Page 1 of 26 Articles in PresS. Am J Physiol Heart Circ Physiol (March 16, 2007). doi:10.1152/ajpheart.01374.2006
1
The Functional Consequence of RhoA knockdown by RNA Interference in Rat Cerebral Arteries Randolph L. Corteling1, Suzanne E. Brett1, Hui Yin2, Xi-Long Zheng2, Michael P. Walsh2 and Donald G. Welsh1 1
Department of Physiology and Biophysics, University of Calgary, Calgary, Alberta, Canada T2N 4N1
2
Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Alberta, Canada T2N 4N1
Running Title: RhoA knockdown in cerebral arteries Keywords: Arterial tone, G-proteins, F/G-actin, myosin light chain phosphorylation, small interfering RNA
Corresponding author: Donald G. Welsh, PhD Department of Physiology and Biophysics HMRB-G86, Heritage Medical Research Building 3330 Hospital Drive, N.W Calgary, Alberta, Canada, T2N 4N1 Tel: (403) 210-3819 Fax: (403) 270-2211 Email:
[email protected]
Copyright Information Copyright © 2007 by the American Physiological Society.
Page 2 of 26
2 Abstract Uridine triphosphate (UTP) constricts cerebral arteries by activating transduction pathways that increase cytosolic [Ca2+] and myofilament Ca2+ sensitivity. The signalling proteins that comprise these pathways remain uncertain with recent studies implicating a role for several G-proteins. To start clarifying which G-proteins enable UTP-induced vasoconstriction, a small interference RNA (siRNA) approach was developed to knockdown specified targets in rat cerebral arteries. siRNA directed against Gq and RhoA were introduced into isolated cerebral arteries using reverse permeabilization. Following a defined period of organ culture, arteries were assayed for contractile function, mRNA levels and protein expression. Targeted siRNA reduced RhoA or Gq mRNA expression by 60-70%, which correlated with a reduction in RhoA but not Gq protein expression. UTP-induced constriction was abolished in RhoA-depleted arteries, but this was not due to a reduction in myosin light chain phosphorylation. UTP-induced actin polymerization was attenuated in RhoA-depleted arteries, which would explain the loss of agonist-induced constriction.
In summary, this study illustrates that siRNA
approaches can be effectively used on intact arteries to induce targeted knockdown given that protein turnover rate is sufficiently high. They also demonstrate that RhoA’s principal role in agonist-induced constriction is to facilitate the formation of F-actin, the physical structure to which phosphorylated myosin binds to elicit arterial constriction.
Copyright Information
Page 3 of 26
3 Introduction Pyrimidine nucleotides such as uridine triphosphate (UTP) are important signalling molecules released from cells that are part of, or pass through the lumen of, resistance arteries (22; 23; 31). When secreted in close proximity to arterial smooth muscle cells, these agents bind to P2Y receptors and activate a transduction sequence that elicits sustained constriction (17; 25; 27).
The signalling proteins enabling pyrimidine 2+
nucleotides to increase cytosolic [Ca ] and myofilament Ca2+ sensitivity remain unresolved (18; 25; 38). For example, based on the induction of Ca2+ waves, some have asserted that UTP-sensitive P2Y receptors must be coupled to the Gq/11
subunits
within heteromeric G-protein complexes that activate phospholipase C- and augment inositol 1,4,5-triphosphate (IP3) production (18; 19).
Others, however, noting the
attenuating effects of Rho-kinase inhibitors suggest that UTP mobilizes RhoA, a monomeric G-protein indirectly coupled to P2Y receptors via G12/13 (25). One means of assessing the importance of specified components of such signaling pathways is to develop an experimental approach in which they can be selectively downregulated within the confines of the intact artery. In theory, such downregulation could be achieved through the use of a RNA-based approach (4; 28; 39). Previous vascular studies have shown that RNA-based approaches such as antisense oligonucleotides can substantially reduce the expression of ion channels and cytoskeletal proteins in intact resistance arteries (28; 29; 39). Although effective, offtarget effects have been a consistent concern given that anti-sense constructs are typically introduced to tissues at micromolar concentrations.
As such, interest has
developed in alternative strategies including the use of small interfering RNA (siRNA) to decrease target protein expression (10; 11).
RNA interference is a relatively new
approach whereby small segments of double-stranded RNA are used to degrade the mRNA required for protein translation (5; 14).
This degradation is controlled by an
endogenous silencing complex and culture studies have shown that nanomolar siRNA concentrations are sufficient to induce protein knockdown (14; 35). While viewed as a valuable tool to manipulate culture systems, RNA interference has been rarely employed in a quantitative manner to explore the integrative basis of arterial tone development (33). This study utilized a siRNA approach to knockdown specific G-proteins and to examine their role in UTP-mediated vasoconstriction. Briefly, siRNA targeted against Gq
Copyright Information
Page 4 of 26
4 or RhoA was introduced into cerebral arteries using reverse permeabilization. Following 4 - 5 days of organ culture, real-time PCR analysis confirmed that this approach effectively reduced Gq and RhoA mRNA expression. These mRNA reductions coincided with a decrease in RhoA but not Gq protein expression. RhoA-depleted arteries did not constrict to UTP; however, myosin light chain phosphorylation was unaffected by RhoA knockdown.
Subsequent experiments revealed that the non-responsiveness to UTP
resulted from the inability of RhoA-depleted vessels to polymerize actin. Cumulatively, our findings demonstrate that siRNA approaches can be effectively employed on intact arteries to knockdown signalling proteins. They also demonstrate that in the cerebral circulation, RhoA’s principal role in agonist-induced constriction is to regulate the formation of F-actin, a filament structure required to support contraction.
