PL-ISSN 0015-5497 (print), ISSN 1734-9168 (online)
Folia Biologica (Kraków), vol. 63 (2015), No 2
Ó Institute of Systematics and Evolution of Animals, PAS, Kraków, 2015
doi:10.3409/fb63_2.119
The Effects of Phytoestrogen Genistein on Steroidogenesis and Estrogen Receptor Expression in Porcine Granulosa Cells of Large Follicles* Anna NYNCA, Agnieszka SADOWSKA, Karina ORLOWSKA, Monika JABLONSKA, and Renata E. CIERESZKO Accepted March 16, 2015
N
YNCA A., SADOWSKA
A., O
RLOWSKA
K., J
ABLONSKA
M., C
IERESZKO
R.E. 2015. The
effects of phytoestrogen genistein on steroidogenesis and estrogen receptor expression in porcine granulosa cells of large follicles. Folia Biologica (Kraków)
63 : 119-128.
Genistein is a biologically active isoflavone with estrogenic or antiestrogenic activity which can be found in a variety of soy products. Since in pigs diet soy is the main source of protein, genistein may affect the reproductive/endocrine systems in these animals. Genistein has been shown to alter porcine ovarian and adrenal steroidogenesis but the mechanism of this action is still not clear. It is known that genistein binds to both estrogen receptor alpha (ER á) and estrogen receptor beta (ER â ), although it has a higher affinity to ER â . Moreover, this phytoestrogen was demonstrated to posses the activity of protein tyrosine kinase (PTK) inhibitor. The aim of the study was to examine the
in vitro
effects of genistein on: (1)
progesterone (P 4 ) and estradiol (E 2 ) secretion by porcine luteinized granulosa cells harvested from large follicles, and (2) the mRNA and protein expression of ER á and ER â in these cells. In addition, to verify the role of PTKdependent mechanisms possibly involved in genistein biological action, we tested the effects of lavendustin C, the nonsteroidal PTK inhibitor, on granulosa cell steroidogenesis. Genistein significantly inhibited P 4 and did not affect E 2 secretion by porcine luteinized granulosa cells isolated from large follicles. Lavendustin C did not affect basal steroids secretion by examined cells. Genistein did not alter ER á but increased ER â mRNA levels in the cultured porcine granulosa cells. In contrast to medium follicles, the expression of ER â protein was unaffected by genistein in granulosa cells of large follicles. To conclude, the soy phytoestrogen genistein acts directly on the porcine ovary to decrease progesterone production and to increase the expression of ER â mRNA. Moreover, genistein-induced changes in follicular steroidogenesis and granulosal sensitivity to estrogens in pigs may depend on maturity of the follicles. Key words: Phytoestrogen, genistein, lavendustin, estrogen receptors, steroidogenesis, pig.
Anna NYNCA, Research and Education Center, Laboratory of Molecular Diagnostics, University of Warmia and Mazury, Prawochenskiego 5, 10-720 Olsztyn, Poland. E-mail:
[email protected] Agnieszka S ADOWSKA, Karina O RLOWSKA, Monika J ABLONSKA, Renata C IERESZKO, Department of Animal Physiology, University of Warmia and Mazury, Oczapowskiego 1A, 10-719 Olsztyn, Poland.
Genistein is one of the most abundant estrogenic compounds present in soy and soy-derived food which are often consumed as an alternative to hormonal therapy by menopausal women (HAJIRAHIMKHAN et al. 2013). Soy is also used in pig diets as a main protein source and it is known to contain not only genistein but also other phytoestrogens (PE) (KRASZEWSKA et al. 2007). Phytoestrogens were found to affect the functions of female and male reproductive systems in many species (for review see: CIERESZKO et al. 2007; KURZER et al.
1997). Specifically, they were reported to cause reproductive disorders in humans, especially during the period of reproductive activity, and in farm animals including pigs (CIERESZKO et al. 2007; DUSZA et al. 2006). It was found that PE inhibit progesterone (P4) secretion by porcine (NYNCA et al. 2009; NYNCA et al. 2013a,b,c; TIEMANN et al. 2007) as well as human (WHITEHEAD et al. 2002) granulosa cells which may influence ovarian function.
_______________________________________ *Supported by the State Committee for Scientific Research as a Solicited Project PBZ-KBN-084/P06/2002, 2 P06D 010 29 and UWM No. 0206.805.
