAAAAATCAACGGCGT------------TTTAATAAGATGAACGGTCAAATATTTAAAAAAAAAGTCAACAGCGTCTCAAATATTTAG TTTAATAAGATGAACGGTCAAATATTTAAAAAAAAAGTCAACAGCGTCTCAAATATTTAG ** ************** ********* ****** ***** ****


---------------AAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC (-261) ---------------AAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC ---------------AAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC ---------------AAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC GATGGAGAGAGTAGTAAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC GATGGAGAGAGTAGTAAACTTCTCTGGAAAACTACTCCGAAGTCCGTACCAACTGCCCGC *********************************************

Fig. 6. Multiple sequence alignment of promoter region of BAD2 genes from rice varieties. Sequence analysis was performed using the ClustalW of SDSC (Thompson et al., 1994). The promoter was predicted by Promoter Prediction on BDGP Promoter Prediction website (http://www.fruitfly.org/seq_tools/promoter.html). *: identical or conserved in all sequences in the alignment; Blue: exon; Black: intron or untranslated region; underlined sequences are the specific primers.

12

Table 1. Segregation test for F2 population in crosses between SA0420 and TNG67 rice lines combination. The genetics of the aroma trait of SA0420 is studied by detecting the aroma of F2 progenies (n=730) of SA0420 X TNG67 and shows that it conditioned by a single dominant locus (χ2 = 0.0164). non-aromatic

aromatic

χ2 value

181 549 0.0164† 1 : 3 † Significant at the 0.9 probability level

Table 3. Sequences of primers used in PCR analysis. Primers and their corresponding sequences used for cloning and characterization of the BAD1, BAD2, and BAD3 from Oryza sativa L. Gene

Primer

Sequence (5’-3’)

name

BAD1 BAD1-7 BAD1-2R BAD2 B1-5 B2-8R BAD2P-3 BAD2P-4R BAD2-2R BAD3 BAD3P-1 BAD3-4R

AAAGCCATCTGAGCTTGCTTCC CTACAGCTTGGATGGAGGCCG ATTAGGTTCTGAAGCCGGTGC AAGCAACCAAAGAGAGTCCACTC ACGGTGCTTTATTATGGCCTGAC TCAGAGGCAGAAGCAGAGGGTG TTACAGCTTGGAAGGGGATTTGTAC ATCGCCTCCTCCTTAGTCCTCTC AATCGCACCAATAACTCCAAGTGG

13