Copyright Information
Page 5 of 26
5 Materials and Methods Animal procedure and tissue preparation.
All procedures were approved by the
University of Calgary Animal Care Committee. Briefly, female Sprague Dawley rats (10 12 weeks of age) were euthanized by carbon dioxide asphyxiation.
The brain was
removed and placed in cold phosphate-buffered saline containing (in mM): 138 NaCl, 3 KCl, 10 Na2HPO4, 2 NaH2PO4, 5 glucose, 0.1 CaCl2, 0.1 MgSO4, pH 7.4. Posterior, middle and anterior cerebral arteries were dissected free of the surrounding tissue and cut into 2-3 mm segments. All arteries were denuded of endothelium by passing air bubbles through the vessel’s lumen for 2 min. The introduction of siRNA. Reverse permeabilization was used to introduce siRNA into rat cerebral arteries (24; 39). In brief, isolated arteries were transferred to culture dishes and exposed to 3 successive solutions (4oC) containing (in mM): 1) 10 EGTA, 120 KCl, 5 ATP, 2 MgCl2, 20 TES, pH 6.8; 20 min; 2) 120 KCl, 5 ATP, 2 MgCl2, 20 TES, 20 nM siRNA, pH 6.8; 3 h; and 3) 120 KCl, 5 ATP, 10 MgCl2, 20 TES, 20 nM siRNA, pH 6.8; 30 min. Subsequently, cerebral arteries were bathed in a fourth solution (in mM: 140 NaCl, 5 KCl, 10 MgCl2, 5 glucose, 2 MOPS, pH 7.1, 22oC) in which [Ca2+] was gradually increased from 0.01 to 0.1 to 1.8 mM every 15 min. Unpressurized vessels were then placed in DMEM/F-12 culture medium (supplemented with 1 mM L-glutamine, 50 units/ml penicillin and 50 µg/ml streptomycin) and maintained in an incubator (37ºC, 21% O2, 5% CO2) for 1 - 5 days (29; 39). A sub-confluent population of cultured aortic smooth muscle cells was also transfected (lipofectamine-2000), in accordance with standard working procedures, with Gq-targeted siRNA (20 nM) to address whether this RNA construct was capable of inducing protein knockdown (43). To assess siRNA uptake, non-selective siRNA was conjugated to fluorescein isothiocyanate (FITC) and introduced into arteries isolated from two rats.
Smooth
muscle cells from these two groups of arteries were subsequently isolated (25) and placed on a glass slide. Using a fluorescence microscope, ~75 cells per group were counted and categorized according to the FITC label.
Smooth muscle cells had to
maintain an elongated shape to be included in the analysis. Arterial diameter. Cerebral arteries were mounted in an arteriograph and superfused with warm (370C) physiological salt solution containing (in mM): 119 NaCl, 4.7 KCl, 20
Copyright Information
Page 6 of 26
6 NaHCO3, 1.7 KH2PO4, 1.2 MgSO4, 1.6 CaCl2, 10 glucose, pH 7.4, 21% O2, 5% CO2. Under resting conditions, arteries were maintained in a hyperpolarized state by setting intravascular pressure to 15 mmHg (38).
Arterial responsiveness to intravascular
+
pressure, extracellular K , UTP, and microcystin-LR (Chemicon, Temecula, CA, USA), a cell-permeant peptide inhibitor of myosin light chain phosphatase, were monitored with an automated video dimension analyzer system (IonOptix, Milton, MA, USA). mRNA analysis. Real-time PCR was used to quantify Gq, RhoA and -actin mRNA in cerebral arteries primarily but not exclusively comprised of smooth muscle cells. Briefly, arterial segments from one rat brain were isolated, exposed to siRNA and organ cultured for 0 - 5 days.
Two arterial segments were sampled per day and placed in
RNase/DNase-free collection tubes prior to flash freezing in liquid N2. After total RNA extraction (RNeasy mini kit with DNase treatment; Qiagen, Valencia, CA, USA), first strand cDNA was synthesized using a RT-Sensiscript kit (Qiagen). One microlitre of cDNA was subsequently used as template in a real-time PC reaction containing SYBRgreen (Qiagen), forward and reverse primers and water (total reaction volume, 25 µl). The PC reaction was hot started (95ºC for 15 min) and underwent 40 cycles of 94ºC for 15 s, 60.1ºC for 30 s, and 72ºC for 30 s.
Samples were then exposed to a final
extension period at 72ºC for 10 min. Gq and RhoA mRNA levels were standardized to actin and then expressed relative to freshly isolated tissue (control). Forward (F) and reverse (R) primers were as follows: Gq (F) 5’CGAGAGGTTGATGTGGAGAAGG3’, (R) 5’CGAGAGGTTGATGTGGAGAAGG3’; RhoA (F) 5’AAGGACCAGTTCCCAGAGGT3’, (R) 5’TGTCCAGCTGTGTCCCATAA3’; and
-actin (F) 5’TATGAGGGTTACGCGCTC
CC3’, (R) 5’ACGCTCGGTCAGGATCTTCA3’. Agarose gel electrophoresis and DNA sequencing were used to confirm product purity and identity. Primer efficiency was calculated to be 92.2%, 91.0% and 90.1% for Gq, RhoA and -actin, respectively. Protein analysis. Western blot analysis was used to detect Gq, RhoA, calponin and caldesmon protein expression. Arterial segments from two rat brains were collected, exposed to non-selective or targeted siRNA and organ cultured for 4 - 5 days. Arteries were then sampled, placed in 100 Ol of lysis buffer (0.1 M SDS, 1% Triton-X-100, 10 mM Tris-HCl pH 8, 150 mM NaCl, and 0.05% Tween 20) and centrifuged at 12,000 rpm for 10 min. The supernatant was placed in a clean tube, assayed for total protein and stored at -20oC for up to one week. Samples were prepared for electrophoresis by
Copyright Information
Page 7 of 26
7 adding 60 µl of supernatant to 20 µl of 4X sample buffer and 10 mM DTT. After heating (10 min, 90oC), 1 - 100 µg of protein was loaded per well and run on a 10% polyacrylamide gel.
