GlcAC5E, perlecan, decorin, syndecan-2, glypican-3, aggrecan, and type II collagen. The results of XT-I mRNA expression were confirmed by enzymatic activity ...
TISSUE-SPECIFIC STEM CELLS The Formation of Extracellular Matrix During Chondrogenic Differentiation of Mesenchymal Stem Cells Correlates with Increased Levels of Xylosyltransferase I ¨ ,a SUSANNE KERN,b CHRISTIAN PRANTE,a KAREN BIEBACK,b CARSTEN FUNKE,a SYLVIA SCHON a a a a ¨ JOACHIM KUHN, MARTIN GASTENS, KNUT KLEESIEK, CHRISTIAN GOTTING a
Institut fu¨r Laboratoriums und Transfusionsmedizin, Herz und Diabeteszentrum NRW, Universita¨tsklinik der Ruhr-Universita¨t Bochum, Bad Oeynhausen, Germany;b Institut fu¨r Transfusionsmedizin und Immunologie, DRK-Blutspendedienst Baden-Wu¨rttemberg-Hessen, Mannheim, Germany
Key Words. Chondrogenesis • Xylosyltransferase I • Proteoglycans • Matrix deposition • Mesenchymal stem cells Differentiation
ABSTRACT In vitro differentiation of mesenchymal stem cells (MSCs) into chondrogenic cells and their transplantation is promising as a technique for the treatment of cartilaginous defects. But the regulation of extracellular matrix (ECM) formation remains elusive. Therefore, the objective of this study was to analyze the regulation of proteoglycan (PG) biosynthesis during the chondrogenic differentiation of MSCs. In different stages of chondrogenic differentiation, we analyzed mRNA and protein expression of key enzymes and PG core proteins involved in ECM development. For xylosyltransferase I (XT-I), we found maximum mRNA levels 48 hours after chondrogenic induction with a 5.04 ⴞ 0.58 (mean ⴞ SD)-fold increase. This result correlates with significantly elevated levels of enzymatic XT-I activity (0.49 ⴞ 0.03 U/1 ⴛ 106 cells) at this time point. Immunohistochemical staining of XT-I revealed a predomi-
nant upregulation in early chondrogenic stages. The highly homologous protein XT-II showed 4.7-fold (SD 0.6) increased mRNA levels on day 7. To determine the differential expression of heparan sulfate (HS), chondroitin sulfate (CS), and dermatan sulfate (DS) chains, we analyzed the mRNA expression of EXTL2 (␣-4-N-acetylhexosaminyltransferase), GalNAcT (1,4-N-acetylgalactosaminyltransferase), and GlcAC5E (glucuronyl C5 epimerase). All key enzymes showed a similar regulation with temporarily downregulated mRNA levels (up to ⴚ87-fold) after chondrogenic induction. In accordance to previous studies, we observed a similar increase in the expression of PG core proteins. In conclusion, we could show that key enzymes for CS, DS, and HS synthesis, especially XT-I, are useful markers for the developmental stages of chondrogenic differentiation. STEM CELLS 2006;24:2252–2261
INTRODUCTION
into chondrocytes is still incomplete. Particularly, data about the transcriptional regulation of enzymes and core proteins involved in the biosynthesis of proteoglycans (PGs) are insufficient. Here, we analyzed the mRNA expression from genes coding for PG core proteins as well as the regulation of the key enzymes involved in PG assembly. Xylosyltransferase I (XT-I) is the key enzyme that initiates the biosynthesis of glycosaminoglycan chains [6, 7]. The enzyme catalyzes the transfer of uridinediphosphate-xylose to specific serine residues of the core proteins in PGs and is located in the early Golgi compartments [8]. Previously, we could show that XT-I is secreted from the Golgi apparatus into the extracellular space together with PGs [9 –11]. Therefore, XT-I is a reliable marker for the PG biosynthesis rate, as our group has
The ability of bone marrow (BM)-derived mesenchymal stem cells (MSCs) to differentiate along a number of connective tissue pathways has been well described [1– 4]. Therefore, they are an attractive source of chondrocyte precursor cells, which are of special interest for tissue engineering to regenerate damaged cartilage. When these cells are cultured in a three-dimensional format in the presence of transforming growth factor 3 (TGF-3), they undergo characteristic morphological changes concurrent with deposition of cartilaginous extracellular matrix (ECM) [4, 5]. The potential of adult MSCs to differentiate toward chondrocytes is well established. However, knowledge of remodeling of cartilaginous ECM during the differentiation of MSCs
Correspondence: Christian Go¨tting, Ph.D., Institut fu¨r Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum NRW, Georgstrae 11, 32545 Bad Oeynhausen, Germany. Telephone: ⫹49-5731-972033; Fax: ⫹49-5731-972013; e-mail: cgoetting@ hdz-nrw.de. Received October 12, 2005; accepted for publication June 10, 2006; first published online in STEM CELLS EXPRESS June 15, 2006. © AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2005-0508
STEM CELLS 2006;24:2252–2261 www.StemCells.com
