The GATA-4 Transcription Factor Transactivates the ... - NCBI - NIH

Vol. 14, No. 11

MOLECULAR AND CELLULAR BIOLOGY, Nov. 1994, p. 7517-7526

0270-7306/94/$04.00+0 Copyright X 1994, American Society for Microbiology

The GATA-4 Transcription Factor Transactivates the Cardiac Muscle-Specific Troponin C Promoter-Enhancer in Nonmuscle Cells HON S. IP,' DAVID B. WILSON,2 MARKKU HEIKINHEIMO,2'3 ZHIHUA TANG,' CHAO-NAN TING,'

M. CELESTE

SIMON,"14'5 JEFFREY M. LEIDEN,16 AND MICHAEL S. PARMACEKl*

Departments of Medicine,1 Molecular Genetics and Cell Biology,4 and Pathology6 and The Howard Hughes Medical Institute,5 University of Chicago, Chicago, Illinois; Departments of Pediatrics and Molecular Biology and Pharmacology, Washington University School of Medicine, St. Louis, Missouri2; and Children's Hospital, University of Helsinki, Helsinki, Finland3 Received 26 April 1994/Returned for modification 17 June 1994/Accepted 8 August 1994

The unique contractile phenotype of cardiac myocytes is determined by the expression of a set of cardiac muscle-specific genes. By analogy to other mammalian developmental systems, it is likely that the coordinate expression of cardiac genes is controlled by lineage-specific transcription factors that interact with promoter and enhancer elements in the transcriptional regulatory regions of these genes. Although previous reports have identified several cardiac muscle-specific transcriptional elements, relatively little is known about the lineage-specific transcription factors that regulate these elements. In this report, we demonstrate that the slow/cardiac muscle-specific troponin C (cTnC) enhancer contains a specific binding site for the lineagerestricted zinc finger transcription factor GATA-4. This GATA-4-binding site is required for enhancer activity in primary cardiac myocytes. Moreover, the cTnC enhancer can be transactivated by overexpression of GATA-4 in non-cardiac muscle cells such as NIH 3T3 cells. In situ hybridization studies demonstrate that GATA-4 and cTnC have overlapping patterns of expression in the hearts of postimplantation mouse embryos and that GATA-4 gene expression precedes cTnC expression. Indirect immunofluorescence reveals GATA-4 expression in cultured cardiac myocytes from neonatal rats. Taken together, these results are consistent with a model in which GATA-4 functions to direct tissue-specific gene expression during mammalian cardiac development.

ing null mutations in MyoD and Myf-5 or myogenin display normal cardiac development despite severe defects in skeletal myogenesis (22, 45, 61). Furthermore, previous studies have identified cardiac muscle-specific transcriptional regulatory elements that are not active in skeletal muscle cells (25, 26, 36, 52). The GATA family of transcription factors is composed of five members, which contain highly related DNA-binding domains composed of two evolutionarily conserved Cys-X2Cys-X17-Cys-X2-Cys zinc fingers (4, 16, 24, 29, 31, 69, 72). Previous studies have demonstrated that the known GATA transcription factors bind the consensus motif (A/ T)GATA(A/G) (16, 73). Random site selection has suggested that additional nonconsensus sequences can bind GATA proteins with high affinity (32, 42). Two of the GATA transcription factors (GATA-1 and GATA-3) are expressed in a tissuerestricted fashion and have been shown previously to regulate lineage-specific gene expression in erythroid cells and T lymphocytes, respectively (24, 29, 33, 72, 78). Moreover, homozygous disruption of the GATA-1 gene in mice results in a specific block in erythroid development (56, 68). Recent studies have suggested that GATA-4, a newly identified GATA transcription factor, may play a role in cardiac development (4, 31). In the mouse, the GATA-4 gene is first expressed in the coelomic epithelial cells of the primitive streak embryo at postcoital (p.c.) day 7 (23). GATA-4 mRNA is clearly detectable within the primordial heart tube at p.c. day 8, and it continues to be expressed in the heart throughout the life of the animal. Later in embryonic development, GATA-4 is expressed in the intestinal epithelial cells and in the germ cells within the seminiferous tubule. Although this tissuerestricted pattern of expression suggested that GATA-4 might

Vertebrate striated muscle is composed of two functionally distinct mesodermally derived cell lineages: cardiac and skeletal (fast and slow) muscle. The diverse functional capacities of these lineages are determined by the expression of distinct sets of tissue-specific genes, including those encoding myofibrillar isoforms, cell surface receptors, and lineage-specific enzymes. The tissue-specific pattern of expression of many muscle genes is controlled at the level of transcription (7, 10, 27, 35, 48, 65, 81). Therefore, an understanding of muscle cell development must at some level be based upon elucidating the molecular mechanisms that control lineage-specific gene expression during myogenesis.

The recent identification and characterization of the basic helix-loop-helix myogenic transcription factors, including MyoD, myogenin, Myf-5, and MRF-4/herculin/Myf-6, as well as the MEF-2 family of transcription factors has added significantly to our understanding of skeletal myogenesis (8, 9, 12, 15, 18, 40, 41, 43, 58, 59, 76, 80). These factors bind to and regulate the expression of many skeletal muscle-specific genes (47, 48, 64, 70). In contrast, relatively little is currently understood about the molecular mechanisms that control cardiac muscle-specific gene expression during mammalian development. Despite the fact that overlapping sets of genes are expressed in the heart and skeletal muscle, several lines of evidence suggest that distinct transcriptional programs may regulate these processes. For example, basic helix-loop-helix myogenic transcription factors are not expressed in developing heart or precardiac mesoderm (49, 63, 64), and mice contain* Corresponding author. Mailing address: University of Chicago, Department of Medicine, MC 6088, Room G-611, 5841 S. Maryland Ave., Chicago, IL 60637. Phone: (312) 702-2679. Fax: (312) 702-2681.

7517

7518

IP ET AL.

play a role in regulating lineage-restricted gene expression in the heart, to date GATA-4 has not been shown to bind to or regulate the expression of cardiac muscle-specific genes. The murine slow/cardiac troponin C (cTnC) gene has been used as a model system with which to examine the molecular mechanisms that regulate cardiac muscle-specific transcription during mammalian development (53, 54, 66). cTnC gene expression is restricted to adult slow skeletal and cardiac muscle and is controlled at the level of transcription (53, 66). We have previously identified a cardiac muscle-specific transcriptional enhancer located within the immediate 5' flanking region of the cTnC gene (bp -79 to -124). This enhancer functions in concert with the cTnC promoter to program high-level transcription both in cultured cardiac myocytes and in cardiac muscle in vivo (54). The cTnC enhancer contains two functionally important nuclear protein-binding sites designated CEF-1 and CEF-2. Both sites have been shown to bind cardiac muscle-restricted nuclear protein complexes (54). In this report, we demonstrate that GATA-4 binds specifically to the CEF-1 site of the cTnC enhancer and that GATA-4 is the major CEF-1-binding activity present in cardiac nuclear extracts. Using in vitro mutagenesis, we show that the GATA-4binding site in CEF-1 is required for the transcriptional activity of the cTnC enhancer in cardiac myocytes. Expression of GATA-4 in NIH 3T3 cells activates transcription from the intact cTnC promoter-enhancer. Finally, GATA-4 has been immunocytochemically localized in the nuclei of primary cardiac myocytes, and GATA-4 and cTnC mRNAs have been colocalized to the embryonic myocardium during murine cardiogenesis. Taken together, these data demonstrate that GATA-4 plays an important role in regulating cTnC gene expression in the heart and suggest that GATA-4, like GATA-1 and GATA-3, may be an important regulator of lineage-specific gene expression during mammalian development.

MATERIALS AND METHODS Cells and media. NIH 3T3 and COS-7 cells were grown in Dulbecco's modified Eagle's medium-10% fetal bovine serum-1% penicillin and streptomycin (GIBCO, Gaithersburg, Md.). Primary cultures of neonatal rat cardiac myocytes and fibroblasts were isolated and grown as described previously

(54).