Proteins were transferred to PVDF membranes and probed
overnight (4oC) with rabbit anti-Gq (1:2,000; Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit anti-RhoA (1:2,000; Santa Cruz), rabbit anti-calponin (1:10,000) or rabbit anti-caldesmon (1:100,000) polyclonal antibodies. Membranes were then washed and probed with HRP-conjugated anti-rabbit secondary antibody (1:1,000; Chemicon) for 2 h (22oC). Following a second set of washes, immunoreactive bands were detected by chemiluminescence (Pierce Biochemicals, Rockford, IL, USA). Gq and RhoA protein levels were standardized to -actin and then expressed relative to freshly isolated tissue (control) or to arteries treated with non-selective siRNA. Due to the small amount of protein (1 µg) loaded per lane, calponin as well as the heavy (h) and light (l) isoforms of caldesmon were standardized to total protein and then relatively expressed. MLC phosphorylation. Arterial segments from one rat brain were either freshly collected or exposed to non-selective or RhoA-targeted siRNA for 4 days of organ culture. Arteries were then subdivided, with one of the two groups being treated with UTP (30 µM, 10 min). Arterial segments were rapidly frozen in a slurry of solid CO2 with 10% (w/v) trichloroacetic acid/10 mM DTT in acetone. Tissues were subsequently washed 3 times (10 mM DTT in acetone), lyophilized overnight and stored at -80ºC. Protein was extracted for 2 h (22oC) in 20 Ol of a buffer containing: 6 M urea, 200 mM Tris, 220 mM glycine, 10 mM DTT, 10 mM EGTA, 1 mM EDTA, 1 mM PMSF, 0.6 M KI and 0.1% (w/v) bromophenol blue. Entire samples were then filtered (0.45 Om spin filter), loaded on a urea/glycerol mini gel and myosin light chains separated as previously described (37). Protein was transferred to nitrocellulose and probed overnight (4oC) with rabbit antiMLC20 antibody (1:500; Santa Cruz). Membranes were washed 3 times and subsequently probed for 1 h (22oC) with HRP-conjugated anti-rabbit secondary antibody (1:5,000; Chemicon). Following a second set of washes, immunoreactive bands were detected by chemiluminescence. Actin polymerization. Arterial segments from one rat brain were exposed to either nonselective or RhoA-targeted siRNA for 4 days of organ culture.
Arteries were then
o
subdivided and placed in an unpressurized state in PSS (37 C, 21% O2, 5% CO2) that did or did not contain UTP (30 µM, 10 min). G- and F-actin were detected in cerebral
Copyright Information
Page 8 of 26
8 arteries using a commercially available kit (Cytoskeleton, Denver, CO, USA). Briefly, arteries were homogenized in 200 Ol of lysis buffer (50 mM KCl, 5 mM MgCl2, 5 mM EGTA, 50 mM PIPES, 100 µM ATP, protease inhibitor cocktail, 5% glycerol, 0.1% Nonidet P40, 0.1% Triton X-100, 0.1% Tween 20, 0.1% 2-mercaptoethanol, 0.001% Antifoam C, pH 6.9) for 30 min at 37ºC. Following centrifugation (2,000 rpm, 5 min), the supernatant was transferred and centrifuged at 100,000g (60 min, 37ºC) to pellet Factin. The supernatant containing G-actin was placed on ice while the pellet (F-actin) was resuspended in 200 Ol of ice-cold water containing 10 OM cytochalasin D. The supernatant and pellet samples were then diluted in 4x SDS sample buffer and heated to 95ºC for 2 min. Equal volumes of each sample (40 Ol) were loaded and separated on a 12% polyacrylamide gel. Proteins were transferred to PVDF membranes before being probed with rabbit anti-actin polyclonal antibody and HRP-conjugated anti-rabbit secondary antibody. Proteins were visualized by chemiluminescence. Chemicals, drugs and enzymes. Antibodies, buffer reagents, and drugs were obtained from Sigma Biochemical (St. Louis, MO, USA) unless otherwise stated. siRNA against Gq (sense 5’CAAUAAGGCUCAUGCACAA3’, anti-sense 5’UUGUGCAUGAGCCUUAU UG3’) and RhoA (sense 5’GAAGUCAAGCAUUUCUGUCTT3’, anti-sense 5’GACAGAAA UGCUUGACUUCTT3’) were commercially manufactured by Qiagen.
Non-selective
siRNA was obtained from Invitrogen (Burlington, ON, Canada). Statistical analysis. To calculate EC50 values, data was logarithmically transformed and fitted on an individual basis to a sigmoidal concentration-response curve. To statistically compare the effects of a given treatment on mRNA, protein or arterial diameter, a series of paired or unpaired t-tests were performed statistically significant.
P values < 0.05 were considered
Data are expressed as means + SE and n represents the
number of vessels or times an experiment was performed. Vessels from any given animal were used only once in a specified experiment.