Prante, Bieback, Funke et al. demonstrated [9]. In that recent study, we analyzed the expression of XT-I and additionally investigated the regulation of xylosyltransferase II (XT-II). XT-II is a phylogenetically conserved protein that is highly homologous to XT-I. Even though the physiological function of this protein is still unclear, a functional role during the assembly of ECM is probable [12]. After the synthesis of the tetrasaccharid-linker initiated by XT-I, the elongation of glycosaminoglycan chains demands a complex interaction of different enzymes. To analyze a differential expression of heparan sulfate (HS), chondroitin sulfate (CS), and dermatan sulfate (DS) chains during ECM assembly, we determined the expression levels of further key enzymes involved in the differentiating pathways. To differentiate between the pathways of CS, DS, and HS biosynthesis, we analyzed the expression of the key enzymes: ␣4-N-acetylhexosaminyltransferase (EXTL2), 1,4-N-acetylgalactosaminyltransferase (GalNAcT), and glucuronyl C5 epimerase (GlcAC5E). Thereby, EXTL2 transfers GalNAc/GlcNAc from uridinediphosphate-GalNAc/GlcNAc to the tetrasaccharide linker and is therefore a key enzyme for the synthesis of HS chains. GalNAcT initiates the synthesis of CS and DS chains by the transfer of the first GalNAc to the core tetrasaccharide in the protein linkage. According to these GAG chains, an irreversible epimerisation of CS to DS is catalyzed by GlcAC5E [13]. To identify marker genes and proteins involved in ECM remodeling during cartilage differentiation, we subjected human BM-derived MSCs to chondrogenic differentiation in high-density pellet culture and analyzed the expression of marker genes, proteins, and enzymes at different time points. Reverse transcription-polymerase chain reaction (RT-PCR), histochemical, and immunohistochemical analyses revealed the appropriate phenotype of differentiated cells (positive Alcian Blue, Sirius red, and Safranin O staining, upregulation of collagen type II and aggrecan). During chondrogenic differentiation, stem cells expressed XT-I, XT-II, EXTL2, GalNAcT, GlcAC5E, perlecan, decorin, syndecan-2, glypican-3, aggrecan, and type II collagen. The results of XT-I mRNA expression were confirmed by enzymatic activity analysis. Assembly of PGs was detected by histochemical analysis with Alcian Blue and immunohistochemically with specific antibodies against decorin, CS, and XT-I.
MATERIALS
AND
METHODS
Collection and Isolation of MSCs from BM BM was obtained from the femoral shaft of patients undergoing total hip replacement at the orthopedic department of the University Hospital Mannheim. In total, six specimens from female patients were obtained, with the donor age ranging from 68 to 84 years. The aspirated cells were diluted 1:5 with phosphate-buffered saline (PBS)/2 mM EDTA (Baxter, Unterschleiheim, Germany, http://www.baxter.de, and Merck, Darmstadt, Germany, http://www.merck. de) and centrifuged on Ficoll-Hypaque gradients (GE Healthcare, Little Chalfont, Buckinghamshire, UK, http://www.gehealthcare.com) at 435g for 30 minutes at room temperature. The interface mononucleated cells (MNCs) were collected, washed, and counted. BM-derived MNCs were cultivated at a density of 1 ⫻ 105/cm2 in 75-cm2 tissue culture flasks (NUNC GmbH & Co. www.StemCells.com
2253
KG, Wiesbaden, Germany, http://www.nunc.de) in MSC growth medium (MSCGM BulletKit; Cambrex, St. Katharinen, Germany, http://www.cambrex.com). After overnight incubation at 37°C in humidified atmosphere containing 5% CO2, all nonadherent cells were discarded, and the adherent culture was maintained with a twice weekly complete exchange of culture medium. A monolayer of approximately 70% confluency was observed after 7–10 days of initial plating. The cells were then harvested by using 0.04% trypsin/0.03% EDTA (PromoCell, Heidelberg, Germany, http:// www.promocell.com). To expand the cells, they were replated at a density of 4,000 –5,000 cells per cm2 at passage 1 and thereafter. MSC identity was proven by performing fluorescence-activated cell sorting analysis and mesodermal differentiation assays (osteogenic, adipogenic, and chondrogenic) as shown previously [14].
Chondrogenic Differentiation Chondrogenesis was induced in passages 2– 4 as described previously [4]. Briefly, 2.5 ⫻ 105 cells were gently centrifuged (150g, 5 minutes) in a 15-ml polypropylene tube. Without disturbing the formed pellet, the cells were cultured in complete chondrogenic differentiation medium containing 0.1 M dexamethasone (Decadron; Merck & Co., Inc., Whitehouse Station, NJ, http://www.merck.com), 1 mM sodium pyruvate, 0.17 mM ascorbic acid-2-phosphate, 0.35 mM proline, 6.25 g/ml bovine insuline, 6.25 g/ml transferrin, 6.25 g/ml selenous acid, 5.35 g/ml linoleic acid, and 1.25 mg/ml bovine serum albumin (BSA) (Cambrex) supplemented with 10 ng/ml TGF-3 (Strathmann Biotec GmbH & Co. KG, Hamburg, Germany, http:// www.biotec-ag.de) by feeding twice a week. The conditioned medium was harvested at the indicated time points. At indicated time points, pellets were harvested in RLT buffer (Qiagen, Hilden, Germany, http://www1.qiagen.com) for the isolation of mRNA or cryosections were performed.