120
A. NYNCA et al.
Genistein affects cellular function via estrogen receptor (ER)-dependent and ER-independent mechanisms. The influence of estrogens is usually mediated by ER (ERá and ERâ), intracellular levels of which are tightly regulated by complex mechanisms (MARINO et al. 2012; BYERS et al. 1997). Genistein may directly bind to the ER already present in the cell and activate or inactivate the ER-dependent pathways, and they may modulate the intracellular ER levels (mRNA and protein). The ER-independent mechanisms may, in turn, involve changes in the activity of tyrosine kinases (PTK) and mitogen-activated protein kinases. In addition, genistein action may result from its antiproliferative and anti-angiogenic properties (BENASSAYAG et al. 2002). Genistein was also reported to modulate the activity of steroidogenic enzymes such as aromatase, 3â-hydroxysteroid dehydrogenase (3â-HSD) and 17â-hydroxysteroid dehydrogenase (17â-HSD) (WHITEHEAD et al. 2006). Therefore, the overall biological action of genistein and other PE in the target cells is probably the result of a very complex interplay of various mechanisms, which are determined by the cell type, balance between the ER subtypes and genistein administration route and dose. Phytoestrogens have been shown to affect ovarian and adrenal steroid production. Previously we demonstrated the inhibitory effects of PE on P4 secretion by porcine granulosa cells (NYNCA et al. 2009; NYNCA et al. 2013a,b,c). Moreover, genistein and daidzein suppressed cortisol production and stimulated androstenedione production by porcine adrenocortical cells isolated during the follicular and luteal phase of the estrous cycle (KAMIÑSKA et al. 2012). It was also found that genistein mechanism of action did not involve the suppression of PTK since non-steroidal PTK inhibitors did not affect steroidogenesis in adrenocortical cells (KAMIÑSKA et al. 2012) or granulosa cells harvested from medium follicles (NYNCA et al. 2013b). Since granulosa cell function may depend on biological/endocrine maturity (medium vs. large follicles), we decided to study the influence of genistein on granulosa cells harvested from large, preovulatory follicles and compare the results of the current study with those obtained previously on medium, growing follicles. Therefore, the objectives of the study were to evaluate the in vitro effects of genistein on P4 and estradiol (E2) secretion by porcine luteinized granulosa cells isolated from large ($8 mm) follicles. In the present study we also examined the effects of genistein on mRNA and protein expression levels of ERá and ERâ in these cells. To verify the role of tyrosine kinase-dependent mechanism in genistein biological action, we additionally tested the effects of the well known tyrosine kinase inhibitor, lavendustin C, on granulosa cell steroidogenesis.
Material and Methods Chemicals Cell culture supplies, genistein, medium M199, nystatin, red blood cells lysing buffer and trypan blue solution were obtained from Sigma (St. Louis, MO, USA). Labeled (2,4,6,7-3H) 17-estradiol and (1,2,6,7-3H) progesterone were purchased from Amersham Pharmacia Biotech (Little Chalfont, Great Britain). Eagle’s medium and calf serum (CS) were used from Biomed (Lublin, Poland), bovine serum albumin (BSA) from ICN Biomedicals (Irvine, CA, USA), gentamycin from KRKA (Novo Mesto, Slovenia) and culture plates from Becton Dickinson Labware Europe (Le Pont de Claix Cedex, France). The cell viability test was performed with alamarBlueTM dye (BioSource International, Cammarillo, CA, USA). For total RNA isolation from cells TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) was used and for RT-PCR Omniscript Reverse Transcription Kit and HotStarTaq Master Mix Kit (Hilden, Germany). The VECTASTAIN ABC System were obtained from Vector Laboratories (Burlingame, CA, USA) and 3,3’-diaminobenzidine from Dako (Glostrup, Denmark). Cell cultures and experimental design All experiments were performed according to the ethical standards of the Animal Ethics Committee at the University of Warmia and Mazury in Olsztyn (permission no. 11/2010/DTN). Porcine ovaries with large, preovulatory ($8 mm in diameter) follicles were collected in a local slaughterhouse (Krokowo/Jeziorany, Poland) and transported promptly in cold buffered physiological saline (PBS) supplemented with gentamycin (0.05 mg/ml) and nystatin (120 U/ml). Ovarian and follicular morphology were evaluated (AKINS & MORRISSETTE 1968) and granulosa cells were isolated from the ovaries as described previously (NYNCA et al. 2009). All stages of experiments were performed in sterile conditions. Cell viability ($97%) was determined by 0.4% trypan blue dye exclusion. Cells were incubated in Eagle’s medium containing 5% calf serum (CS), gentamycin (0.05 mg/ml) and nystatin (120 U/ml). Aliquots of granulosa cells were cultured in: 1/ 96-well plates (0.2×105 cells/0.1 ml/well) to measure cell viability; 2/ 24well plates (1.5×105 cells/1 ml/well) to measure steroid secretion and to assess the level of ER proteins; and 3/ 6-well plates (2×106 cells/3 ml/well) to analyze the level of ER mRNA. Following 48-72 h of preculture (37°C, 10% CS, 95% air/5% CO2), cells were cultured with treatments (5% CS) for subsequent 48 h. When the experiments were terminated, the media (-20°C) and/or the cells (-80°C)