Copyright Information
Page 9 of 26
9 Results Control experiments and siRNA. A reverse permeabilization procedure was used to introduce siRNA into cerebral arterial smooth muscle. As demonstrated in Figure 1A, this process enabled the influx of FITC-labelled non-selective siRNA (20 nM), into smooth muscle cells isolated from permeabilized arteries. Uptake was apparent in at least 77% of smooth muscle cells sampled (108 of 139 cells). Reverse permeabilized arteries were subsequently organ cultured to provide the required time to induce protein knockdown.
Functional experiments revealed that the combination of reverse
permeabilization and organ culture did not alter cerebral arterial responsiveness to UTP, a potent vasoconstrictor agonist (Figure 1B). Gq knockdown.
Non-selective or Gq-targeted siRNA was introduced into cerebral
arteries which are primarily but not exclusively composed of smooth muscle cells. Realtime PCR was subsequently used to monitor mRNA levels over a 5 day period of organ culture.
Compared to the non-selective construct, Gq-targeted siRNA induced
substantial mRNA knockdown within the first three days of organ culture (Figure 2A). This ~65% reduction was maintained in organ cultured arteries for at least 5 days. Despite the sizable mRNA knockdown, western analysis revealed no significant change in Gq protein expression after 5 days of organ culture (Figure 2B). Similar null results were obtained in arteries sampled after 4 or 6 days of organ culture (n = 2; data not shown). As expected, therefore, the UTP responsiveness of cerebral arteries treated with Gq-targeted siRNA did not decrease (Figure 2C).
Indeed, functional analysis
revealed that, compared to the non-selective construct, arteries treated with Gq-targeted siRNA showed a small but significant increase in UTP sensitivity. This slight change most likely reflects subtle animal-to-animal variability in UTP responsiveness. Control experiments confirmed that Gq-targeted siRNA could induce protein knockdown if transfected into cultured smooth muscle cells (Figure 3). RhoA knockdown. Despite the preceding findings, a second attempt was undertaken to induce G-protein knockdown in an intact artery.
Efforts focused on RhoA, a small
monomeric G-protein thought to be important for agonist-induced constriction and which cell culture studies have shown to be susceptible to siRNA knockdown (25; 40). Compared to the non-selective construct, siRNA targeted against RhoA substantially reduced RhoA mRNA expression by ~50% within the first 4 days of organ culture (Figure 4A). RhoA protein expression decreased by ~80% within 4 days as compared to tissues
Copyright Information
Page 10 of 26
10 treated with non-selective siRNA (Figure 4B). RhoA-depleted arteries did not constrict in response to UTP (Figure 4C). Likewise, arteries exposed to RhoA-targeted siRNA but not the non-selective construct were unable to constrict to 55 mM extracellular K+ (arterial response (n = 4): RhoA-targeted siRNA, 1 ± 1 Om; non-selective siRNA, 78.9 ± 9.1 Om) or to 80 mmHg intravascular pressure (arterial response (n = 4): NS RhoAtargeted siRNA, 0 Om; non-selective siRNA, 82 ± 4.9 Om). Mechanism of contractile suppression.
Subsequent experiments explored the
mechanism underlying the contractile loss of RhoA-depleted arteries. This monomeric G-protein is known to inhibit myosin light chain phosphatase via Rho-kinase activation (21; 34; 36). Therefore, we examined the effect of RhoA depletion on UTP-induced myosin light chain phosphorylation. Irrespective of whether arteries were freshly isolated or exposed to non-selective or RhoA-targeted siRNA, UTP application (10 min) consistently phosphorylated 10 - 25% of the myosin light chain pool (Figure 5A & B). As such, the non-responsive nature of RhoA-depleted vessels was not related to the phosphorylation status of the myosin light chains, the loss of Rho-kinase activation or to myosin light chain phosphatase inhibition. This conclusion was further supported by functional observations showing that microcystin, an inhibitor of myosin light chain phosphatase activity, failed to induce vasoconstriction in RhoA-depleted cerebral arteries (Figure 5C). We speculated, therefore, that RhoA depletion was perhaps impairing F-actin formation, which is required to generate force (13; 16; 26; 30).
In support of this
mechanism, UTP application (10 min) induced F-actin formation in unpressurized arteries treated with non-selective but not RhoA-targeted siRNA (Figure 6A).
This
absence of polymerization was further evident in Figure 6B where UTP failed to augment the F/G-actin ratio in RhoA-depleted arteries.
In light of these findings, control
experiments were subsequently undertaken to address whether RhoA-depleted arteries were perhaps de-differentiating in organ culture (Figure 7). Using h-caldesmon and calponin as markers for differentiated smooth muscle, we found that arteries treated with non-selective and RhoA-targeted siRNA expressed similar quantities of these two proteins.
L-caldesmon expression was, however, modestly higher in RhoA-depleted
arteries compared to those treated with non-selective siRNA. While relatively similar to one another from a differentiation perspective, siRNA-treated arteries did express substantially less calponin compared to freshly isolated tissue.
Copyright Information
Page 11 of 26
11 Discussion In this study, we utilized a siRNA approach to knockdown signaling proteins with a view to defining their role in arterial tone development. We report that siRNA targeted against Gq or RhoA selectively reduced mRNA levels in intact cerebral arteries. These targeted reductions resulted in a decrease in RhoA but not Gq protein expression. Functional analysis revealed that RhoA-depleted arteries did not constrict to UTP, a loss of function that was not related to altered myosin light chain phosphorylation. The nonresponsive nature of RhoA-depleted arteries was found to be associated with an inability to polymerize actin.