Histological Staining The sections were fixed with icecold acetone (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) and stained with 0.1% aqueous Safranin O solution (Sigma-Aldrich). Cell nuclei were counterstained with Weigert’s iron hematoxylin (Sigma-Aldrich). Alcian Blue staining was used for histological assessment of the total PG content. Cryosections of differentiated chondrogenic pellets were stained for 30 minutes with 1% Alcian Blue in 3% acetic acid. Cell nuclei were counterstained for 5 minutes with 0.1% Kernechtrot in 5% aluminum sulfate. The total collagen content was detected by Sirius red staining. Cryosections were stained for 60 minutes with 0.1% Sirius red F3B (Sigma-Aldrich) in an aqueous solution of picric acid (1.2%).
Immunohistochemistry and Densitometric Analysis MSCs undergoing chondrogenic differentiation were subjected to immunohistochemical analysis for XT-I, CS, and decorin. Cryosections from differentiated pellets were fixed with icecold acetone and preincubated with 2% BSA and 3% fetal calf serum in Tris-buffered saline (TBS). For the detection of XT-I, the sections were incubated with a 1:50 dilution (diluent S0809; Dako, Hamburg, Germany, http://www.dako.com) of anti-XT-I
Increased XT-I During Chondrogenic Differentiation
2254
antibody (polyclonal rabbit IgG against human XT-I peptide [15]) for 1 hour at room temperature. After rinsing with TBS, the secondary antibody (Universal LSAB Plus-Kit AP; Dako) was applied at room temperature for 15 minutes. After rinsing with TBS, signals were developed using a Fuchsin-Plus staining solution (Dako) to identify bound antibody. The detection of decorin was carried out using anti-decorin antibody (polyclonal rabbit IgG against human decorin core protein [16]). CS-56 (monoclonal mouse IgM anti-CS; Sigma-Aldrich) was used for the detection of CS. Both antibodies were used at a 1:50 dilution (diluent: S0809; Dako) analogue to the immunohistological staining of XT-I. For the semiquantitative and quantitative analyses of the relative Fuchsin red content in the histological stainings, a densitometric analysis was performed using ImageJ software (National Institutes of Health, Bethesda, MD, http://www.nih. gov) as described below. The relative content of stained red fractions was determined by color-selective conversion of the red-stained areas and the subsequent analysis of stained pixels. Multiple representative sections (at least six) were analyzed by two independent researchers.
RNA Extraction and Reverse Transcription The total RNA isolates were obtained from cells within the chondrogenic differentiation using a commercial kit with additional on-column DNase I treatment according to the manufacturer’s recommendations (Qiagen). Reverse transcription was performed using SuperScript II Reverse Transcriptase (Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com).
LightCycler Real-Time Quantitative RT-PCR Analysis The mRNA expression of all target genes was analyzed by a fluorogenic RT-PCR assay using the LightCycler System (Roche, Mannheim, Germany, http://www.roche.com). The PCR for the mRNA quantification was performed using an SYBR Green Taq-DNA polymerase mixture (Platinum SYBR Green qPCR SuperMix-UDG; Invitrogen). Thermal cycling conditions included enzymatic degradation of uracil-containing DNA at 50°C for 2 minutes, activation of the DNA polymerase at 95°C for 2 minutes, followed by 45 cycles at 94°C for 5 seconds, at 58°C for 15 seconds, and at 72°C for 15 seconds. Primers used for a specific amplification of the target genes are shown in Table 1. The transcriptional levels of all target genes were normalized to constant mRNA levels of ubiquitin.
XT-I Activity Assay Using cell culture supernatant, we carried out the analysis of XT-I activity from chondrogenic samples as described previously [17].
Statistical Analysis Statistical evaluation was performed with the Student’s t test. A p value of less than .05 was considered significant. Values of the mRNA expression are expressed in arbitrary units as mean ⫾ SD.
Table 1. Primers used for reverse transcription-polymerase chain reaction Gene Ubiquitin
Oligo
Ubi_F Ubi_R XT-I XT-I F XT-I R XT-II XT-II F XT-II R GalNAcT GalNAcT F GalNAcT R EXTL2 EXTL2 F EXTL2 R Perlecan Perlecan F Perlecan R Syndecan-2 Syndecan F Syndecan R GlcAC5E GlcAC5E F GlcAC5E R Aggrecan Aggrecan F Aggrecan R Decorin Decorin F Decorin R IIa1-Collagen Collagen II F Collagen II R Glypican-3 Glypican-3 F Glypican-3 R
Sequence CTCCACCTCCAGGGTGAT GATTCAGGATAAGGAAGGCAT CGGTCCTGGAGAACAGCC CCCAATGATTTCCTGATTCAC TGGCCTGTGAGACCCTCG AGAAGGTGGGTCTGGAGACT CTTACACGGCCTCTGATT GCTAGAGGCACGATAACA CTCCAATCAGCACCATAG GAGAAGGCACCAGATGAA GCAGTTGGCTTCATCAG GCAGTTGGCTTCATCAG AATGACAGCTGCTAGGAC GGAGCTGATGAGGATGTA ACAATGTGGAAGTCCGAG CAGTTGCAAGGATACACC CCTCAGAGGAACCATCAGC CCACTGTGGAAGTAAGACC CCTTCCGCTGTCAATG GCAGGTCTAGCAGAGTTG CCGGGCAGAGGGCAATAGCAG GTTCAATGATGGGGAGGCGTGAG GATACAGCCAAAAGGCAG ATCATTCCATCACCAGAG
Abbreviations: EXTL2, ␣-4-N-acetylhexosaminyltransferase; F, forward; GalNAcT, -1,4-N-acetylgalactosaminyltransferase; GlcAC5E, glucuronyl C5 epimerase; R, reverse; XT, xylosyltransferase.
