The gene expression landscape of thermogenic ... - Wiley Online Library

Plant, Cell and Environment (2012) 35, 554–566

doi: 10.1111/j.1365-3040.2011.02435.x

The gene expression landscape of thermogenic skunk cabbage suggests critical roles for mitochondrial and vacuolar metabolic pathways in the regulation of thermogenesis pce_2435

554..566

YASUKO ITO-INABA1, YAMATO HIDA2, HIDEO MATSUMURA3, HIROMI MASUKO4, FUMIKO YAZU1, RYOHEI TERAUCHI5, MASAO WATANABE4,6 & TAKEHITO INABA1 1

Interdisciplinary Research Organization, Faculty of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan, 2Department of Biochemistry, Graduate School of Medicine/Faculty of Medicine, University of Yamanashi, Chuo, Yamanashi 409-3898, Japan, 3Research Support Center for Human and Environmental Sciences, Shinshu University, Ueda, Nagano 386-8567, Japan, 4Graduate School of Life Sciences, Tohoku University, Sendai 980-8577, Japan, 5 Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan and 6Faculty of Science, Tohoku University, Sendai 980-8578, Japan

ABSTRACT

INTRODUCTION

Floral thermogenesis has been described in several plant species. Because of the lack of comprehensive gene expression profiles in thermogenic plants, the molecular mechanisms by which floral thermogenesis is regulated remain to be established. We examined the gene expression landscape of skunk cabbage (Symplocarpus renifolius) during thermogenic and post-thermogenic stages and identified expressed sequence tags from different developmental stages of the inflorescences using super serial analysis of gene expression (SuperSAGE). In-depth analysis suggested that cellular respiration and mitochondrial functions are significantly enhanced during the thermogenic stage. In contrast, genes involved in stress responses and protein degradation were significantly up-regulated during post-thermogenic stages. Quantitative comparisons indicated that the expression levels of genes involved in cellular respiration were higher in thermogenic spadices than in Arabidopsis inflorescences. Thermogenesis-associated genes seemed to be expressed abundantly in the peripheral tissues of the spadix. Our results suggest that cellular respiration and mitochondrial metabolism play key roles in heat production during floral thermogenesis. On the other hand, vacuolar cysteine protease and other degradative enzymes seem to accelerate senescence and terminate thermogenesis in the postthermogenic stage.

More than 200 years ago, pioneering studies on floral thermogenesis in plants were performed in European Arum species (Araceae) by Lamarck (1778). Since then, heat production in the reproductive organs has been detected in several plant taxa including gymnosperms (Cycadaceae) as well as eudicots (Nymphaeaceae) and monocots (Araceae) (Seymour 2001). These plants begin thermogenesis when they bloom and terminate heat production when the pollen is released from the anthers. The Eastern Asian skunk cabbage (Symplocarpus renifolius) can keep the spadix temperature between 22 and 26 °C for several days, even when the ambient temperature falls as low as -10 °C (Fig. 1) (Knutson 1974; Uemura et al. 1993; Seymour 2004). The development of the skunk cabbage spadix can be divided into four stages: immature, female, bisexual and male (ItoInaba et al. 2009a). At the immature stage, the inflorescence is not ready to produce heat. At the female stage which lasts until the pollen is released, the spadix heats up significantly. At the bisexual stage, stamens emerge from the surface of the spadix and thermogenesis fluctuates. Subsequently, thermogenesis is undetectable at the male stage. As generally observed in arum species, thermogenesis in skunk cabbage is positively correlated to its oxygen consumption rate (Seymour & Blaylock 1999). Therefore, the respiratory activity in female-stage spadices is much higher than in male-stage ones. Interestingly, intracellular structures in female-stage spadix cells differ from that in malestage spadix cells (Ito-Inaba et al. 2009a). In petals and pistils, female-stage cells contain large amounts of mitochondria in dense cytoplasm, while male-stage cells contain fewer mitochondria and large cytoplasmic vacuoles. Stamen cells also carry numerous mitochondria during the female stage. These facts suggest that a large number of mitochondria is important for massive oxygen-dependent heat production, and that the development of vacuoles in

Key-words: floral thermogenesis; low temperature; plant mitochondria; respiration; SuperSAGE