Broadly speaking, our observations highlight that siRNA
approaches can induce effective protein knockdown in intact resistance arteries and that the resulting phenotype can further our understanding of how cell signalling regulates arterial tone development. A siRNA approach for intact arteries Pyrimidine nucleotides such as uridine triphosphate (UTP) are important signalling molecules released from cells that are part of, or pass through the lumen of, resistance arteries (22; 23; 31). When secreted in close proximity to arterial smooth muscle cells, these agents bind to P2Y receptors and activate a transduction sequence that elicits sustained constriction (17; 25; 27). Previous studies have indirectly implicated several G-protens in pyrimidine-induced vasoconstriction (18; 19; 25; 38), although precise identification has proven difficult given the limited utility of existing pharmacological tools. It was within this context that this study considered an RNA-based approach to target and downregulate key G-proteins.
In intact arteries, RNA-based approaches have
traditionally centered on the use of anti-sense oligodeoxynucleotides (28; 29; 39). While effective at knocking down ion channel subunits and cytoskeletal proteins, off-target effects have been a concern given that constructs are typically introduced at micromolar concentrations (28; 29; 39).
Consequently, interest has grown in gene silencing
approaches in which nanomolar levels of siRNA could in theory induce a similar protein knockdown.
Although a small number of studies have used RNA interference
approaches to intact arteries, most have not provided quantitative evidence of tissue knockdown (10; 11). This study utilized a siRNA approach to knockdown key signalling proteins in intact cerebral arteries. Consistent with previous anti-sense investigations (28; 29; 39), initial control experiments confirmed that: 1) reverse permeabilization facilitated siRNA uptake into cerebral arterial smooth muscle cells; and 2) non-selective siRNA treatment/organ
Copyright Information
Page 12 of 26
12 culture did not alter cerebral arterial responsiveness to UTP (Figure 1). siRNA targeted against Gq and RhoA was subsequently manufactured in accordance with previously established criteria (5; 14). Briefly, siRNA duplexes were 19-20 nucleotides in length, contained a GC content of ~50% and retained a two nucleotide 3’-overhang and a 5’phosphate terminus.
As illustrated in Figures 2 & 4, targeted siRNA effectively
diminished Gq and RhoA mRNA levels over a 5 day period of organ culture. While realtime PCR measurements confirmed mRNA knockdown, western analysis revealed that these reductions did not necessarily translate to the protein level. This is exemplified by our work with Gq, where targeted siRNA reduced mRNA levels by ~65% but had no effect on protein expression or agonist-induced constriction. While ineffective in intact arteries, Gq-targeted siRNA did, however, reduce Gq protein expression in a proliferating line of cultured aortic smooth muscle cells (Figure 3), suggesting that protein turnover is an important consideration with the application of siRNA technique. Unlike Gq, RhoA-targeted siRNA induced a reduction in both mRNA and protein expression in intact cerebral arteries (Figure 4). The functional consequence of RhoA depletion was that these arteries no longer constricted to UTP or other vasoconstrictor stimuli. The dramatic nature of this arterial phenotype prompted further investigation of its mechanistic basis. 2+
myofilament Ca
RhoA is traditionally viewed as an important regulator of
sensitivity. RhoA induces Ca2+ sensitization by activating Rho-kinase,
which phosphorylates
MYPT1 (the regulatory subunit of
myosin light chain
phosphatase), leading to inhibition of phosphatase activity (21; 34; 36).
If cerebral
arterial phosphatase activity is tightly controlled by RhoA, then UTP’s ability to induce myosin light chain phosphorylation and elicit constriction should be reduced in RhoAdepleted arteries.
In striking contrast to this expectation, UTP application
phosphorylated nearly 25% of the myosin light chain pool in RhoA-depleted arteries (Figure 5). This compares favourably to 10 - 20% phosphorylation in arteries freshly isolated or treated with non-selective siRNA.
These findings should not be over
interpreted to suggest that RhoA-induced Ca2+ sensitization does not play a role in the contractile response to UTP. While depleted, the remaining RhoA may be sufficient to sustain myosin light chain phosphorylation.
Furthermore, RhoA depletion may be
affecting the rate of myosin light chain phosphorylation. In addition to controlling Ca2+ sensitization, RhoA activity strongly influences actin polymerization (1; 13; 30; 41). This influence is the product of two signalling pathways that regulate the actin-binding proteins cofilin and profilin (1; 15; 41).
Copyright Information
Cofilin
Page 13 of 26
13 disassembles F-actin filaments from the pointed (-) end and is sequentially controlled by Rho-kinase and LIM-kinase (15). In contrast, profilin controls G-actin incorporation into the barbed (+) end, a process under the regulation of mDia (15).
We speculated,
therefore, that RhoA depletion may alter cofilin/profilin activity in a manner that promotes actin depolymerisation. This would reduce the availability of actin filaments for binding of phosphorylated myosin and/or anchoring of actin filaments to the plasma membrane, leading to a reduction in force generation (16; 26). Consistent with this logic, UTPinduced actin polymerization was eliminated in arteries depleted of RhoA (Figure 6). Notably, all siRNA-treated arteries expressed little F-actin under basal conditions. This contrasts markedly with freshly-isolated arteries (2; 41; 42), suggesting that the physical/chemical environment (i.e. intravascular pressure) to which an artery is normally exposed is important for maintaining basal actin polymerization. With RhoA-depleted arteries losing their ability to polymerize actin, it could be suggested that these vessels are susceptible to de-differentiation (1; 15; 41).
To
address this possibility, we examined caldesmon and calponin, two thin filament proteins whose expression changes dramatically with the differentiation state of smooth muscle (7; 12; 20). With the exception of a modest upregulation of l-caldesmon, we found no evidence that RhoA-depleted arteries de-differentiated more rapidly than arteries treated with non-selective siRNA (Figure 7). Thus, siRNA-treated arteries appear to share a common state of differentiation, an important consideration when comparing the functional consequences of protein knockdown. While comparable to one another, the differentiation state of siRNA-treated arteries appeared to be modestly different from freshly-isolated arteries, as evidenced by the reduced expression of calponin in siRNAtreated arteries. Physiological Implications Our findings have important physiological implications to the general understanding of agonist-induced vasoconstriction.