RESULTS Lineage-Specific Differentiation of MSCs By culturing the cells as a pellet under chondrogenic differentiation conditions, chondrogenic differentiation was achieved in all MSCs tested. Within the first day, the cells consolidated to form a tight aggregate. Chondrocyte-like lacunae and an extensive deposition of ECM were evident in the cryosections and could be detected with Alican Blue and Safranin O staining (Fig. 1). As described previously [18, 19], MSCs treated with chondrogenic supplements expressed chondrogenic-specific markerlike type II collagen, as well as aggrecan (Figs. 2, 3).
mRNA Expression of XT-I and the Homolog XT-II During the Process of Chondrogenic Differentiation RT-PCR analysis of the xylosyltransferase family members during the chondrogenic differentiation is shown in Figure 4. XT-I and XT-II were expressed prior to the initiation of chondrogenesis and throughout all stages of the differentiation pathway. However, for XT-I, we found a significant upregulation after 48 hours of chondrogenic induction with TGF-3. At this time, cell pellets exhibited 5.04-fold (SD 0.58) increased XT-I expression levels. One week after chondrogenic differentiation, the XT-I expression decreased to the level of undifferentiated cells and persisted there until differentiation was complete. RT-PCR for XT-II revealed 4.7-fold (SD 0.6) increased levels in cell pellets after 7 days of differentiation with a subsequent decrease to the basic transcription level for up to 4 weeks.
Prante, Bieback, Funke et al.
2255
Figure 1. Chondrogenic differentiation capacity of mesenchymal stem cells. Cultured cells from bone marrow harvests were exposed in vitro to differentiation medium to induce chondrogenic differentiation. (A): Monolayer of mesenchymal stem cells derived from bone marrow (passage 0, day 8). (B): Chondrogenesis was shown by Safranin O staining in cryosections of pellets formed after 4 weeks of chondrogenic differentiation in micromass cultures. (C): Control: cryosection of septal cartilage stained with Safranin O. (D– F): Alcian Blue-stained cryosection of differentiated pellets. Nuclei were counterstained with Kernechtrot. Magnifications, ⫻100 (A, D), ⫻40 (B, C), ⫻400 (E), ⫻1,000 (F).
crucial enzyme for HS biosynthesis, minimum mRNA levels were detected after 4 days (⫺87 ⫾ 0.6-fold). After complete differentiation (up to 4 weeks), the mRNA expression reached the base level. The regulation of GalNacT, which is a key enzyme for CS/DS biosynthesis, was similar to EXTL2. RT-PCR for GalNAcT revealed downregulated levels of mRNA on the first day (⫺2.7 ⫾ 0.4-fold) and minimum levels after 3 days (⫺9.6 ⫾ 0.2-fold) after chondrogenic induction. As with EXTL2, the mRNA expression nearly reached the base level at later stages of chondrogenic differentiation. For GlcAC5E, which is responsible for the conversion of chondroitin to dermatan and heparin to HS, we found an equal mRNA abundance with minimum expression levels 4 days (⫺10.7 ⫾ 0.5-fold) after lineage-specific differentiation. Figure 2. Sirius red staining (magnification, ⫻50). Increasing amounts of collagen deposition during chondrogenic maturation from day 1 (A) to day 7 (B) and day 28 (C) are shown. (D): Sections from the murine femoral shaft were used as positive control for the Sirius red staining.
Enzymatic Activity of XT-I in Cell Culture Supernatant During chondrogenic differentiation, we determined the enzymatic activity of XT-I in the cell culture supernatant. The XT-I activity was analyzed in the first 7 days and after 4 weeks of chondrogenic induction. Thereby, the culture medium was replaced twice a week. We found an increased secretion of XT-I enzyme in early stages of differentiation, whereas the maximum of enzymatic activity was reached after 3 days (0.51 ⫾ 0.03 U/1 ⫻ 106 cells) of chondrogenesis (Fig. 5). In parallel to the control media, there was no significant XT-I expression after 4 weeks of chondrogenic differentiation.