Plasmids. The promoterless control plasmid pCAT-Basic (Promega, Madison, Wis.) and plasmid p-124CAT, containing the 156-bp (bp -124 to +32) cTnC cardiac muscle-specific promoter and enhancer subcloned 5' of the chloramphenicol acetyltransferase (CAT) reporter gene, have been described previously (54). Plasmid p-124CATmCEF-1, containing five nucleotide substitutions within the CEF-1 GATA-4-binding site within the context of the 156-bp cTnC promoter-enhancer, was constructed by using PCR-mediated site-directed mutagenesis (28) and subcloned into HindIII-XbaI-digested pCAT-Basic as described previously (54). The sequence of the mutated 156-bp fragment was confirmed by dideoxy sequence analysis. The reference plasmid pMSVpgal contains the bac-

terial lacZ gene under the control of the murine sarcoma virus long terminal repeat (14). The control expression plasmid pMT2 and the eukaryotic expression plasmid pMT2-GATA-4 were described previously (4). Plasmid GATA-4/pGEM7Z contains the full-length murine GATA-4 cDNA (4) cloned into the EcoRI site of pGEM7Z (Promega). Transfections and CAT assays. Cultures of rat neonatal cardiac myocytes were transfected with 15 jig of CAT reporter plasmid and 5 pLg of the pMSV3gal reference plasmid, using

MOL. CELL. BIOL.

the Lipofectin reagent (GIBCO) as described previously (54). For the GATA-4 cotransfection experiments, 106 NIH 3T3 cells were cotransfected with 6 ,ug of the appropriate CAT reporter plasmid, 5 ,ug of the pMSV,BGal reference plasmid, and either 24 ,ug of the GATA-4 expression plasmid, pMT2GATA-4, or pBluescript KS (Stratagene, La Jolla, Calif.) control DNA. Forty-eight hours following transfection, cell lysates were prepared and normalized for protein content, using a commercially available kit (Bio-Rad, Hercules, Calif.). CAT and 3-galactosidase assays were performed as described previously (54). All experiments were repeated at least three times to ensure reproducibility. CAT activities were corrected for variations in transfection efficiencies as determined by assaying cell extracts for 3-galactosidase activities. In vitro transcription and translation. In vitro transcription and translation reactions were carried out with 2 plg of linearized GATA-4/pGEM7Z and T7 RNA polymerase as instructed by the manufacturer (Promega). Electrophoretic mobility shift assays (EMSAs). Nuclear extracts were prepared from cultures of primary neonatal rat cardiac myocytes and fibroblasts, NIH 3T3 cells, and C2C12 myotubes as described previously (54). In addition, nuclear extracts were prepared 48 h following transient transfection of COS-7 cells with either the pMT-2 or pMT2-GATA-4 expression vector by the procedure of Andrews and Faller (2). The following complementary oligonucleotides were synthesized with BamHI and BglII overhanging ends on an Applied Biosystems model 380B DNA synthesizer: CEF-1 (5' CCAGC CTGAGATTACAGGGA 3'), mCEF-1 (mutant CEF-1; 5' CC AGCCTGGGGCCCCAGGGA 3'), CEF-2 (5' GGTGGAG GATATTCCAGG 3'), mCEF-2 (mutant CEF-2; 5' GGTG GAGGGCCCTCCAGG 3'), and otglobin (murine ol-globin GATA; 5' TCCGGCAACTGATAAGGATTCCCT 3'). EMSAs were carried out at 4°C for 20 min in 15-,u reaction mixtures containing 3 RI of in vitro-translated reaction product or 10 to 20 pLg of nuclear extract, 20,000 dpm of radiolabelled double-stranded oligonucleotide, 500 ng of poly(dI-dC), 5 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.5 mM dithiothreitol, 37.5 mM KCI, and 4% Ficoll 400. For cold competition experiments, 10 to 100 ng of unlabelled competitor oligonucleotide was included in the binding reaction mixture. For antibody supershift experiments, either rabbit preimmune (1 [lI) or specific rabbit polyclonal GATA-4 (1 pA) antiserum (4) was incubated with the in vitro-translated protein or nuclear extract at room temperature for 30 min prior to the binding reaction. Of note, the rabbit polyclonal GATA-4 antiserum does not cross-react with any of the known GATA family members (23). Protein-DNA complexes were separated by electrophoresis on 4% nondenaturing polyacrylamide gels in 0.25 x TBE (lx TBE is 100 mM Tris, 100 mM boric acid, and 2 mM EDTA) at 4°C as described previously (54). In situ hybridization. Mouse embryos were obtained by mating male and female B6SJLF1/J mice (Jackson Laboratory, Bar Harbor, Maine). Noon of the day on which the copulation plug was found was considered day 0.5 p.c. Precise staging of dissected embryos was performed as specified in reference 30. GATA-4 antisense and sense riboprobes were prepared by in vitro transcription of a linearized Bluescript phagemid containing a GATA-4 cDNA (pSK-G14A) as described previously (4). cTnC riboprobes were prepared by using linearized Bluescript phagemid containing a partial-length mouse cTnC cDNA (the 483-bp EcoRI-BamHI cTnC cDNA fragment (bp 44 to 526)). Digoxigenin-labelled riboprobes were prepared by transcription in the presence of digoxigenin-UTP, using a commercially available kit (Boehringer Mannheim, Indianap-

olis, Ind.).

VOL. 14, 1994

GATA-4 ACTIVATES TRANSCRIPTION OF THE cTnC GENE

Whole-mount in situ hybridization was performed on 5 to 10 embryos ranging in age from 7.0 to 9.5 days p.c. Hybridization to sense riboprobe was used as a negative control. The dissected embryos were rinsed in phosphate-buffered saline (PBS), fixed for 2 h in 4% paraformaldehyde in PBS at 4°C, and then stored in methanol at -20°C. After rehydration, the embryos were hybridized with digoxigenin-labelled GATA-4 antisense and sense probes by the method of Conlon and Rossant (11). Bound riboprobe was detected with a 1:200 dilution of goat antidigoxigenin antibody coupled to alkaline phosphatase (Boehringer Mannheim). After being stained for 1 to 2 h with nitroblue tetrazolium and 5-bromo-4-chloro-3indolyl-1-phosphate, embryos were photographed with a Leica/ Wild M3 stereomicroscope and Ektachrome 400 or Kodacolor 400 film. Antibody preparation. Preparation of rabbit antiserum recognizing a fusion protein between glutathione S-transferase (GST) and mouse GATA-4 (GST-GATA-4) has been described previously (4). This antibody does not cross-react with other members of the GATA-binding family. Affinity-purified antibody was obtained by chromatography on GST-GATA-4 covalently coupled to Affi-Gel-10 (Bio-Rad). Antibodies recognizing the fusion protein were eluted with 100 mM glycine (pH 2.5) followed by 100 mM triethanolamine (pH 11.5) (20). After dialysis against PBS, antibodies directed against GST epitopes were removed by adsorption to GST coupled to Affi-Gel-10. Finally, the anti-GATA-4 immunoglobulin G (IgG) was concentrated by protein A-agarose chromatography (20) and stored at 4°C in PBS containing 0.02% sodium azide. Control IgG for use in immunofluorescence studies was prepared by chromatography of preimmune serum on protein A-agarose. Immunofluorescence. Primary neonatal rat cardiac myocytes and fibroblasts were isolated as described previously (54) and used in indirect immunofluorescence experiments after 3 to 5 days in culture. The neonatal rat cardiac cells were fixed in 4% paraformaldehyde and subjected to indirect immunofluorescence. To visualize GATA-4, cells were stained with affinitypurified rabbit anti-mouse GATA-4 IgG (1 ,ug/ml) followed by a 1:100 dilution of rhodamine-conjugated goat anti-rabbit IgG (Boehringer Mannheim). To distinguish cardiomyocytes from fibroblasts, the cells were also stained with a mouse monoclonal anti-oa-actinin (sarcomeric) antibody (Sigma, St. Louis, Mo.) followed by a 1:100 dilution of fluorescein isothiocyanateconjugated goat anti-mouse IgG. The stained cells were examined by conventional immunofluorescence microscopy and laser confocal microscopy using a Molecular Dynamics confocal microscope. RESULTS Identification of a GATA-4-binding site in the cTnC enhancer. Previous studies have identified four functionally important nuclear protein-binding sites in the murine cTnC promoter-enhancer (Fig. 1A) (54). The first of these sites, termed CEF-1, contains the nucleotide sequence AGATIA, which conforms to one of the high-affinity GATA-binding sites identified by random site selection analyses but differs from the consensus GATA-binding sequence (WGATAR) by a single nucleotide substitution (Fig. 1A) (32, 42, 51). In addition, the second nuclear protein-binding site in the cTnC enhancer, CEF-2, contains the nucleotide sequence GGATAT, which contains the GATA core motif but differs from the consensus GATA-binding sequence in its flanking residues (Fig. 1A). Of note, related motifs are present in the transcriptional regulatory elements of multiple cardiac genes (Fig. 1B).