For example, it is routinely asserted that
vasoconstrictor agonists like UTP elicit arterial constriction by activating a RhoAdependent pathway that strongly inhibits myosin light chain phosphatase. This logic is often based on indirect measures such as the relaxing effects of Rho-kinase inhibitors (3; 6; 25; 32). Contrary to this general perception, our observations indicate that RhoA’s involvement in sensitizing the cerebral arterial myofilaments is not as clear as initially expected. This does not suggest that RhoA is unimportant to enhancing myosin light chain phosphorylation but that its principal role in agonist-induced constriction more
Copyright Information
Page 14 of 26
14 likely centers on the formation and maintenance of actin filaments (16; 26).
These
findings broadly reinforce the views of Gunst and colleagues who have stressed that cytoskeletal networks are not only dynamic but need to be carefully considered within the context of smooth muscle force generation (26; 28; 42). They are also consistent with the work of Gokina who has noted that Rho-kinase inhibition and actin depolymerization elicit a similar pattern of response in myogenically active arteries (8; 9). Summary This study implemented a siRNA approach to knockdown key signalling proteins in intact resistance arteries.
Findings revealed that while targeted siRNA consistently
reduced mRNA levels, such changes did not necessarily translate into reduced protein expression. When the key regulatory protein RhoA did decrease, cerebral arteries lost their ability to constrict to vasoconstrictor stimuli. The non-contractile nature of RhoAdepleted arteries arose from their inability to polymerize F-actin, a finding that highlights the importance of cytoskeletal dynamics in active force development.
Copyright Information
Page 15 of 26
15 ACKNOWLEDGMENTS The authors are grateful to Kevin D. Luykenaar for his assistance. This work was supported by an operating grant from the Canadian Institutes of Health Research. DGW is a Senior Scholar with the Alberta Heritage Foundation for Medical Research (AHFMR), and holds a Canada Research Chair (Tier 2) in Vascular Communication. RLC is supported by a Scholarship from the Heart and Stroke Foundation of Canada. MPW is an AHFMR Scientist and holds a Canada Research Chair (Tier 1) in Vascular Smooth Muscle Research.
Copyright Information
Page 16 of 26
16 References 1. Albinsson S, Nordstrom I and Hellstrand P. Stretch of the vascular wall induces smooth muscle differentiation by promoting actin polymerization. J Biol Chem 279: 34849-34855, 2004. 2. Chen X, Pavlish K, Zhang HY and Benoit JN. Effects of chronic portal hypertension on agonist-induced actin polymerization in small mesenteric arteries. Am J Physiol Heart Circ Physiol 290: H1915-H1921, 2006. 3. Chrissobolis S and Sobey CG. Evidence that Rho-kinase activity contributes to cerebral vascular tone in vivo and is enhanced during chronic hypertension: comparison with protein kinase C. Circ Res 88: 774-779, 2001. 4. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K and Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-498, 2001. 5. Elbashir SM, Martinez J, Patkaniowska A, Lendeckel W and Tuschl T. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J 20: 6877-6888, 2001. 6. Fu X, Gong MC, Jia T, Somlyo AV and Somlyo AP. The effects of the Rhokinase inhibitor Y-27632 on arachidonic acid-, GTPgammaS-, and phorbol esterinduced Ca2+-sensitization of smooth muscle. FEBS Lett 440: 183-187, 1998. 7. Gimona M, Sparrow MP, Strasser P, Herzog M and Small JV. Calponin and SM 22 isoforms in avian and mammalian smooth muscle. Absence of phosphorylation in vivo. Eur J Biochem 205: 1067-1075, 1992. 8. Gokina NI and Osol G. Actin cytoskeletal modulation of pressure-induced depolarization and Ca2+ influx in cerebral arteries. Am J Physiol Heart Circ Physiol 282: H1410-H1420, 2002. 9. Gokina NI, Park KM, Elroy-Yaggy K and Osol G. Effects of Rho kinase inhibition on cerebral artery myogenic tone and reactivity. J Appl Physiol 98: 1940-1948, 2005. 10. Gonczi M, Szentandrassy N, Johnson IT, Heagerty AM and Weston AH. Investigation of the role of TASK-2 channels in rat pulmonary arteries; pharmacological and functional studies following RNA interference procedures. Br J Pharmacol 147: 496-505, 2006. 11. Gurney AM and Hunter E. The use of small interfering RNA to elucidate the activity and function of ion channel genes in an intact tissue. J Pharmacol Toxicol Methods 51: 253-262, 2005.