Transcriptional Regulation of EXTL2, GalNAcT, and GlcAC5E During Chondrogenic Differentiation In high-density cell pellets, EXTL2, GalNacT, and GlcAC5E were expressed prior to the initiation of chondrogenic differentiation (Fig. 4). For all enzymes, we found significantly downregulated mRNA levels after the chondrogenic induction with the lowest levels at day 3 or day 4. For EXTL2, which is a www.StemCells.com
Differential mRNA Expression of the PGs Decorin, Aggrecan, Perlecan, Glypican-3, and Syndecan-2 The large aggregating PG aggrecan and the small leucin-rich PG decorin are PGs that contain CS side chains. For both targets, chondrogenic induction caused an early response with an augmentation of the mRNA abundance followed by intermediately downregulated expression levels. In the late stages of differentiation, mRNA levels increased up to threefold over base level (Fig. 3). Thereby, decorin revealed a 2.2-fold (SD 0.11) heightened mRNA abundance 4 weeks after induction with TGF-3. Levels of aggrecan mRNA showed a maximum increase after 7 days with a 3.1-fold (SD 0.8) elevation. Glypican-3, syndecan-2, and perlecan are all PGs mostly associated with HS chains and revealed a differential mRNA expression. In parallel with decorin and aggrecan, the chondrogenic induction caused a comparable mRNA transcription for perlecan. Glypican-3 was found to be a differentially regulated HS PG; we identified glypican-3 with low transcriptional levels at the first days of incubation but with a continuous increase after 5 days with a nearly ninefold augmentation after 4 weeks of differentiation. In contrast, syndecan-2 exhibits only marginal transcriptional changes during chondrogenic differentiation with maximum mRNA levels after 28 days of differentiation with up to 1.1-fold increased mRNA levels (data not shown).
2256
Increased XT-I During Chondrogenic Differentiation
Figure 3. Transcriptional regulation of chondrogenic marker genes during the chondrogenic differentiation of mesenchymal stem cells. Reverse transcription-polymerase chain reaction analysis is shown for the proteoglycan core proteins aggrecan, decorin, perlecan, and syndecan-2 and for type II collagen. Values are displayed as the mean with corresponding SD. The culture time is displayed in days.
Immunohistochemical Staining of XT-I, Decorin, and CS PGs in High-Density Pellets Immunohistochemistry of slides cut through the center of the differentiated pellets indicated the highest levels of XT-I di-
rectly after chondrogenic induction and a weak staining in the following days (Fig. 6A– 6C). This observation is in parallel with mRNA and enzymatic data. The deposition was detected in discrete areas around the newly synthesized PGs.
Prante, Bieback, Funke et al.
2257
Figure 4. Transcriptional regulation of chondrogenic marker genes during the chondrogenic differentiation of mesenchymal stem cells. Reverse transcription-polymerase chain reaction analysis is shown for key enzymes involved in glycosaminoglycan assembly (XT-I, XT-II, GalNAcT, GlcAC5E, and EXTL2). Values are displayed as mean with corresponding SD. The culture time is displayed in days. Abbreviations: EXTL2, ␣-4-N-acetylhexosaminyltransferase; GalNAcT, -1,4-Nacetylgalactosaminyltransferase; GlcAC5E, glucuronyl C5 epimerase; XT, xylosyltransferase.
With the use of antibodies specific against human decorin and CS, staining revealed anti-decorin and anti-CS antibody with a smooth allocation located in the areas of ECM depowww.StemCells.com
sition. Thereby, the content of immunologically detected decorin increased continuously over the period of cultivation (Fig. 6D– 6F). We observed a more extensive increase in
2258
Increased XT-I During Chondrogenic Differentiation periods of both parameters in vivo. XT-I is secreted from the Golgi apparatus into the extracellular space together with PGs. Therefore, the physiologically stable XT-I enzyme could accumulate in the supernatant, which results in increased enzymatic activities (Fig. 5). For XT-II, a protein that is highly homologous to XT-I and phylogenetically conserved, we found highly increased mRNA levels after 7 days of chondrogenic induction. As is already known, XT-I is involved in the assembling of ECM, whereas XT-II with a differential transcription may exhibit other physiological functions, which will have to be clarified in further experiments.
Regulatory Response of the CS and DS Biosynthetic Pathway on the TGF-3 Induced Chondrogenic Differentiation
Figure 5. Enzymatic activity of xylosyltransferase (XT)-I in samples from the cell culture supernatant of differentiating stem cells. The XT-I activity was determined by the catalytic transfer of uridinediphosphate[14C]xylose to silk fibroin, attached to a nitrocellulose membrane. Supernatant from early stages of chondrogenic differentiation shows significantly increased XT-I activities in comparison with undifferentiated cells. Data are shown as the mean ⫾ SD. The culture time is displayed in days.
fuchsin staining using CS antibody in comparison with decorin (Fig. 6G– 6I).
DISCUSSION During chondrogenic differentiation, the remodeling of ECM with a distinct deposition of PGs is a critical factor for the physiological efficiency of in vitro cultivated cartilage. The loading capacity in particular depends on the PG content in cartilage. But there is only limited knowledge about regulation of the rate-limiting enzymes involved in the GAG synthesis. Therefore, in the present study, we examined the effect of TGF-3-mediated MSC chondrogenesis on the mRNA abundance of XT-I and additional rate-limiting enzymes that initiate and determine further CS, DS, and HS synthesis.