Correspondence: Y. Ito-Inaba and T. Inaba. E-mail: ykoina@ cc.miyazaki-u.ac.jp (Y. Ito-Inaba), [email protected] (T. Inaba) 554

© 2011 Blackwell Publishing Ltd

Gene expression landscape in skunk cabbage

555

MATERIALS AND METHODS Plant materials and RNA isolation The skunk cabbage (S. renifolius) sampled for these experiments was collected in Nishiwaga town in Iwate prefecture, Japan. A sample taken from wild skunk cabbage was immersed immediately in liquid nitrogen and stored at -80 °C. Total RNA was isolated with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Purity and quantity of the isolated total RNA were confirmed and determined by denaturing gel electrophoresis and spectrophotometric analysis, respectively.

Figure 1. Floral thermogenesis in skunk cabbage. (a) Skunk cabbage in the wild. (b) Visualization of thermogenesis by thermography. The thermal image was taken with thermotracer TH9100 MR/WR (NEC/Avio).

male-stage spadices plays a role in the termination of heat production. However, it remains largely unknown which genes are involved in these changes of intracellular structure and the transitions between the thermogenic stages. To uncover the molecular mechanisms underlying plant thermogenesis, much effort has been made to characterize two energy dissipating systems, an alternative oxidase (AOX) and an uncoupling protein (UCP) (Vanlerberghe & McIntosh 1997; Vercesi et al. 2006; Zhu et al. 2011). Because of the correlation between heat production and AOX concentration as well as activity in several thermogenic plants (Grant et al. 2008; Ito-Inaba, Hida & Inaba 2009b), AOX rather than UCP has been assumed to control plant thermogenesis. However, although it has been suggested that the post-translational regulation of AOX regulates the thermogenic capacity of this protein (Onda et al. 2007; Grant et al. 2009), direct evidence supporting the notion of a dominant role of AOX is lacking. Furthermore, studies of AOX and UCP in non-thermogenic plants imply that they function in the regulation of cellular metabolism and prevent the release of reactive oxygen species (Borecky et al. 2006). To date, no specific primary structures associated with heat production have been identified in AOX and UCP proteins (Grant et al. 2009; Ito-Inaba et al. 2009b). These observations indicate that additional genes other than AOX and UCP may be involved in floral thermogenesis. We examined the gene expression landscape of spadix cells in thermogenic skunk cabbage to understand the molecular basis of floral thermogenesis. Because the complete genome sequence of thermogenic skunk cabbage is not available, we took advantage of the super serial analysis of gene expression (SuperSAGE) methodology as it can be applied to non-model organisms to provide quantitative and comprehensive gene expression profiles (Matsumura et al. 2003, 2008a). We identified genes that are associated with the maintenance and termination of floral thermogenesis and propose a mechanism by which these genes regulate floral heat production.

Generation and analysis of SuperSAGE libraries To prepare a SuperSAGE library, we collected two to three spadices of skunk cabbage at each developmental stage from natural marshland after measuring spadix (Ts) and ambient (Ta) temperature; details on the samples are given in Supporting Information Table S1. SuperSAGE library construction was performed as described by Matsumura et al. (2003) with minor modifications. Briefly, 5 mg mRNA was purified from total RNA with an mRNA Purification Kit (Illustra mRNA purification kit, GE, Little Chalfont, Buckinghamshire, UK). The mRNA was subsequently used for double stranded cDNA synthesis (SuperScript Double-Stranded cDNA Synthesis Kit, Invitrogen, Carlsbad, CA, USA) using a biotinylated oligo(dT) primer, followed by digestion with NlaIII (New England Biolabs, Inc., Beverly, MA, USA). The 3′-end fragments of the cDNA were bound to streptavidin-coated magnetic beads (Promega, Madison, WI, USA) and purified. FITC-labelled linkers, harbouring a recognition site for EcoP15I endonuclease, were ligated to the cDNA. SuperSAGE tags adjacent to the linkers were then released by EcoP15I (New England Biolabs) digestion. This type III restriction enzyme recognizes the asymmetric hexameric sequence 5′-CAGCAG-3′ and cleaves the DNA 27 bp downstream of the recognition site leaving a 5′ overhang of 2 bp. Two pools of linker tags were blunt ended by filling in with KOD DNA polymerase (Toyobo, Osaka, Japan) and randomly ligated to each other. To amplify the resulting ditags, PCR with ExTaq DNA polymerase (TaKaRa, Kyoto, Japan) was performed using biotinylated linkerspecific primers. Ditags were purified and analysed using a 454 GS-20 (454 Life Sciences, Branford, CT, USA). The DNA sequences of SuperSAGE tags were analysed with 454 pipe. The sequences of the linkers and PCR primers are listed in Supporting Information Table S2.