Copyright Information
Page 17 of 26
17 12. Halayko AJ, Salari H, MA X and Stephens NL. Markers of airway smooth muscle cell phenotype. Am J Physiol 270: L1040-L1051, 1996. 13. Hall A. G proteins and small GTPases: distant relatives keep in touch. Science 280: 2074-2075, 1998. 14. Hall J. Unravelling the general properties of siRNAs: strength in numbers and lessons from the past. Nat Rev Genet 5: 552-557, 2004. 15. Hellstrand P and Albinsson S. Stretch-dependent growth and differentiation in vascular smooth muscle: role of the actin cytoskeleton. Can J Physiol Pharmacol 83: 869-875, 2005. 16. Hirshman CA and Emala CW. Actin reorganization in airway smooth muscle cells involves Gq and Gi-2 activation of Rho. Am J Physiol 277: L653-L661, 1999. 17. Horiuchi T, Dietrich HH, Tsugane S and Dacey RG, Jr. Analysis of purine- and pyrimidine-induced vascular responses in the isolated rat cerebral arteriole. Am J Physiol Heart Circ Physiol 280: H767-H776, 2001. 18. Jaggar JH and Nelson MT. Differential regulation of Ca2+ sparks and Ca2+ waves by UTP in rat cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 279: C1528-C1539, 2000. 19. Jaggar JH, Porter VA, Lederer WJ and Nelson MT. Calcium sparks in smooth muscle. Am J Physiol Cell Physiol 278: C235-C256, 2000. 20. Kashiwada K, Nishida W, Hayashi K, Ozawa K, Yamanaka Y, Saga H, Yamashita T, Tohyama M, Shimada S, Sato K and Sobue K. Coordinate expression of alpha-tropomyosin and caldesmon isoforms in association with phenotypic modulation of smooth muscle cells. J Biol Chem 272: 15396-15404, 1997. 21. Kimura K, Ito M, Amano M, Chihara K, Fukata Y, Nakafuku M, Yamamori B, Feng J, Nakano T, Okawa K, Iwamatsu A and Kaibuchi K. Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273: 245248, 1996. 22. Lazarowski ER and Boucher RC. UTP as an extracellular signaling molecule. News Physiol Sci 16: 1-5, 2001. 23. Lazarowski ER and Harden TK. Quantitation of extracellular UTP using a sensitive enzymatic assay. Br J Pharmacol 127: 1272-1278, 1999.
Copyright Information
Page 18 of 26
18 24. Lesh RE, Somlyo AP, Owens GK and Somlyo AV. Reversible permeabilization. A novel technique for the intracellular introduction of antisense oligodeoxynucleotides into intact smooth muscle. Circ Res 77: 220-230, 1995. 25. Luykenaar KD, Brett SE, Wu BN, Wiehler WB and Welsh DG. Pyrimidine nucleotides suppress KDR currents and depolarize rat cerebral arteries by activating Rho kinase. Am.J.Physiol Heart Circ.Physiol 286: H1088-H1100. 2004. 26. Mehta D and Gunst SJ. Actin polymerization stimulated by contractile activation regulates force development in canine tracheal smooth muscle. J Physiol 519: 829840, 1999. 27. Miyagi Y, Kobayashi S, Nishimura J, Fukui M and Kanaide H. Dual regulation of cerebrovascular tone by UTP: P2U receptor-mediated contraction and endothelium-dependent relaxation. Br J Pharmacol 118: 847-856, 1996. 28. Opazo SA, Zhang W, Wu Y, Turner CE, Tang DD and Gunst SJ. Tension development during contractile stimulation of smooth muscle requires recruitment of paxillin and vinculin to the membrane. Am J Physiol Cell Physiol 286: C433C447, 2004. 29. Reading SA, Earley S, Waldron BJ, Welsh DG and Brayden JE. TRPC3 mediates pyrimidine receptor-induced depolarization of cerebral arteries. Am J Physiol Heart Circ Physiol 288: H2055-H2061, 2005. 30. Ridley AJ and Hall A. The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70: 389-399, 1992. 31. Saiag B, Bodin P, Shacoori V, Catheline M, Rault B and Burnstock G. Uptake and flow-induced release of uridine nucleotides from isolated vascular endothelial cells. Endothelium 2: 279-285, 2003. 32. Shirao S, Kashiwagi S, Sato M, Miwa S, Nakao F, Kurokawa T, Todoroki-Ikeda N, Mogami K, Mizukami Y, Kuriyama S, Haze K, Suzuki M and Kobayashi S. Sphingosylphosphorylcholine is a novel messenger for Rho-kinase-mediated Ca2+ sensitization in the bovine cerebral artery: unimportant role for protein kinase C. Circ Res 91: 112-119, 2002. 33. Smolock EM, Wang T, Nolt JK and Moreland RS. siRNA knock down of casein kinase 2 increases force and crossbridge cycling rates in vascular smooth muscle. Am J Physiol Cell Physiol In Press, 2006. 34. Somlyo AP and Somlyo AV. Ca2+ sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiol Rev 83: 1325-1358, 2003.
Copyright Information
Page 19 of 26
19 35. Sontheimer EJ. Assembly and function of RNA silencing complexes. Nat Rev Mol Cell Biol 6: 127-138, 2005. 36. Uehata M, Ishizaki T, Satoh H, Ono T, Kawahara T, Morishita T, Tamakawa H, Yamagami K, Inui J, Maekawa M and Narumiya S. Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389: 990-994, 1997. 37. Weber LP, Van Lierop JE and Walsh MP. Ca2+-independent phosphorylation of myosin in rat caudal artery and chicken gizzard myofilaments. J Physiol 516: 805824, 1999. 38. Welsh DG and Brayden JE. Mechanisms of coronary artery depolarization by uridine triphosphate. Am J Physiol Heart Circ Physiol 280: H2545-H2553, 2001. 39. Welsh DG, Morielli AD, Nelson MT and Brayden JE. Transient receptor potential channels regulate myogenic tone of resistance arteries. Circ Res 90: 248-250, 2002. 40. Yoneda A, Multhaupt HA and Couchman JR. The Rho kinases I and II regulate different aspects of myosin II activity. J Cell Biol 170: 443-453, 2005. 41. Zeidan A, Nordstrom I, Albinsson S, Malmqvist U, Sward K and Hellstrand P. Stretch-induced contractile differentiation of vascular smooth muscle: sensitivity to actin polymerization inhibitors. Am J Physiol Cell Physiol 284: C1387-C1396, 2003. 42. Zhang W and Gunst SJ. Dynamic association between alpha-actinin and betaintegrin regulates contraction of canine tracheal smooth muscle. J Physiol 572: 659-676, 2006. 43. Zheng XL, Gui Y, Du G, Frohman MA and Peng DQ. Calphostin-C induction of vascular smooth muscle cell apoptosis proceeds through phospholipase D and microtubule inhibition. J Biol Chem 279: 7112-7118, 2004.