Differential Regulation of XT-I and XT-II During Chondrogenic Differentiation XT-I catalyzes the initial and rate-limiting step in the biosynthesis of glycosaminoglycan chains in CS, DS, and HS PGs and, therefore, represents a key enzyme for ECM assembly. Increased levels of XT-I mRNA (Fig. 4) and enzymatic activity (Fig. 5) during the early stages of chondrogenic induction show the essential function of this enzyme: building up a distinct ECM that is characteristic for cartilage. These results are in parallel with the localization of the protein in chondrogenic pellets, where we found significantly increased levels of XT-I in areas of newly synthesized matrix (Fig. 6A– 6C). Regarding mRNA and enzymatic data, we observed shifted maximums which are plausible because of the different half-life
In addition to investigating aggrecan, which builds up the major PG in chondrocytes, we investigated the regulation of decorin. It belongs to the group of small leucin-rich PGs and is known to modulate collagen fibrillogenesis [20, 21]. Decorin carries one CS or DS side chain that is probably involved in maintaining the fibril to fibril spacing [22]. Immunohistochemical analysis revealed a broad allocation of the decorin core protein in the chondrogenic cryosections. As expected from the mRNA analysis, we found increasing amounts of decorin in the cryosections during the period of chondrogenic differentiation (Fig. 6D– 6F). Thereby, the uniform distribution was colocalized with the chemically stained ECM. In this context, the mRNA expression of GlcAC5E, which is responsible for the synthesis of DS [23], is an interesting parameter. After chondrogenic induction, we found significantly downregulated mRNA levels of GlcAC5E after up to 1 week of chondrogenesis and increased levels after 4 weeks. The irreversible conversion of the CS side chain into DS [13] observed in later stages of differentiation may therefore have a regulatory effect on the formation of the collagen fibrils. For GalNAcT, which is a key enzyme for the CS and DS pathway, we found a similar intermediate transcriptional downregulation directly after chondrogenic induction and increasing amounts of mRNA after 5 days of cultivation. These results were in parallel with the major transcriptional increase of decorin at this point in time. These data show that the mRNA abundance of key enzymes and core proteins involved in the biosynthesis of PGs with CS or HS chains is equally regulated at early chondrogenic stages, especially after 5 days. Increased levels of decorin and GalNAcT in early stages of matrix deposition are in parallel with the mRNA content of type II collagen. As already reported, decorin was shown to stabilize collagen fibrils in the ECM and orientate fibrillogenesis [24 –27]. Therefore, we could show that, besides collagen, the matrix formation during chondrogenic development can be characterized by mRNA expression of core proteins and key enzymes involved in the biosynthesis of PGs. Those targets, which are involved in the formation of collagen fibers, are potentially interesting markers for early chondrogenic differentiation.
Prante, Bieback, Funke et al.
2259
Figure 6. Immunohistochemical detection of XT-I, decorin, and CS proteoglycans in chondrogenic cell pellets were proceeded at day 1 (A, D, G), day 7 (B, E, H), and day 28 (C, F, I). (A–C): In cryosections from chondrogenic pellets, the detection of XT-I was performed using polyclonal rabbit anti-human XT-I antibody. (D–F): Detection of decorin using polyclonal rabbit immunoglobulin G against human decorin core protein. (G–I): Immunohistochemical detection of CS proteoglycans using CS-56 anti-CS antibody (Sigma-Aldrich). Bound antibody was detected using a Fuchsin-Plus staining solution (red staining). Sections were counterstained with hematoxylin (blue staining of nuclei and extracellular matrix). Magnification, ⫻100 (A–I). Abbreviations: CS, chondroitin sulfate; XT, xylosyltransferase.