Data analysis of gene expression across multiple SuperSAGE libraries To compare the expression tag numbers of the inflorescences of the different developmental stages, tag numbers in each developmental stage were normalized by calculating

© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 35, 554–566

556 Y. Ito-Inaba et al.

Total number of tags

Number of unique tagsa (%)

Number of nonsingleton tagsb (%)

Stage

ID

Immature

a

54664

28544 (52.2)

6989 (12.8)

Female

b c

46408 24860

22886 (49.3) 13468 (54.2)

5819 (12.5) 3149 (12.7)

Bisexual

d e

112350 51384

46720 (41.6) 24347 (47.4)

13062 (11.6) 6385 (12.4)

Male

f g h

18830 56726 38300

10825 (57.5) 26672 (47.0) 19681 (51.4)

2333 (12.4) 6710 (11.8) 4265 (11.1)

50440

24143 (49.9)

6089 (12.2)

Average

Table 1. SuperSAGE libraries for different developmental stages of inflorescences

a

Numbers in parenthesis represent the ratio of the number of unique tags to the total number of tags. b Numbers in parenthesis represent the ratio of the number of non-singleton tags to the total number of tags.

the normalized tag numbers (Nn) in each developmental stage:

Nn = No Nt × 50 000 where No and Nt are the observed tag numbers and total tag numbers in each developmental stage, respectively; 50 000 is nearly identical to the average number of tags in libraries. For clustering analysis of SuperSAGE transcription profiles, the normalized expression tag numbers in each developmental stage were submitted to a Poisson Approach as described by Huang, Cai & Wong (2008).

Construction of cDNA libraries and database cDNA libraries were constructed with a cDNA Library Construction Kit (TaKaRa). Briefly, 5 mg mRNA was purified from the total RNA isolated from female-stage spadices using the illustraTM mRNA Purification Kit (GE). The mRNA was used for double-stranded cDNA synthesis using an oligo(dT) anchor primer, followed by addition of EcoRI adaptors on both sides of the cDNA. The cDNA was digested with NotI, and ligated into pBluescript II SK(+) digested by EcoRI and NotI. The plasmids were introduced into Escherichia coli DH10B which then was cultured. A cDNA database was constructed by analysis of cDNA sequences from ~1500 independent clones, which then were analysed using BLAST.

Tag-to-gene assignment Each 26 bp tag was annotated based on our cDNA database using the BioEdit program (http://www.mbio.ncsu.edu/ BioEdit/bioedit.html). The SuperSAGE and cDNA data discussed in this publication have been deposited in NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/ geo) with accession number GSE29852, and DDBJ (http:// www.ddbj.nig.ac.jp/index-e.html) with accession number FY780693-782537, respectively.

RNA in situ hybridization Both antisense and sense probes were synthesized using a T3/T7 digoxigenin RNA labeling kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Following in situ hybridization was performed according to Suwabe et al. (2008) by using Hybrimaster HS-300 (ALOKA, Tokyo, Japan). The tissue sections were observed under a light microscope (Eclipse E800 microscope system, Nikon, Tokyo, Japan).

RT-PCR analysis for studying tissue specificity of gene expression RNA was prepared from petals, pistils, stamens and the pith (outer, middle and inner layer) using the RNeasy Mini Kit (Qiagen). First-strand cDNAs were generated with the PrimeScript RT reagent Kit (TaKaRa) using oligo(dT) primers and random hexamers. RT-PCR was performed with the gene-specific primers described in Supporting Information Table S3.