7519

A. -124

cTnC Pr/Erh

-79

1

cPJJ\ cP=E H

2

I3I

CEF-1: TGGT:A mCEP-1: --G-----CEF-2: GGTGG CCAG C-n-CEF-2

B.

CONSENSUS Murine cTnC Enhancer Maurln a-MHC Promoter Murirw ANF Promoter Humen "/c MLIC Prmoter Chicken cTnT Enhtnocr

WGATAR AG ATMA AGATAG AGATAA TGATEG AGATAM

FIG. 1. Identification of potential GATA-binding sites in the cTnC enhancer and other cardiac genes. (A) Schematic representation of the cTnC cardiac-specific promoter-enhancer (Pr/Enh; bp -124 to + 1) (54). The four functionally important nuclear protein-binding sites designated CEF-1, CEF-2, CPF-1, and CPF-2 are boxed (54). The nucleotide sequences of the putative CEF-1 and CEF-2 GATAbinding sites (boxed) are shown beneath the respective binding sites. The nucleotide substitutions in the GATA site of CEF-1 (mCEF-1) and CEF-2 (mCEF-2) are shown. (B) Comparison of the nucleotide sequences of the consensus GATA-binding site (CONSENSUS) with potential GATA-binding sites in other cardiac muscle genes: murine cTnC enhancer (54), murine ot-myosin heavy-chain (MHC) promoter (19), murine atrial natriuretic factor (ANF) promoter (5, 67), human slow/cardiac myosin light-chain 1 (MLC1) promoter (60), and chicken cardiac troponin T (cTnT) promoter-enhancer (25).

To determine directly if GATA-4 binds to the CEF-1 site, we performed EMSAs using a radiolabelled CEF-1 oligonucleotide probe and in vitro-translated GATA-4 protein (Fig. 2). In vitro-labelled GATA-4 bound specifically to the CEF-1 probe (Fig. 2, lane 3, arrow). This binding was blocked by preincubation with a GATA-4-specific antiserum and was competed for by unlabelled CEF-1 oligonucleotide (Fig. 2, lanes 5 to 7) but not by a CEF-1 oligonucleotide containing five nucleotide substitutions in the GATA-binding site (Fig. 2, lanes 10 and 11) (see Fig. 1A for the mCEF-1 sequence). GATA-4 binding to CEF-1 was also competed for by an unlabelled oligonucleotide containing the GATA-binding site from the murine al-globin gene (Fig. 2, lanes 8 and 9). GATA-4 from cardiac nuclear extracts binds to CEF-1. To determine if cardiac nuclear extracts contained GATA-4 that could bind to the CEF-1 element of the cTnC enhancer, cardiac nuclear extracts were used in EMSAs in conjunction with a radiolabelled CEF-1 probe and a GATA-4-specific antiserum (Fig. 3). Cardiac nuclear extracts contained a major CEF-1-binding activity (lane 2, arrow) which was identical to GATA-4 by several criteria. First, it was competed for by unlabelled CEF-1 oligonucleotide (Fig. 3A, lanes 3 and 4) and by the GATA-binding site from the al-globin promoter (39) (Fig. 3A, lanes 5 and 6). In contrast, it was not competed for by the mCEF-1 oligonucleotide containing five nucleotide substitutions in the GATA site (Fig. 3A, lanes 7 and 8). Second, this complex was supershifted by a GATA-4-specific antiserum (Fig. 3A, lane 10, dashed arrow) but not by a preimmune serum (Fig. 3A, lane 9). Finally, this cardiac nuclear complex comigrated with recombinant GATA-4 protein prepared by transfection of COS-7 cells with a GATA-4 eukaryotic expres-

IP ET AL.

7520

MOL. CELL. BIOL.

Reticulocyte Lysate: Antisera: Competitor (ng):

H201

sion vector (Fig. 3A; compare lanes 2 and 12). Thus, we concluded that cardiac nuclear extracts contain GATA-4 that can bind to CEF-1. Two additional CEF-1-binding activities were observed in the cardiac nuclear extracts. The rapidmobility complex does not appear to represent a specific binding activity, as it was not competed for by excess unlabelled CEF-1 oligonucleotide. The slower-mobility complex does not appear to represent a GATA-binding activity, as it was not competed for by excess unlabelled oligonucleotide corresponding to the GATA-binding site from the otl-globin promoter. Previous studies have suggested that GATA-4 is expressed in a lineage-restricted pattern in vivo. To determine whether the CEF-1-binding activity corresponding to GATA-4 also displayed a lineage-restricted pattern of expression, we performed EMSAs using nuclear extracts prepared from cardiac muscle, NIH 3T3 cells, murine C2C12 skeletal myotubes, and primary cardiac fibroblasts. Prominent GATA-4 activity was observed in the cardiac nuclear extracts (Fig. 3B, lane 2, solid arrow). In contrast, significant GATA-4-binding activity was not detected in nuclear extracts from the skeletal muscle cells, cardiac fibroblasts, or NIH 3T3 cells. In some experiments, detectable GATA-4-binding activity was seen in the skeletal myotubes and cardiac fibroblasts. As described below, the functional significance of this low-level binding activity remains unclear. Thus, these experiments were consistent with the hypothesis that the major GATA-4-binding activity present in cardiac extracts is derived from the cardiac myocyte population. In addition, they are in agreement with previous studies that have suggested a lack of GATA-4 expression in skeletal myocytes (4, 23, 75). As shown in Fig. 1A, the cTnC enhancer contains a second nuclear protein-binding site designated CEF-2 that also contains a potential GATA-binding sequence. To determine if GATA-4 binds to this motif, cardiac nuclear extracts were used

I-4

GATA

1 _

-

T CE- aglobinl mCEF-1

20 1001 20 1001 20 100|

.....

_AS

FIG. 2. Binding of in vitro-transcribed and -translated GATA-4 to the CEF-1 site of the cTnC enhancer. A radiolabelled synthetic CEF-1 oligonucleotide was used in EMSAs with reticulocyte lysates programmed with either water (H20) or in vitro-transcribed GATA-4 mRNA (GATA-4). Where indicated, binding reaction mixtures were preincubated with either control preimmune rabbit antiserum (PI), a GATA-4-specific rabbit antiserum (I), or 20 to 100 ng of the indicated unlabelled competitor oligonucleotides (see Materials and Methods for the sequences of these oligonucleotides). The band corresponding to the GATA-4 protein complex is indicated with an arrow. Autoradiograms were scanned with an Agfa Arcus Plus scanner into a Macintosh Quadra 700 computer using Adobe Photoshop software and printed on a Rasterops CorrectPrint 300 printer.