Regulatory Response of the HS Biosynthetic Pathway on the TGF-3 Induced Chondrogenic Differentiation We examined the regulation of glypican-3, syndecan-2, and perlecan according to the PGs with HS side chains. Glypican-3 and syndecan-2 belong to the group of cell surface PGs and are involved in the initiation and support of chondrogenic development [28, 29]. For glypican-3, we detected significantly increased mRNA abundance starting from early chondrogenic stages (day 5) up to the differentiated chondrocytes (day 28). Starting from day 5, the proportion of transcriptional increase of glypican-3 and EXTL2 was very similar, indicating a direct correlation between the key enzyme involved in HS chain elongation and its target. Interestingly, we found only low transcriptional levels with marginal changes during the differentiation process for syndecan-2. These findings have to be clarified in future studies, which should focus on the role of syndecan-2 in MSC differentiation. Perlecan represents the major HS PG [30] and exhibits important physiological functions during the matrix maturation of chondrocytes, as shown in previous studies [31, 32]. In this case, we observed heightened mRNA levels in the later stages of lineage-specific differentiation. The transcriptional regulation of EXTL2 was in parallel to GalNAcT, with an intermediate downregulation directly after chondrogenic induction and increasedmRNA levels after 7 days. This indicates that during chondrogenic morphogenesis the expression of both modifying enzymes as well as core proteins of the GAGs responds to the same progression. www.StemCells.com
Summary In accordance with our previous studies, we could show that the chondrogenic differentiation of MSCs correlates with the assembly of ECM during the different stages of maturation. Besides different types of collagen, core proteins like aggrecan and perlecan are standard markers for the development of chondrocytes [4, 30, 32–34]. The present study reveals that the key enzymes involved in the assembly of GAGs are useful for the detection of matrix deposition during chondrogenesis. Increased levels of XT-I, EXTL2, and GalNAcT indicate newly synthesized matrix, whereas increasing levels of GlcAC5E are associated with an irreversible ECM remodeling of CS toward DS. According to the progression of the chondrogenic differentiation, we could also show that key enzymes of the GAG synthesis as well as the corresponding core proteins are regulated in a very similar coordinated way. In this context, it is interesting to look at the upregulation of type II collagen in early chondrogenic stages. Collagen and PGs exhibit similar characteristics in the trend of mRNA abundance. This indicates the complex interplay of the different matrix-forming components. XT-I seems to have an exceptional position during this complex process of ECM production. The expression of this first enzyme in GAG synthesis is significantly increased in early chondrogenic stages, suggesting that XT-I is a limiting factor during PG biosynthesis. These findings are in concordance with other studies in which XT-I could also be identified as the rate-limiting step in PG biosynthesis [8, 35]. Previous studies from our group have shown that serum XT-I activity is a biochemical marker for staging and monitoring the progression
2260
of articular cartilage damage in osteoarthritis. Additionally, we could show that mutations in the XT-II gene are in correlation with an earlier manifestation of osteoarthritis [36]. This indicates that the key enzymes responsible for chondrogenic maturation, especially XT-I, are potentially interesting genes in the context of matrix buildup, regeneration, and destruction.
Limitations The present study reveals new data for the complex process of ECM remodeling and deposition during the chondrogenic differentiation of MSCs. We used different methods to detect changes in the expression of selected targets on the mRNA, protein, or enzymatic activity level. According to the mRNA data, the transcriptional level of mRNA and the corresponding total mRNA content, which is isolated from a cell, do not have to be identical. Therefore, our investigations are based on the cellular mRNA content and are not able to distinguish between an extended mRNA half-life and actually increased transcription rates. To differentiate between different transcriptional mRNA levels, it would be necessary to investigate the mRNA half-life
REFERENCES 1
Majumdar MK, Thiede MA, Mosca JD et al. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J Cell Physiol 1998;176:57– 66.
2
Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–147.
3
Yoo JU, Barthel TS, Nishimura K et al. The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg Am 1998;80:1745–1757.
4
Mackay AM, Beck SC, Murphy JM et al. Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng 1998;4:415– 428.
5
Barry F, Boynton RE, Liu B et al. Chondrogenic differentiation of mesenchymal stem cells from bone marrow: Differentiation-dependent gene expression of matrix components. Exp Cell Res 2001;268:189 –200.
6
Schwartz NB. Regulation of chondroitin sulfate synthesis. Effect of beta-xylosides on synthesis of chondroitin sulfate proteoglycan, chondroitin sulfate chains, and core protein. J Biol Chem 1977;252: 6316 – 6321.
7
Kearns AE, Campbell SC, Westley J et al. Initiation of chondroitin sulfate biosynthesis: A kinetic analysis of UDP-D-xylose: core protein beta-D-xylosyltransferase. Biochemistry 1991;30:7477–7483.
8
Scho¨n S, Prante C, Bahr C et al. Cloning and recombinant expression of active full-length xylosytransferase I (XT-I) and characterization of subcellular localization of XT-I and XT-II. J Biol Chem 2006;281: 14224 –14231.
9
Go¨tting C, Sollberg S, Kuhn J et al. Serum xylosyltransferase: A new biochemical marker of the sclerotic process in systemic sclerosis. J Invest Dermatol 1999;112:919 –924.
Increased XT-I During Chondrogenic Differentiation for all target genes at all times of mRNA isolation during chondrogenic differentiation. However, we do have first evidence for cytokine-induced alterations of XT-I expression levels that altered mRNA levels are a cause of different transcriptional activity rather than of mRNA half-life alterations (C. Prante, unpublished data). MSCs do have a capacity for osteogenic differentiation. We have taken into account that ECM molecules like XT-I are also influenced by triggers for an osteogenic differentiation. However, first results on XT-I during osteogenic differentiation of MSCs show different transcriptional activity patterns (data not shown).
ACKNOWLEDGMENTS We thank Sarah Kirkby for linguistic advice and Berit Abel for technical assistance. This work was supported by the “Forschungsfo¨rderung an der Medizinischen Fakulta¨t der Ruhr-Universita¨t Bochum (FORUM),” Grant F414-2004.
DISCLOSURES The authors indicate no potential conflicts of interest.