RESULTS Construction of SuperSAGE Libraries and their clustering analysis We constructed SuperSAGE libraries according to the literature (Matsumura et al. 2008b); the ‘SuperSAGE tags’ generated were sequenced as summarized in Table 1. An average of 50 440 SuperSAGE tags was obtained from each sample. Among them, the number of different tags corresponding to different genes was 24 143, and 6089 tags were retrieved at least twice. In each developmental stage, the number of unique tags was around 50% of the total tag count, and the proportion of non-singleton tags was around 10%. The gene expression profiles obtained were subjected to cluster analysis to identify candidate sets of co-regulated genes that are directly or indirectly associated with the



expression peak at the female stage (Fig. 2b). Likewise, group I consisted of immature-stage specific genes (cluster 7); group III consisted of bisexual-stage specific genes (clusters 2, 3 and 14); and group IV consisted of male-stage specific genes (clusters 1, 5, 10, 12 and 13). Group V, composed of clusters 4, 6 and 15, did not show developmental stage-specific expression. Among the total of 3266 tags, 246, 979, 542 and 1005 tags were mainly expressed in immature, female, bisexual and male stages, respectively, while the remaining 494 tags did not show developmental specificity (Table 2). The genes classified as non-specific appear unlikely to play a role in thermogenesis or inflorescence development as their expression was not associated with the transitions of spadix development. Overall, the clustering analysis suggested that the expression of numerous genes was correlated with developmental stage and floral thermogenesis.

(a) 40

Percentage

C8 C9 C11 C16

C7

30

C4 C6 C15

C1 C5 C10 C12 C13

C2 C3 C14

20 10 0

ab c de f gh

ab c de f gh

ab c de f gh

ab c de f gh

ab c de f gh

ab cde f g h

a bcde f g h

a bcde f gh

a bcde f g h

a bc de f gh

(I)

(II)

(III)

(IV)

(V)

(b) Averaged percentage

557

40 30 20 10 0

Distribution pattern Figure 2. Distribution of clusters across developmental stages.

Identification of genes expressed in spadices using a cDNA library

(a) Clusters abundantly expressed in the immature (a), female (b,c), bisexual (d,e) and male (f,g,h) stages were classified into groups (I), (II), (III) and (IV), respectively. The remaining clusters were unrelated to the developmental stage and were classified into group (V). (b) The means of the clusters combined into a group are given as the averaged percentage (%). Lowercase letters (a–h) on the horizontal axis correspond to the sample ID in Table 1.

Given the result of the clustering analysis, we initially attempted to annotate SuperSAGE tags using BLAST searches. However, due to the lack of large-scale cDNA datasets of thermogenic skunk cabbage or closely related species, the length of SuperSAGE tags is insufficient to identify the origin of each tag. Therefore, we constructed a cDNA library of the female-stage spadix of thermogenic skunk cabbage and sequenced ~1500 independent clones. This allowed us to identify the origin of numerous SuperSAGE tags (Table 2). Of 979 unique SuperSAGE tags abundantly expressed at the female stage, 186 tags showed homology to cDNA sequences. As some cDNAs contained sequences that matched several SuperSAGE tags at discrete sites, 129 independent cDNA clones containing tag sequences were identified by eliminating the redundancy. Although the cDNA library was constructed using femalestage spadices, SuperSAGE tags obtained from other developmental stages also matched some sequences in the cDNA dataset. Among the cDNAs we sequenced, 357 independent cDNA clones that contained SuperSAGE tags were identified.

process of our interest (Cai et al. 2004; Huang et al. 2008). We obtained the normalized number of each tag in each sample based on the equation shown in Materials and methods. Then, we extracted 3266 tags that appeared at least 16 times in normalized samples (on average, at least twice in each normalized sample) and these tags were analysed by a Poisson Approach as described previously (Huang et al. 2008). According to this analysis, the gene expression profile of SuperSAGE tags could be classified into 16 clusters (Supporting Information Fig. S1). Subsequently, each cluster was manually assigned to one of five groups based on the expression pattern (Fig. 2). For instance, group II (Fig. 2a), composed of clusters 8, 9, 11 and 16, was qualified as a group of female-stage specific genes, as the average of these four clusters showed a major

Distribution patterna

Number of tags clustered into each group Number of tags that match cDNA clones Number of independent cDNA clonesb