A. Extract: Antisera:

Competitor (ng):

B.

C. | | _1

COS| pMT2-

Cardiac

I

I1P CEF-1 laglobin mCEF-11 _ 20 1001 20 100120 too l

_i

l

Extracts: Antisera:

_III

......

I

f. 9

4-0

.

_

Cardiac

3T3 P

-.I

|

l

C2C12

Fibroblasts Pl

Probe:

Extract:

Antisera: -

w W. ww __o

CEF-1 I CEF-2 s Cardiac = C|MT2.

CEF-1

-PlJ

i

W& _

I II PilI

m

AM

4

5

I

-I

P

I

1

2

3

6

7

8

9

10

FIG. 3. Binding of GATA-4 from nuclear extracts to the CEF-1 site of the cTnC enhancer. Radiolabelled CEF-1 and CEF-2 oligonucleotides used in EMSAs with nuclear extracts prepared from neonatal rat hearts (Cardiac), COS-7 cells transfected with the control plasmid pMT-2 (COS), and COS-7 cells transfected with the GATA-4 eukaryotic expression plasmid pMT-2-GATA-4 (pMT2-GATA-4) (A and C) or with nuclear extracts prepared from neonatal rat hearts (Cardiac), NIH 3T3 cells (3T3), C2C12 myotubes (C2C12), and primary neonatal rat cardiac fibroblasts (Fibroblasts) (B). Where indicated, binding reaction mixtures were preincubated with either control preimmune rabbit serum (PI), a GATA-4-specific rabbit antiserum (I), or 20 to 100 ng of unlabelled competitor oligonucleotides. The bands corresponding to the GATA-4 nuclear protein complex and the antibody-supershifted GATA-4 protein complex are indicated with solid and dashed arrows, respectively. The nuclear protein complex which binds to both the CEF-1 and CEF-2 probes is indicated by the open arrow.

were

VOL. 14, 1994


7521

FIG. 4. Double-label indirect immunofluorescence of a heterogeneous population of rat cardiac cells. The cells were stained simultaneously with mouse anti-actinin IgG and either rabbit anti-mouse GATA-4 IgG (A to E) or rabbit preimmune IgG (F and G). Bound antibody was detected with fluorescein isothiocyanate-conjugated goat anti-mouse IgG and rhodamine-conjugated goat anti-rabbit IgG. (A) a-Actinin expression in a cardiac myocyte. (B) GATA-4 expression in the same field. The nuclei of both the cardiac myocyte (white arrow) and cardiac fibroblasts (see black arrow for example) contain GATA-4. (C) a-Actinin and GATA-4 expression in the same field. (D and E) Confocal microscopic view of cardiac myocytes and fibroblasts. (D) The threshold of detection is set low to demonstrate the positions of a cardiac myocyte (left) and cardiac fibroblast (right). (E) GATA-4 (red) is evident in the nuclei of both the cardiac myocyte (white arrow) and the fibroblast (black arrow), whereas a-actinin staining (green) is present only in the myocyte. (F) Control staining with preimmune rabbit IgG, demonstrating weak perinuclear staining but no nuclear staining in a cardiac myocyte (white arrow). (G) a-Actinin expression in the same field.

in EMSAs in conjunction with a radiolabelled CEF-2 probe and a GATA-4-specific antiserum (Fig. 3C). Consistent with data presented in our previous report (54), radiolabelled CEF-2 bound five specific cardiac nuclear protein complexes (Fig. 3C, lanes 4 to 6). None of these complexes was supershifted by a GATA-4-specific antiserum (Fig. 3C, lane 6). Moreover, none of these nuclear complexes comigrated with the GATA-4-binding activity detected by using the radiolabelled CEF-1 probe and cardiac nuclear extracts (Fig. 3C, lanes 1 to 3, solid arrow) or radiolabelled CEF-1 and recombinant GATA-4 protein prepared by transfection of COS-7 cells with a GATA-4 eukaryotic expression vector (Fig. 3C, lanes 8 to 10, solid arrow). Interestingly, the radiolabelled CEF-1 and CEF-2 probes both bound one complex of identical mobility (Fig. 3C, lanes 1 to 6, open arrow). Binding of this complex to either probe could be competed for by unlabelled CEF-1 and CEF-2 competitors (data not shown), suggesting that CEF-1 and CEF-2 bind a common nuclear protein complex. Taken together, these experiments demonstrated that CEF-1, but not CEF-2, binds GATA-4 present in cardiac nuclear extracts. GATA-4 expression in cardiac myocytes. The adult myocardium is composed of multiple cell types, including cardiac myocytes, fibroblasts, and vascular endothelial and smooth

muscle cells. To determine whether GATA-4 is expressed in cardiac myocytes or alternatively is expressed in nonmyocytic cells in the heart, we performed indirect immunofluorescence analyses using a GATA-4-specific antiserum and freshly isolated primary rat neonatal cardiac myocytes and fibroblasts. Cardiac myocytes were identified by concurrent incubation of the mixed population of cells with an antiserum directed against sarcomeric a-actinin which clearly defined sarcomeric striations (Fig. 4A, C, and E). Cell staining was assessed by both conventional fluorescence (Fig. 4A to C, F, and G) and confocal (Fig. 4D and E) microscopy. Intense GATA-4 staining was detectable in the nuclei of cardiac myocytes (Fig. 4B, C, and E, white arrows). In addition, faint but reproducible staining was detected in the nuclei of primary cardiac fibroblasts (Fig. 4B, C, and E, black arrows). Control experiments performed with rabbit preimmune serum revealed weak, diffuse perinuclear staining of cardiac myocytes but not nuclear staining (Fig. 4F and G). These data were consistent with the results of EMSA experiments (Fig. 3B) and suggest that abundant GATA-4 is present in the nuclei of cardiac myocytes, while lower-level GATA-4 expression is present in cardiac fibroblasts. Functional significance of the GATA site for cTnC enhancer activity. To determine the role of the CEF-1 GATA-binding

7522

IP ET AL.

MOL. CELL. BIOL. Relative CAT

60

Activity

CAT Gene

pCAT

-

50

I"

I I1.1

4i

40 0

p-124CAT

-Jjjjijjj..

54

30

W.

U -

co

U1 p-1 24CATmCEF-1

6

ENNNW

FIG. 5. The GATA-4-binding site is required for the activity of the cTnC promoter-enhancer in neonatal cardiac myocytes. Fifteen micrograms of the cTnC-CAT reporter plasmids (schematically represented at the left) and 5 jig of the pMSVfgal reference plasmid were transfected into cultures of primary neonatal rat cardiac myocytes, and CAT and ,-galactosidase activities were determined. CAT activities, corrected for differences in transfection efficiencies, were normalized to the CAT activity observed following transfection of the promoterless control plasmid, pCAT-Basic, which produced 0.5% acetylation. A representative CAT assay is shown at the right. Autoradiograms were scanned with an Agfa Arcus Plus scanner into a Macintosh Quadra 700 computer using Adobe Photoshop software and printed on a Rasterops CorrectPrint 300 printer.