Genistein and Porcine Granulosa Cells
were collected and stored until all assays were completed. Genistein and lavendustin C were dissolved in ethanol. The highest concentration of ethanol (0.5%) did not affect the examined parameters (granulosa cell viability, steroid hormone secretion, ERs mRNA and protein expression). The effect of genistein on the viability of granulosa cells Cell viability was determined after treatment of genistein with alamarBlueTM reagent (BANNERMAN et al. 2001). After preincubation (48 h), monolayers of granulosa cells were cultured for 48 h with or without genistein (0.05, 0.5, 5 or 50 FM) or staurosporin (STS; a positive control; 5 FM). Twenty four hours before the end of cell culture, alamarBlueTM dye was added to all wells. The medium was collected 24 h later and alamarBlueTM reduction was measured spectrophotometrically at 565 and 595 nm and expressed as a percentage according to the manufacturer’s calculations. All analyses were performed in quadruplicate. The effects of genistein and lavendustin C on steroid hormone secretion For estimation of P4 and E2 secretion, granulosa cell monolayers were preincubated for 72 h and then cultured for 48 h with or without genistein (0.05, 0.5, 5 or 50 FM) in the absence or presence of luteinizing hormone (LH; 100 ng/ml). To compare the effects of genistein and lavendustin C (a protein tyrosine kinase inhibitor that is not a phytoestrogen) on steroid hormone production, cells were also incubated with lavendustin C (0.05, 0.5, 5 or 50 FM) and/or LH (100 ng/ml). In all experiments, medium without treatments served as a control. Medium concentrations of steroid hormones were measured by a previously validated 3H-radioimmunoassays (CIERESZKO et al. 1998, 2001; SZAFRAÑSKA et al. 2002) Intra- and inter-assay coefficients of variation for P4 were 3.75 and 2.45%, respectively. Intra- and inter-assay coefficients of variation for E2 were 3.1 and 2.25%, respectively. Sensitivities of the P4 and E2 assays were 6 and 1 pg/tube, respectively, and were not altered by treatments. Serial dilutions of medium samples showed parallelism with the standard curves of examined steroids. All analyses were performed in triplicate. The effects of genistein on ERá and ERâ mRNA expression The levels of ERá and ERâ mRNA expression were measured in luteinized granulosa cells preincubated for 48 h and then cultured for subsequent 48 h with or without genistein (0.5 or 5 FM). Total
121
RNA was extracted from luteinized granulosa cells after the culture using TRIzol Reagent. For cDNA synthesis, 1 Fg of RNA was reverse transcribed in a 20 Fl reaction volume with 0.5 Fg oligo(dT)15 primer (Roche, Penzberg, Germany) using the Omniscript RT Kit (Hilden, Germany). Complementary DNA was amplified by polymerase chain reaction (PCR; GeneAmp PCR System 2400, Perkin Elmer, Waltham, MA, USA) in a total volume of 50 Fl using 40 pmol of porcine ERá (MUTEMBEI et al. 2005) or ERRâ (PFAFFL et al. 2001) sense and antisense primer pairs: ERá sense 5’AGGGAGAGGAGTTTGTGTG 3’ and antisense 5’TCTCCAGCAGCAGGTCATAG 3’; ERâ sense 5’GCTTCGTGGAGCTCAGCCTG 3’ and antisense 5’AGGATCATGGCCTTGACACAGA 3’. To provide an appropriate internal control, coamplification of GAPDH was carried out in each sample using the GAPDH-sense (5’ATGGTGAAGGTCGGAGTGAA 3’) and antisense (5’CTTGGCAGCGCCGGTAGAAGC 3’) primer pair. Amplification tubes also contained 5 Fl of the first strand cDNA, 25 Fl of HotStarTaq Master Mix (2.5 U HotStarTaq DNA Polymerase, 1×PCR buffer containing 1.5 mM MgCl2, 200 FM of each dNTP). The optimal number of cycles, ensuring the termination of amplification for the genes in the log phase was established by primer dropping method (WONG et al. 1994): 1) 40 and 30 cycles were employed for ERá and GAPDH, respectively, and 2) 38 and 26 cycles were employed for ERâ and GAPDH, respectively. PCR reactions were performed under the following cycling conditions: initial denaturation at 95°C for 15 min, an appropriate number of cycles including denaturation at 95ºC for 20 s, annealing at 59ºC (for ERá gene) or 58ºC (for ERâ gene) for 30 s and elongation at 72ºC for 1 min, followed by a final extension at 72ºC for 7 min. Negative controls were performed without reverse transcriptase and for each pair of primers the non-template controls were carried out. Aliquots of PCR reaction products were electrophoresed on a 1.5% agarose gel stained with ethidium bromide and visualized under ultraviolet illumination. Gel images were saved by FOTO/Analist Achiever software (Fotodyne, Hartland, WI, USA) and product yield was determined using GelScan for Windows ver.1.45 software (Kucharczyk, Warszawa, Poland). Data were expressed as a ratio of ERá or ERâ mRNA relative to GAPDH mRNA in arbitrary optical density units (OD). In addition, the PCR-amplified DNA was sequenced (by DNA Sequencing and Synthesis Laboratory, Institute of Biochemistry and Biophysics, Polish Academy of Science, Warsaw, Poland) in both directions to confirm the accuracy of amplification. Comparison of the PCR-amplified