Copyright Information
Page 20 of 26
20 FIGURES
Figure 1. Cerebral arteries and reverse permeabilization. A: Uptake of FITC-labelled non-selective siRNA into smooth muscle cells enzymatically isolated from cerebral arteries that were or were not reversibly permeabilized.
Scale bar = 25 µM.
B:
Summary data of UTP-induced constriction of cerebral arteries that were freshly isolated (control: EC50 = 1.2 + 0.8 µM; resting and minimum diameter, 243 + 5 and 127 + 3; n=7) or exposed to non-selective siRNA and 4 (EC50 = 2.9 + 0.8 µM; resting and minimum diameter, 241 + 10 and 146 + 7; n = 6) or 5 (EC50 = 0.8 + 0.7 µM; resting and minimum diameter, 246 + 8 and 145 + 5; n = 6) days of organ culture. To calculate EC50 values, data was logarithmically transformed and fitted on an individual basis to a sigmoidal concentration-response curve.
Copyright Information
Page 21 of 26
21
Figure 2.
The introduction of non-selective (NS) or Gq-targeted siRNA into intact
cerebral arteries. A: The effects of NS (n = 4) or Gq-targeted (n = 4) siRNA on Gq mRNA expression following 0 - 5 days of organ culture. mRNA values were expressed relative to freshly isolated tissue. * denotes significant difference from NS siRNA. B: The effect of NS (n = 3) or Gq-targeted (n = 3) siRNA on Gq protein expression following 5 days of organ culture. Protein values were expressed relative to freshly isolated tissue. C: UTPinduced constriction of cerebral arteries exposed to NS (EC50 = 1.3 + 0.8 µM, resting and minimum diameter, 226 + 4 and 137 + 6; n = 6) or Gq-targeted (EC50 = 0.4 + 0.8 µM, resting and minimum diameter, 237 + 9 and 131 + 11; n = 6) siRNA followed by 5 days of organ culture. The EC50 values for NS and Gq-targeted siRNA were significantly different from one another.
Copyright Information
Page 22 of 26
22
Figure 3. Gq knockdown in cultured aortic smooth muscle cells. Western blot and densitometric analysis of Gq protein expression in cultured aortic smooth muscle cells transfected (lipofectamine-2000) with NS (n = 3) or Gq-targeted (n = 3) siRNA. Cells were sampled 2 days after transfection. Data were expressed relative to NS siRNAtreated samples.
Copyright Information
Page 23 of 26
23
Figure 4. The introduction of NS or RhoA-targeted siRNA into intact cerebral arteries. A: The effects of NS (n = 4) or RhoA-targeted (n = 5) siRNA on RhoA mRNA expression following 0 - 5 days of organ culture. mRNA values were expressed relative to freshly isolated tissue. B: The effect of NS (n = 3) or RhoA-targeted (n = 3) siRNA on RhoA protein expression following 4 days of organ culture. Protein values were expressed relative to tissue exposed to NS siRNA. C: UTP-induced constriction in cerebral arteries exposed to NS (resting and minimum diameter, 226 + 4 and 137 + 6 µM; n = 6) or RhoAtargeted (resting and minimum diameter, 198 + 11 and 194 + 12 µM ; n = 6) siRNA and 4 days of organ culture. * denotes significant difference from NS siRNA.
Copyright Information
Page 24 of 26
24
Figure 5.
Myosin light chain phosphorylation in cerebral arteries.
A: UTP-induced
myosin light chain phosphorylation in arteries that were freshly isolated (control) or exposed to NS or RhoA-targeted siRNA plus 4 days of organ culture. B: Summary data of UTP-induced myosin light chain phosphorylation in arteries that were freshly isolated (control; n = 3) or exposed to NS (n = 3) or RhoA-targeted (n = 3) siRNA plus 4 days of organ culture. Data were expressed relative to the total myosin light chain pool. * denotes significant difference from non UTP-treated arteries. C: Representative traces of microcystin (1 µM)-induced constriction of a cerebral artery exposed to NS or RhoAtargeted siRNA plus 4 days of organ culture.
Copyright Information
Page 25 of 26
25
Figure 6. Actin polymerization in cerebral arteries. A: Western blot illustrating the effect of UTP on G- and F-actin in arteries exposed to NS or RhoA-targeted siRNA plus 4 days of organ culture. B: Summary data illustrating the effects of UTP on the F/G-actin ratio in arteries exposed to NS (n = 3) or RhoA-targeted (n = 3) siRNA plus 4 days of organ culture.
* denotes significant difference from NS siRNA.
performed on unpressurized arteries superfused with PSS.
Copyright Information
These experiments were
Page 26 of 26
26
Figure 7. Thin filament protein expression in cerebral vessels. Densitometric analysis of caldesmon (light (l) and heavy (h) isoforms) and calponin expression in arteries that were freshly isolated (control; n = 3) or exposed to NS (n = 3) or RhoA-targeted (n = 3) siRNA plus 4 days of organ culture.
Data were expressed relative to freshly isolated tissue
(control). * and ** denote a significant difference from control and NS siRNA, respectively.
Copyright Information