site in the transcriptional activity of the cTnC promoterenhancer in cardiac myocytes, CAT reporter constructs containing the wild-type cTnC promoter-enhancer (p-124CAT) and the cTnC promoter-enhancer containing a mutated GATA-4-binding site (p-124CATmCEF-1) were transfected into primary cardiac myocytes. The wild-type cTnC promoterenhancer increased CAT expression by 50-fold compared with a control CAT reporter construct lacking a functional promoter or enhancer (pCAT-Basic) (Fig. 5). Mutation of the GATA-4-binding site in CEF-1 resulted in a 90% reduction in the transcriptional activity of the cTnC promoter-enhancer (Fig. 5). Thus, the GATA-4-binding site is required for the transcriptional activity of the cTnC gene in cardiac myocytes. GATA-4 activates transcription of the cTnC enhancer in nonmuscle cells. The cTnC transcriptional enhancer is not active in non-cardiac muscle cell lineages (54). Similarly, GATA-4 is not expressed in non-cardiac muscle cells such as NIH 3T3 cells. Therefore, it was of interest to determine whether forced expression of GATA-4 can activate transcription from the cTnC promoter-enhancer in 3T3 cells. 3T3 cells were cotransfected with a CAT reporter construct containing the intact cTnC promoter-enhancer and a GATA-4 eukaryotic expression vector (pMT2-GATA-4) (Fig. 6). Consistent with previous reports (54), the p-124CAT reporter construct was inactive in 3T3 cells (Fig. 6, column 1). However, cotransfection of the pMT2-GATA-4 expression plasmid with the p-124CAT reporter construct resulted in a 45-fold increase in transcription from the cTnC promoter-enhancer (Fig. 6, column 2). To determine whether this increase in transcription was dependent upon an intact CEF-1 GATA-4-binding site, we tested the effects of GATA-4 expression on the transcriptional activity of the p-124CATmCEF-1 reporter plasmid containing a five-nucleotide substitution in the CEF-1 GATA-4 site of the cTnC enhancer (Fig. 6, columns 3 and 4). GATA-4 did not significantly activate transcription of the cTnC enhancer containing a mutant GATA-4-binding site. Thus, GATA-4 can transactivate the intact cTnC promoter-enhancer in nonmuscle cells, and this transactivation requires the CEF-1 GATA-4binding site. Whole-mount in situ hybridization of GATA-4 and cTnC in mouse embryos. To provide additional evidence that GATA-4

20 100

p-124CAT pBluescript KS

pMT2-GATA-4 p-124CATmCEF-1

1

2

+

+

3

4

_ L+ | |+LlIJ

IE+ 7 Z+ _

FIG. 6. GATA-4-modulated transactivation of the cTnC promoterenhancer in NIH 3T3 cells. NIH 3T3 cells were transfected with 24 ,ug of the p-124CAT reporter plasmid containing the wild-type cTnC promoter-enhancer (p-124CAT +) or the p-124CATmCEF-1 reporter plasmid containing a five-nucleotide substitution in the CEF-1 GATA4-binding site (p-124CATmCEF-1 +) and either 6 ,ug of the control plasmid pBluescript KS (pBluescript KS +) or 6 jig of the GATA-4 expression plasmid pMT2-GATA-4 (pMT2-GATA-4+). All transfection mixtures also contained 5 jig of the pMSV,Bgal reference plasmid. Forty-eight hours after transfection, CAT and P-galactosidase activities were determined. CAT activities, corrected for differences in transfection efficiencies, were normalized to the CAT activity obtained following transfection of the p-124CAT plasmid with the pBluescript KS control plasmid, which produced 0.1% acetylation. The data are presented as relative CAT activities ± standard errors of the means.

regulates cTnC RNA expression, we used whole-mount in situ hybridization to compare the temporal and spatial patterns of expression of GATA-4 and cTnC during mouse development. Previous studies have shown that intraembryonic expression of GATA-4 mRNA is evident in precardiac mesoderm of 7.0- to 7.5-day-p.c. mouse embryos and that by 8 to 9 days p.c., abundant GATA-4 mRNA is present in the endocardium and myocardium of the folding heart tube (23). A direct comparison of the patterns of expression of GATA-4 and cTnC transcripts is shown in Fig. 7. At an early stage of heart development (day 7.0 to 7.5 p.c.), cTnC was not expressed at detectable levels (Fig. 7B), whereas GATA-4 expression was evident in promyocardial tissue at the anterior end of the embryo (Fig. 7A). By 9.0 to 9.5 days p.c., there were striking similarities between the patterns of expression of GATA-4 and cTnC (Fig. 7D and E). Both transcripts were abundantly expressed in the heart at this stage of development. Structures caudal to the heart (Fig. 7D and E, arrows), which include precardiac mesoderm and liver precursors in the septum transversum, were found to express GATA-4 mRNA but not cTnC mRNA. These results and earlier studies (23) indicate that (i) intraembryonic expression of GATA-4 precedes cTnC expression by approximately 0.5 to 1 day, (ii) both GATA-4 and cTnC are expressed in cardiac myocytes during postnatal and adult development, and (iii) GATA-4 is expressed in cells expressing cTnC (cardiac myocytes), but cTnC is not expressed in all cells expressing GATA-4 (yolk sac endoderm, intestinal epithelium, precardiac mesoderm, and endocardium). These results are consistent with a model in which GATA-4 is necessary but not sufficient for transcription of the cTnC gene.


VOL. 14, 1994

A

B

7523

C .i.

m

ve

m

, ; a_ F_

m

pm

f

>. ;

w. fl ^ ..

..

^s _ s

@

,

E

FIG. 7. Expression of GATA-4 and cTnC mRNA in mouse embryos. (A) A 7.0- to 7.25-day p.c. embryo hybridized to a GATA-4 antisense probe. GATA-4 mRNA (arrows) is evident in visceral endoderm (ve) in the upper pole of the egg cylinder and in promyocardium (pm) at the anterior end of the embryonic tissue. Magnification, X60; bar = 100 SLm. (B) A 7.25- to 7.50-day p.c. embryo hybridized to a cTnC antisense probe. No cTnC mRNA is evident in promyocardial tissue at this early stage of development. Magnification, X60; bar = 100 ,um. (C) Lateral view of a 9.5-day p.c. embryo hybridized to a control cTnC sense probe. No hybridization is seen. Magnification, X40. (D) Lateral view of a 9.5-day p.c. embryo hybridized to a GATA-4 antisense probe. Abundant GATA-4 mRNA expression is seen in the heart, proximal outflow tract, and structures caudal to the heart, including the septum transversum and visceral yolk sac attachment (arrows). Magnification, X40. (E) Lateral view of a 9.5-day p.c. embryo hybridized to a cTnC antisense probe. cTnC expression is seen in the heart but not in areas caudal to the heart (arrows). Magnification,

x40.

DISCUSSION The striated muscle lineages, cardiac, fast skeletal, and slow skeletal, can be functionally distinguished by the expression of sets of tissue-specific protein isoforms. While relatively little is understood about the molecular mechanisms that regulate cardiac muscle-specific gene expression, current developmental paradigms suggest that the regulation of cardiac musclespecific genes is likely to be controlled by the activity of cardiac muscle-specific transcription factors. We have used the cTnC gene as a model system with which to examine the molecular mechanisms that regulate cardiac and skeletal muscle transcription (52, 54). The expression of the cTnC gene in cardiac myocytes both in vitro and in vivo is controlled by a transcriptional enhancer located in the immediate 5' flanking region of the gene (bp -124 to -79). This enhancer contains two nuclear protein-binding sites designated CEF-1 and CEF-2 (54). In this report, we have demonstrated that the lineagerestricted zinc finger transcription factor GATA-4 is expressed in cardiac myocytes, binds to the CEF-1 site of the cTnC enhancer, and is the major CEF-1-binding protein in cardiac myocyte nuclear extracts. Binding of GATA-4 to the CEF-1

site of the cTnC enhancer is required for the transcriptional activity of this element in cardiac muscle cells. Furthermore, the intact cardiac-specific cTnC promoter-enhancer can be transactivated in NIH 3T3 cells by forced expression of GATA-4. Finally, in situ hybridization analyses have demonstrated that cTnC and GATA-4 are coexpressed in the myocardium during murine embryogenesis. These findings are consistent with the hypothesis that GATA-4 plays an important role in regulating the cardiac muscle-specific expression of the cTnC gene. Numerous studies have provided evidence for the importance of the skeletal muscle-restricted basic helix-loop-helix and MEF-2 transcription factors in the regulation of skeletal muscle development (7, 10, 27, 35, 40, 47, 48, 58, 65, 80, 81). Several lines of evidence now suggest that GATA-4 may play an important role in cardiac muscle development. GATA-4 is expressed early during cardiac myogenesis in the mouse, and its expression is restricted to the developing heart and precardiac mesoderm during early murine development (4, 23). GATA-4-binding sites are present in the transcriptional regulatory regions of multiple cardiac genes (Fig. 1B). Most