122
A. NYNCA et al.
DNA sequence to that in the database indicated 100 and 99% homology for ERá and ERâ, respectively, at the nucleotide level.
cells (%) and as the intensity staining of luteinized granulosa cells nuclei (arbitrary units; range: 0-255). Statistical analysis
The effects of genistein on ERá and ERâ protein expression ERá and ERâ protein expression in luteinized granulosa cells preincubated for 72 h and then cultured for subsequent 48 h with or without genistein (0.05, 0.5, 5 or 50 FM) was assessed by immunocytochemistry. Estrogen receptor á and â proteins were detected in granulosa cells plated on ThermanoxTM Coverslips (Nunc, Roskilde, Denmark) using primary mouse monoclonal antibodies against ERá (Dako, Glostrup, Denmark) or ERâ (Serotec, Kidlington, Great Britain) at a dilution of 1:100 (PETTERSSON et al. 1997; SLOMCZYNSKA et al. 2001) or 1:20 (SAUNDERS et al. 2000; SLOMCZYNSKA et al. 2001), respectively. After culture, luteinized granulosa cells were rinsed in PBS and fixed in 4% paraformaldehyde. Then, following washing in PBS, cells were incubated with 0.01% Triton X-100 in PBS for 1 min to permeabilize the cell membranes. Thereafter, to quench endogenous peroxidase activity, cells were incubated with 0.3% H2O2 in PBS for 20 min, and then in 5% normal horse serum in Tris-buffered saline plus Tween-20 (TBST) for 50 min to block the nonspecific binding of the secondary antibody. Subsequently, cells were incubated overnight with primary antibodies, followed by incubation with biotinylated horse anti-mouse antibody (Vector Laboratories, Burlingame, CA, USA) at a 1:300 dilution in TBST for 60 min. Next, the cells were treated with streptavidin-horseradish peroxidase complex (ABC/HRP; Vector Laboratories, USA) at a 1:100 dilution in TBST for 50 min. The color reaction was developed for 5–10 min in diaminobenzidine (DAB) solution (Dako, Glostrup, Denmark). The specificity of immunostaining for ERá and ERâ was tested by omitting the primary antibodies (Fig. 7F). Since no expression of ERá protein was detected in granulosa cells, porcine uterine slices were examined immunohistochemically to additionally analyze the specificity of the used antibodies. Images were recorded for data analysis using a CH30/CH40 microscope and a C-5060 WZ digital camera (Olympus, Tokyo, Japan). The staining distribution (number of stained cells and staining intensity) was quantified using 5 Soft Imaging System (Olympus, Tokyo, Japan). All treatments were run in duplicate and repeated in four separate experiments. Six pictures of the stained cells were taken from each duplicate. The pictures were always taken from the same precisely defined six areas of the coverslip. Data from each duplicate were archived, analyzed and expressed as a number of stained
Analyses were performed using Statistica program (StatSoft Inc., Tulsa, OK, USA). The raw hormone concentrations data were log transformed and then statistically analyzed. Data expressed as a percentage of the number of stained cells were arcsine transformed before the statistical analyses. Amounts of P4 secreted in the absence (control) or presence of LH were compared by the Student’s t-test. All other data were analyzed by one-way ANOVA for repeated measurements followed by the least significant difference (LSD) post hoc test. The level of significance was set at P