Immature

Female

Bisexual

Male

Others

Total

246

979

542

1005

494

3266

22

186

73

125

122

528

14

129

51

74

89

357

a

Distribution patterns were classified as shown in Fig. 2. The number of independent cDNA clones was determined by eliminating redundancy.

b


Table 2. Annotation of SuperSAGE tags derived from the S. renifolius cDNA database


(b)

Cellular component (%)

100

Mitochondria Chloroplast and plastid Membranes Nucleus Cytosol

50

Extracellular Cell wall Ribosome ER Others Unknown

0 Female

100

Biological process (%)

(a)

Electron transport or energy pathways Protein metabolism Developmental processes Transport Cell organization and biogenesis Transcription Signal transduction DNA or RNA metabolism Response to various stresses Others Unknown

50

0 Female

Male

Male

Figure 3. Classification of 129 genes highly expressed in female-stage and 74 genes highly expressed in male-stage spadices. The tags were classified based on the GO annotation, which assigns cellular components (a) and biological processes (b) to a sequence. Each gene was weighted with the count of corresponding SuperSAGE tags to account for the varying expression levels.

Classification of genes expressed in the spadix based on Gene Ontology terms To further assess the function of each gene in the cellular processes associated with thermogenesis of skunk cabbage, we classified the identified genes based on Gene Ontology (GO) terms. For this purpose, AGI codes of Arabidopsis orthologs corresponding to the 357 independent cDNA sequences of skunk cabbage were obtained from The Arabidopsis Information Resource 7 gene annotation database (http://www.arabidopsis.org/index.jsp). This analysis allowed us to predict the localization and function of the skunk cabbage orthologs. We also incorporated the gene expression profile obtained from SuperSAGE into this analysis. Each gene was weighted according to the count of corresponding SuperSAGE tags, thereby reflecting the expression level of each gene. This multiplication was critical as the small number of highly expressed genes was likely to be more important than the large number of genes with lower expression level. Based on this method, the percentage of transcripts assigned to specific cellular components or biological processes was established (Fig. 3). We compared the transcript profiles between female and male spadices (Fig. 3). It was of particular interest that genes encoding mitochondrial proteins were active in female spadices but not in male spadices (Fig. 3a). In addition, the activity of genes related to electron transport or energy pathways decreased significantly during the transition from the female to the male stage (Fig. 3b). These results suggest that mitochondrial function and/or cellular respiration play a key role in floral thermogenesis. This is consistent with our previous observation that the thermogenic female spadix accumulates a large number of mitochondria and has an increased oxygen consumption rate (Ito-Inaba et al. 2009a). In male spadices, the activity of genes to which no protein localization could be assigned was significantly increased (Fig. 3a). Notably, genes classified as stress responsive were highly expressed in male spadices (Fig. 3b). In-depth analysis revealed that the

expression of a gene encoding a cysteine protease (skunk cabbage ortholog of At1g47128) yielded the most abundant transcript. This type of cysteine protease is localized in the vacuole, according to previous proteomic analyses in Arabidopsis (Carter et al. 2004; Shimaoka et al. 2004), and is involved in various processes including digestion and posttranslational modification of storage proteins, antibiotic responses and programmed cell death (Kiyosaki et al. 2009). As our previous observation indicated that vacuoles develop during the female–male transition (Ito-Inaba et al. 2009a), the high expression level of the cysteine protease gene may be correlated with the vacuolar development in male-stage spadices. Taken together, the expression profiles of SuperSAGE tags are consistent with previous observations of inflorescence development in skunk cabbage.

In-depth analysis of genes highly expressed in female-stage spadices According to physiological studies, thermogenesis is positively correlated to oxygen consumption rate (Seymour & Blaylock 1999; Seymour & Schultze-Motel 1999; Seymour, Gibernau & Ito 2003a; Seymour, White & Gibernau 2003b; Seymour & Gibernau 2008). We investigated genes encoding proteins supposedly localized in mitochondria or functioning in the respiratory pathway in more detail. Thirty-one genes were confirmed to be associated with respiratory or mitochondrial function (Table 3). These 31 genes represented 24% of the 129 highly expressed genes in the female-stage spadix, indicating that transcripts of genes involved in respiration and mitochondrial function are overrepresented in female-stage spadix cells. Among the 31 genes, 21 genes are known to be involved in cellular respiration which can be divided into four processes: glycolysis, the tricarboxylic acid (TCA) cycle, the pentose phosphate pathway and the respiratory chain (Table 3 and Supporting Information Fig. S2). High expression levels of these genes may be required for the massive oxygen consumption rate observed in thermogenic female spadices. The remaining 10