7524

IP ET AL.

importantly, GATA-4 can directly activate the expression of at least one cardiac muscle-specific gene in nonmuscle cells. Despite these results, the findings that GATA-4 is expressed in non-cardiac muscle cells in later development and that other GATA family members which have been reported to bind to similar sequence motifs are widely expressed in the mouse raise important questions about the mechanisms by which GATA-4 might regulate lineage-specific gene expression during cardiac myogenesis. Previous studies of the role of the GATA proteins in regulating lineage-specific gene expression in T cells and erythroid precursors have strongly suggested that GATA proteins interact cooperatively with other transcription factors to regulate lineage-specific gene expression in these systems (reviewed in references 50 and 51). For example, GATA-1 functions in conjunction with NF-E2 in regulating the transcription of the globin locus control region (1, 3, 55, 79). In addition, the cx- and ,-globin promoters contain binding sites for both GATA and CACCC box-binding factors (21, 57). In this light, it is of interest that the cTnC promoter-enhancer contains at least three additional nuclear protein-binding sites, each of which has been shown to be important for the activity of this enhancer in cardiac myocytes (54). Of note, the CEF-2 nuclear protein-binding site, which contains the nucleotide sequence GGATAT, failed to bind GATA-4. However, EMSAs revealed that the CEF-1 and CEF-2 probes (each of which contains the nucleotide sequence GANATTNCAGG) do bind a common lineage-restricted nuclear protein complex. Moreover, a four-nucleotide substitution in CEF-2 which abolished the binding of this complex (Fig. 1A, mCEF-2) dramatically reduced the activity of the cTnC in cardiac myocytes (data not shown). Taken together, these data suggest that a potentially novel lineage-restricted transcription factor (or factors) binds to both the CEF-1 and CEF-2 elements and may, in conjunction with GATA-4, CACCC box-binding factors (13, 62), and M-CAT/TEF-1 (38, 77), play an important role in regulating transcription of the cTnC gene in cardiac myocytes. The identity of this novel factor, which is clearly distinct from GATA-4, is currently under investigation. Differences in DNA-binding specificities between the different GATA proteins may also play a role in restricting expression of the cTnC gene to cardiac myocytes. Thus, for example, because the GATA-4 site in the cTnC enhancer does not correspond to a consensus GATA-binding site, it is possible that it binds GATA-4 with higher affinity than other GATA family members. This possibility is currently being tested in EMSA and transfection studies. Finally, it is becoming increasingly clear that transcriptional repression may be important in controlling lineage-specific gene expression (17, 44, 46, 74). Mechanisms underlying such repression can include competitive binding of repressor factors to DNA, protein-protein interactions that sequester lineage-specific transcription factors from their cognate binding sites, and posttranslational modifications that modulate DNA-binding or transcriptional transactivation activities. The role of each of these mechanisms in regulating cardiac-specific gene expression remains to be determined. In addition to playing a potentially important role in controlling lineage-specific gene expression during cardiac development, GATA-4 serves as an early marker of differentiating cardiac mesoderm (4, 23, 31). Thus, it will be of interest to elucidate the transcriptional mechanisms controlling GATA-4 expression in precardiac mesoderm. We have shown previously that GATA-4 can be induced in F9 cells by treatment with retinoic acid (4). It is possible that GATA-4 can function as a retinoic acid-responsive transcription factor during cardiac

MOL. CELL. BIOL.

development. Recent studies have described an evolutionarily conserved homeobox gene, Csx-1/Nkx 2.5 (6, 34, 37, 71), which, like GATA-4, is expressed early during cardiac development. It will be of interest to elucidate the relationship between GATA-4 and Csx-1 expression in developing cardiac myocytes. ACKNOWLEDGMENTS We thank Bill Coleman and Julie Trausch-Azar for assistance with confocal microscopy, Lisa Gottschalk for expert preparations of illustrations, and Kathryn Dekker for expert secretarial assistance. This work was supported in part by Public Health Service grant 1ROlHL52134 from the National Institutes of Health, grant 91-52 from the McDonnell Foundation, a Monsanto/Searle Award, a Pfizer Scholar Award, and a Basil O'Connor Scholar Award to D.B.W. M.H. was supported by the Ehrnrooth Foundation, the Finnish Cultural Foundation, and the Paulo Foundation. This work was supported in part by a grant from the Muscular Dystrophy Association to J.M.L. This work was supported in part by Public Health Service grant 1ROlHL51145-01 and an American Heart Association grant-in-aid to M.S.P. The first two authors contributed equally to this work.

ADDENDUM After the manuscript was submitted, Grepin et al. (18a) and Molkentin et al. (43a) reported that GATA-4 plays an important functional role in regulating transcription of the rat B-type natriuretic peptide and the rat a-myosin heavy-chain genes,

respectively. REFERENCES 1. Andrews, N. C., H. Erdjument-Bromage, M. B. Davidson, P. Tempst, and S. H. Orkin. 1993. Erythroid transcription factor NF-E2 is a haematopoietic-specific basic leucine zipper protein. Nature (London) 362:722-728. 2. Andrews, N. C., and D. V. Faller. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19:2499. 3. Andrews, N. C., K. J. Kotkow, P. A. Ney, H. Erdjument-Bromage, P. Tempst, and S. H. Orkin. 1993. The ubiquitous subunit of erythroid transcription factor NF-E2 is a small basic-leucine zipper protein related to the v-maf oncogene. Proc. Natl. Acad. Sci. USA 90:11488-11492. 4. Arceci, R. J., A. A. King, M. C. Simon, S. H. Orkin, and D. B. Wilson. 1993. Mouse GATA-4: a retinoic acid-inducible GATAbinding transcription factor expressed in endodermally derived tissues and heart. Mol. Cell. Biol. 13:2235-2246. 5. Argentin, S., A. Ardati, S. Tremblay, I. Lihrmann, L. Robitaille, J. Drouin, and M. Nemer. 1994. Developmental stage-specific regulation of atrial natriuretic factor gene transcription in cardiac cells. Mol. Cell. Biol. 14:777-790. 6. Bober, E., C. Baum, T. Braun, and H. H. Arnold. 1994. A novel NK-related mouse homeobox gene: expression in central and peripheral nervous structures during embryonic development. Dev. Biol. 162:288-303. 7. Boheler, K. R., C. Chassagne, X. Martin, C. Wisnewsky, and K. Schwartz. 1992. Cardiac expressions of alpha- and beta-myosin heavy chains and sarcomeric alpha-actins are regulated through transcriptional mechanisms. Results from nuclear run-on assays in isolated rat cardiac nuclei. J. Biol. Chem. 267:12979-12985. 8. Braun, T., E. Bober, B. Winter, N. Rosenthal, and H. H. Arnold. 1990. Myf-6, a new member of the human gene family of myogenic determination factors: evidence for a gene cluster on chromosome 12. EMBO J. 9:821-831. 9. Braun, T., G. Buschhausen Denker, E. Bober, E. Tannich, and H. H. Arnold. 1989. A novel human muscle factor related to but distinct from MyoDl induces myogenic conversion in 1OT1/2 fibroblasts. EMBO J. 8:701-709. 10. Bucher, E. A., P. C. Maisonpierre, S. F. Konieczny, and C. P. J. Emerson. 1988. Expression of the troponin complex genes: transcriptional coactivation during myoblast differentiation and inde-