13 Hagner-McWhirter A, Li JP, Oscarson S et al. Irreversible glucuronyl C5-epimerization in the biosynthesis of heparan sulfate. J Biol Chem 2004;279:14631–14638. 14 Bieback K, Kern S, Klu¨ter H et al. Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. STEM CELLS 2004;22:625– 634. 15 Kuhn J, Mu¨ller S, Schno¨lzer M et al. High-level expression and purification of human xylosyltransferase I in High Five insect cells as biochemically active form. Biochem Biophys Res Commun 2003;312: 537–544. 16 Scho¨nherr E, Hausser H, Beavan L et al. Decorin-type I collagen interaction. Presence of separate core protein-binding domains. J Biol Chem 1995;270:8877– 8883. 17 Go¨tting C, Mu¨ller S, Scho¨ttler M et al. Analysis of the DXD motifs in human xylosyltransferase I required for enzyme activity. J Biol Chem 2004;279:42566 – 42573. 18 Fortier LA, Nixon AJ, Williams J et al. Isolation and chondrocytic differentiation of equine bone marrow-derived mesenchymal stem cells. Am J Vet Res 1998;59:1182–1187. 19 Nakata K, Nakahara H, Kimura T et al. Collagen gene expression during chondrogenesis from chick periosteum-derived cells. FEBS Lett 1992; 299:278 –282. 20 Pogany G, Hernandez DJ, Vogel KG. The in vitro interaction of proteoglycans with type I collagen is modulated by phosphate. Arch Biochem Biophys 1994;313:102–111. 21 Reed CC, Iozzo RV. The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj J 2002;19:249 –255. 22 Milan AM, Sugars RV, Embery G et al. Modulation of collagen fibrillogenesis by dentinal proteoglycans. Calcif Tissue Int 2005;76:127–135.
10 Kuhn J, Mo¨lle K, Brinkmann T et al. High-density tissue-like cultivation of JAR choriocarcinoma cells for the in vitro production of human xylosyltransferase. J Biotechnol 2003;103:191–196.
23 Tiedemann K, Larsson T, Heinegard D et al. The glucuronyl C5-epimerase activity is the limiting factor in the dermatan sulfate biosynthesis. Arch Biochem Biophys 2001;391:65–71.
11 Kuhn J, Go¨tting C, Schno¨lzer M et al. First isolation of human UDP-Dxylose: Proteoglycan core protein beta-D-xylosyltransferase secreted from cultured JAR choriocarcinoma cells. J Biol Chem 2001;276: 4940 – 4947.
24 Scott JE, Orford CR, Hughes EW. Proteoglycan-collagen arrangements in developing rat tail tendon. An electron microscopical and biochemical investigation. Biochem J 1981;195:573–581.
12 Go¨tting C, Kuhn J, Zahn R et al. Molecular cloning and expression of human UDP-d-Xylose:proteoglycan core protein beta-d-xylosyltransferase and its first isoform XT-II. J Mol Biol 2000;304:517–528.
25 Pringle GA, Dodd CM. Immunoelectron microscopic localization of the core protein of decorin near the d and e bands of tendon collagen fibrils by use of monoclonal antibodies. J Histochem Cytochem 1990;38: 1405–1411.
Prante, Bieback, Funke et al.
26 Fleischmajer R, Fisher LW, MacDonald ED et al. Decorin interacts with fibrillar collagen of embryonic and adult human skin. J Struct Biol 1991;106:82–90. 27 Keene DR, San Antonio JD, Mayne R et al. Decorin binds near the C terminus of type I collagen. J Biol Chem 2000;275:21801–21804. 28 Molteni A, Modrowski D, Hott M et al. Differential expression of fibroblast growth factor receptor-1, -2, and -3 and syndecan-1, -2, and -4 in neonatal rat mandibular condyle and calvaria during osteogenic differentiation in vitro. Bone 1999;24:337–347. 29 Kirn-Safran CB, Gomes RR, Brown AJ et al. Heparan sulfate proteoglycans: Coordinators of multiple signaling pathways during chondrogenesis. Birth Defects Res C Embryo Today 2004;72:69 – 88. 30 Gomes RR Jr., Farach-Carson MC, Carson DD. Perlecan functions in chondrogenesis: Insights from in vitro and in vivo models. Cells Tissues Organs 2004;176:79 – 86. 31 Gomes R, Kirn-Safran C, Farach-Carson MC et al. Perlecan: An important component of the cartilage pericellular matrix. J Musculoskelet Neuronal Interact 2002;2:511–516.
www.StemCells.com
2261
32 French MM, Gomes RR Jr., Timpl R et al. Chondrogenic activity of the heparan sulfate proteoglycan perlecan maps to the N-terminal domain I. J Bone Miner Res 2002;17:48 –55. 33 Chen CW, Tsai YH, Deng WP et al. Type I and II collagen regulation of chondrogenic differentiation by mesenchymal progenitor cells. J Orthop Res 2005;23:446 – 453. 34 French MM, Smith SE, Akanbi K et al. Expression of the heparan sulfate proteoglycan, perlecan, during mouse embryogenesis and perlecan chondrogenic activity in vitro. J Cell Biol 1999;145:1103–1115. 35 Rode´n L. Structure and metabolism of connective tissue proteoglycans. In: Lennarz WJ, ed. The Biochemistry of Glycoproteins and Proteoglycans. New York: Plenum Publishing Corp., 1980:269 –314. 36 Scho¨n S, Huep G, Prante C et al. Mutational and functional analyses of xylosyltransferases and their implication in osteoarthritis. Osteoarthritis Cartilage 2006;14:442– 448.