VOL. 14, 1994


pendent control in heart and skeletal muscles. Mol. Cell. Biol. 8:4134-4142. 11. Conlon, R. A., and J. Rossant. 1992. Exogenous retinoic acid rapidly induces anterior ectopic expression of murine Hox-2 genes in vivo. Development 116:357-368. 12. Davis, R. L., H. Weintraub, and A. B. Lassar. 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987-1000. 13. Devlin, B. H., F. C. Wefald, W. E. Kraus, T. S. Bernard, and R. S. Williams. 1989. Identification of a muscle-specific enhancer within the 5'-flanking region of the human myoglobin gene. J. Biol. Chem. 264:13896-13901. 14. Donoghue, M., H. Ernst, B. Wentworth, B. Nadal-Ginard, and N. Rosenthal. 1988. A muscle-specific enhancer is located at the 3' end of the myosin light-chain 1/3 gene locus. Genes Dev. 2:17791790. 15. Edmondson, D. G., and E. N. Olson. 1989. A gene with homology to the myc similarity region of MyoDl is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev. 3:628-640. 16. Evans, T., M. Reitman, and G. Felsenfeld. 1988. An erythrocytespecific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes. Proc. Natl. Acad. Sci. USA 85:5976-5980. 17. Ewen, M. E., H. K. Sluss, C. J. Sherr, H. Matsushime, J. Y. Kato, and D. M. Livingston. 1993. Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell 73:487-497. 18. Gossett, L. A., D. J. Kelvin, E. A. Sternberg, and E. N. Olson. 1989. A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol. Cell. Biol. 9:5022-5033. 18a.Grepin, C., L. Dagnino, L. Robitaille, L. Haberstroh, T. Antakly, and M. Nemer. 1994. A hormone-encoding gene identifies a pathway for cardiac but not skeletal muscle gene transcription. Mol. Cell. Biol. 14:3115-3129. 19. Gulick, J., A. Subramaniam, J. Neumann, and J. Robbins. 1991. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J. Biol. Chem. 266:9180-9185. 20. Harlow, E., and D. Lane. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 21. Hartzog, G. A., and R. M. Myers. 1993. Discrimination among potential activators of the beta-globin CACCC element by correlation of binding and transcriptional properties. Mol. Cell. Biol. 13:44-56. 22. Hasty, P., A. Bradley, J. H. Morris, D. G. Edmondson, J. M. Venuti, E. N. Olson, and W. H. Klein. 1993. Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature (London) 364:501-506. 23. Heikinheimo, M., J. M. Scandrett, and D. B. Wilson. 1994. Localization of transcription factor GATA-4 to regions of the mouse embryo involved in cardiac development. Dev. Biol. 164: 361-373. 24. Ho, I.-C., P. Vorhees, N. Marin, B. K. Oakley, S. F. Tsai, S. H. Orkin, and J. M. Leiden. 1991. Human GATA-3-a lineagerestricted transcription factor that regulates the expression of the T-cell receptor alpha-gene. EMBO J. 10:1187-1192. 25. lannello, R. C., J. H. Mar, and C. P. Ordahl. 1991. Characterization of a promoter element required for transcription in myocardial cells. J. Biol. Chem. 266:3309-3316. 26. Jaynes, J. B., J. E. Johnson, J. N. Buskin, C. L. Gartside, and S. D. Hauschka. 1988. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer. Mol. Cell. Biol. 8:62-70. 27. Johnson, J. E., B. J. Wold, and S. D. Hauschka. 1989. Muscle creatine kinase sequence elements regulating skeletal and cardiac muscle expression in transgenic mice. Mol. Cell. Biol. 9:33933399. 28. Jones, D. H., and B. H. Howard. 1990. A rapid method for site-specific mutagenesis and directional subcloning by using the polymerase chain reaction to generate recombinant circles. BioTechniques 8:178-183. 29. Joulin, V., D. Bories, J. F. Eleouet, M. C. Labastie, S. Chretien, M. G. Mattei, and P. H. Romeo. 1991. A T-cell-specific TCR delta

7525

DNA binding protein is a member of the human GATA family. EMBO J. 10:1809-1816. 30. Kaufman, M. H. 1992. The atlas of mouse development. Academic Press, London. 31. Kelley, C., H. Blumberg, L. I. Zon, and T. Evans. 1993. GATA-4 is a novel transcription factor expressed in endocardium of the developing heart. Development 118:817-827. 32. Ko, L. J., and J. D. Engel. 1993. DNA-binding specificities of the GATA transcription factor family. Mol. Cell. Biol. 13:4011-4022. 33. Ko, L. J., M. Yamamoto, M. W. Leonard, K. M. George, P. Ting, and J. D. Engel. 1991. Murine and human T-lymphocyte GATA-3 factors mediate transcription through a cis-regulatory element within the human T-cell receptor delta gene enhancer. Mol. Cell. Biol. 11:2778-2784. 34. Komuro, I., and S. Izumo. 1993. Csx: a murine homeoboxcontaining gene specifically expressed in the developing heart. Proc. Natl. Acad. Sci. USA 90:8145-8149. 35. Lee, H. R., S. A. Henderson, R Reynolds, P. Dunnmon, D. Yuan, and K R. Chien. 1988. Alpha 1-adrenergic stimulation of cardiac gene transcription in neonatal rat myocardial cells. Effects on myosin light chain-2 gene expression. J. Biol. Chem. 263:73527358. 36. Lee, K. J., R. S. Ross, H. A. Rockman, A. N. Harris, T. X. O'Brien, M. van Bilsen, H. E. Shubeita, R Kandolf, G. Brem, J. Price, S. M. Evans, H. Zhu, W. M. Franz, and K. R. Chien. 1992. Myosin light chain-2 luciferase transgenic mice reveal distinct regulatory programs for cardiac and skeletal muscle-specific expression of a single contractile protein gene. J. Biol. Chem. 267:15875-15885. 37. Lints, T. J., L. M. Parsons, L. Hartley, I. Lyons, and R. P. Harvey. 1993. Nkx-2.5: a novel murine homeobox gene expressed in early heart progenitor cells and their myogenic descendants. Development 119:419-431. 38. Mar, J. H., and C. P. Ordahl. 1988. A conserved CAT1CCT motif is required for skeletal muscle-specific activity of the cardiac troponin T gene promoter. Proc. Natl. Acad. Sci. USA 85:64046408. 39. Martin, D., and S. Orkin. 1990. Transcriptional activation and DNA binding by the erythroid factor GF-1/NF-E1/Eryf 1. Genes Dev. 4:1886-1898. 40. Martin, J. F., J. J. Schwarz, and E. N. Olson. 1993. Myocyte enhancer factor (MEF) 2C: a tissue-restricted member of the MEF-2 family of transcription factors. Proc. Natl. Acad. Sci. USA 90:5282-5286. 41. McDermott, J. C., M. C. Cardoso, Y. T. Yu, V. Andres, D. Leifer, D. Krainc, S. A. Lipton, and B. Nadal-Ginard. 1993. hMEF2C gene encodes skeletal muscle-specific and brain-specific transcription factors. Mol. Cell. Biol. 13:2564-2577. 42. Merika, M., and S. H. Orkin. 1993. DNA-binding specificity of GATA family transcription factors. Mol. Cell. Biol. 13:3999-4010. 43. Miner, J. H., and B. Wold. 1990. Herculin, a fourth member of the MyoD family of myogenic regulatory genes. Proc. Natl. Acad. Sci. USA 87:1089-1093. 43a.Molkentin, J. D., D. V. Kalvakolanu, and B. E. Markham. 1994. Transcription factor GATA-4 regulates cardiac muscle-specific expression of the a-myosin heavy-chain gene. Mol. Cell. Biol. 14:4947-4957. 44. Morimoto, R. I. 1993. Cells in stress: transcriptional activation of heat shock genes. Science 259:1409-1410. 45. Nabeshima, Y., K Hanaoka, M. Hayasaka, E. Esumi, S. Li, L. Nonaka, and Y. Nabeshima. 1993. Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature (London) 364:532-535. 46. Natesan, S., and M. Z. Gilman. 1993. DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes Dev. 7:2497-2509. 47. Olson, E. N. 1990. MyoD family: a paradigm for development? Genes Dev. 4:1454-1461. 48. Olson, E. N. 1993. Regulation of muscle transcription by the MyoD family. The heart of the matter. Circ. Res. 72:1-6. 49. Olson, E. N., and W. H. Klein. 1994. bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out. Genes Dev. 8:1-8. 50. Orkin, S. H. 1990. Globin gene regulation and switching: circa

7526

MOL. CELL. BIOL.

IP ET AL.

1990. Cell 63:665-72. 51. Orkin, S. H. 1992. GATA-binding transcription factors in hematopoietic cells. Blood 80:575-581. 52. Parmacek, M. S., H. S. Ip, F. Jung, T. Shen, J. F. Martin, A. J. Vora, E. N. Olson, and J. M. Leiden. 1994. A novel myogenic regulatory circuit controls slow/cardiac troponin C gene transcription in skeletal muscle. Mol. Cell. Biol. 14:1870-1885. 53. Parmacek, M. S., and J. M. Leiden. 1989. Structure and expression of the murine slow/cardiac troponin C gene. J. Biol. Chem. 264:13217-13225. 54. Parmacek, M. S., A. J. Vora, T. Shen, E. Barr, F. Jung, and J. M. Leiden. 1992. Identification and characterization of a cardiacspecific transcriptional regulatory element in the slow/cardiac troponin C gene. Mol. Cell. Biol. 12:1967-1976. 55. Peters, B., N. Merezhinskaya, J. Diffley, and C. T. Noguchi. 1993. Protein-DNA interactions in the epsilon-globin gene silencer. J. Biol. Chem. 268:3430-3437. 56. Pevny, L., M. C. Simon, E. Robertson, W. H. Klein, S. F. Tsai, V. Dagati, S. H. Orkin, and F. Costantini. 1991. Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature (London) 349:257260. 57. Plumb, M., J. Frampton, H. Wainwright, M. Walker, K. Macleod, G. Goodwin, and P. Harrison. 1989. GATAAG: a cis-control region binding an erythroid-specific nuclear factor with a role in globin and non-globin gene expression. Nucleic Acids Res. 17:7392. 58. Pollock, R., and R. Treisman. 1991. Human SRF-related proteins: DNA-binding properties and potential regulatory targets. Genes Dev. 5:2327-2341. 59. Rhodes, S. J., and S. F. Konieczny. 1989. Identification of MRF4: a new member of the muscle regulatory factor gene family. Genes Dev. 4:2050-2061. 60. Rotter, M., K. Zimmerman, A. Poustka, Y. N. Soussi, and P. A. Starzinski. 1991. The human embryonic myosin alkali light chain gene: use of alternative promoters and 3' non-coding regions. Nucleic Acids Res. 19:1497-504. 61. Rudnicki, M. A., P. Schnegelsberg, R. H. Stead, T. Braun, H. H. Arnold, and R. Jaenisch. 1993. MyoD or myf-5 is required for the formation of skeletal muscle. Cell 75:1351-1359. 62. Sartorelli, V., K. A. Webster, and L. Kedes. 1990. Muscle-specific expression of the cardiac a-actin gene requires MyoD1, CArG-box binding factor, and Spl. Genes Dev. 4:1811-1822. 63. Sassoon, D., G. Lyons, W. E. Wright, V. Lin, A. Lassar, H. Weintraub, and M. Buckingham. 1989. Expression of two myogenic regulatory factors myogenin and MyoDl during mouse embryogenesis. Nature (London) 341:303-307. 64. Sassoon, D. A. 1993. Myogenic regulatory factors: dissecting their role and regulation during vertebrate embryogenesis. Dev. Biol. 156:11-23. 65. Sassoon, D. A., I. Garner, and M. Buckingham. 1988. Transcripts of alpha-cardiac and alpha-skeletal actins are early markers for myogenesis in the mouse embryo. Development 104:155-164. 66. Schreier, T., L. Kedes, and R. Gahlmann. 1990. Cloning, structural analysis, and expression of the human slow twitch skeletal muscle/

cardiac troponin C gene. J. Biol. Chem. 265:21247-21253. 67. Seidman, C. E., K. D. Bloch, K. A. Klein, J. A. Smith, and J. G. Seidman. 1984. Nucleotide sequences of the human and mouse atrial natriuretic factor genes. Science 226:1206-1209. 68. Simon, M. C., L. Pevny, M. V. Wiles, G. Keller, F. Costantini, and S. H. Orkin. 1992. Rescue of erythroid development in gene targeted GATA-1-mouse embryonic stem cells. Nat. Genet. 1:9298. 69. Tamura, S., X.-H. Wang, M. Maeda, and M. Futai. 1993. Gastric DNA-binding proteins recognize upstream sequence motifs of parietal cell-specific genes. Proc. Natl. Acad. Sci. USA 90:1087610880. 70. Tapscott, S. J., and H. Weintraub. 1991. MyoD and the regulation of myogenesis by helix-loop-helix proteins. J. Clin. Invest. 87: 1133-1138. 71. Tonissen, K. F., T. A. Drysdale, T. J. Lints, R. P. Harvey, and P. A. Krieg. 1994. XNkx-2.5, a Xenopus gene related to Nkx-2.5 and tinman: evidence for a conserved role in cardiac development. Dev. Biol. 162:325-328. 72. Tsai, S. F., D. I. K. Martin, L. I. Zon, A. D. D'Andrea, G. G. Wong, and S. H. Orkin. 1989. Cloning of cDNA for the major DNAbinding protein of the erythroid lineage through expression in mammalian cells. Nature (London) 339:446-451. 73. Wall, L., E. deBoer, and F. Grosveld. 1988. The human beta-globin gene 3' enhancer contains multiple binding sites for an erythroidspecific protein. Genes Dev. 2:1089-1100. 74. Wang, C. Y., B. Petryniak, C. B. Thompson, W. G. Kaelin, and J. M. Leiden. 1993. Regulation of the ets-related transcription factor elf-1 by binding to the retinoblastoma protein. Science 260:

1330-1335. 75. Wilson, D. B., D. M. Dorfman, and S. H. Orkin. 1990. A nonerythroid GATA-binding protein is required for function of the human preproendothelin-1 promoter in endothelial cells. Mol. Cell. Biol. 10:4854-4862. 76. Wright, W. E., D. A. Sassoon, and V. K. Lin. 1989. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56:607-617. 77. Xiao, J. H., I. Davidson, H. Matthes, J. M. Garnier, and P. Chambon. 1991. Cloning, expression, and transcriptional properties of the human enhancer factor TEF-1. Cell 65:551-568. 78. Yamamoto, M., L. J. Ko, M. W. Leonard, H. Beug, S. H. Orkin, and J. D. Engel. 1990. Activity and tissue-specific expression of the transcription factor NF-E1 multigene family. Genes Dev. 4:16501662. 79. Yost, S. E., B. Shewchuk, and R. Hardison. 1993. Nuclear proteinbinding sites in a transcriptional control region of the rabbit alpha-globin gene. Mol. Cell. Biol. 13:5439-5449. 80. Yu, Y.-T., R. E. Breitbart, L. B. Smoot, Y. Lee, V. Mahdavi, and B. Nadal-Ginard. 1992. Human myocyte-specific enhancer factor 2 comprises a group of tissue-restricted MADS box transcription factors. Genes Dev. 6:1783-1798. 81. Zeller, R., K. D. Bloch, R. S. Williams, R. J. Arceci, and C. E. Seidman. 1987. Localized expression of the atrial natriuretic factor gene during cardiac embryogenesis. Genes Dev. 1:693-698.