© 2011 Blackwell Publishing Ltd, Plant, Cell and Environment, 35, 554–566 7 12 10

AtPUMP5 ATP/ADP carrier Oxoglutarate/malate translocator

5 9 1 2 1

10 3 5 3 1 0

Hypothetical protein 1 RC complex III RC complex I Cytochrome C2 RC complex I Mitochondrial ATP synthase

Hypothetical protein 2 Mt large ribosomal subunit Glycine dehydrogenase Oxidoreductase NFU4

5 5

Glucose-6-phosphate dehydrogenase Ribulose-phosphate 3-epimerase

5 6

19 33 9 10 7 5

Citrate synthase Aconitase Malate dehydrogenase Malic enzyme 2-Oxoglutarate dehydrogenase Dihydrolipoamide succinyltransferase

Voltage-dependent anion channel Outer membrane protein porin

11 38 20 7 20 3 4

a

Glyceraldehyde-3-phosphate dehydrogenase Enolase Phosphoglycerate kinase Triose phosphate isomerase Phosphoenolpyruvate carboxylase Fructose-bisphosphate aldolase Hexokinase

Gene/encoded proteinb

16 13 5 4 0

13 3

8 25 16

36 23 8 4 4 6

9 4

25 32 12 10 9 11

159 48 55 26 17 2 3

b

20 2 6 4 8

6 16

40 26 18

38 10 14 6 4 2

28 12

34 14 42 18 2 0

159 93 6 12 6 12 2

c

5 4 3 1 1

4 4

12 16 6

22 13 6 4 3 1

16 5

27 23 16 11 2 0

90 49 16 2 4 5 3

d

4 6 1 0 2

7 2

9 15 5

14 8 7 0 1 3

10 3

29 19 18 9 2 3

111 26 29 16 3 3 3

e

13 3 0 3 3

3 5

13 3 5

8 5 0 0 0 3

0 3

13 13 24 5 5 0

114 19 11 3 3 5 3

f

3 3 2 4 3

5 2

11 5 4

27 4 2 0 3 2

19 7

28 20 16 17 4 3

78 48 13 0 5 3 1

g

0 1 3 1 1

1 4

5 0 0

10 1 1 1 0 1

7 4

13 9 7 4 1 4

52 21 8 0 5 3 1

h

8E-13 3E-94 6E-80 3E-11 1E-108

2E-58 1E-120

1E-19 4E-56 1E-131

3E-26 0.005 1E-109 2E-66 4E-63 9E-40

3E-32 1E-120

7E-33 1E-124 1E-149 3E-90 1E-108 9E-41

1E-152 1E-177 1E-148 1E-125 9E-66 1E-101 7E-94

AT5G43150 ATMG00020 AT2G35120 AT3G45770 AT3G20970

AT5G15090 AT5G67500

AT2G22500 AT5G13490 AT5G19760

AT1G67785 AT4G32470 AT1G16700 AT4G10040 AT5G37510 AT4G29480

AT5G40760 AT1G63290


AT3G04120 AT2G36530 AT1G79550 AT3G55440 AT2G42600 AT2G36460 AT4G29130

E-valued AGI codee

Mitochondria Mitochondria Mitochondria Mitochondria, chloroplast, nucleus Mitochondria

Mitochondrial inner membrane Mitochondrial inner membrane Mitochondrial inner membrane, chloroplast envelope Mitochondrial outer membrane Mitochondrial outer membrane

Mitochondrial inner membrane Mitochondrial inner membrane Mitochondrial inner membrane Mitochondrial inner membrane Mitochondrial inner membrane Mitochondrial inner membrane

Cytosol, plastid Cytosol, plastid

Mitochondrial matrix Mitochondrial matrix Mitochondrial matrix Mitochondrial matrix Mitochondrial matrix Mitochondrial matrix

Cytosol Cytosol Cytosol Cytosol Cytosol Cytosol Cytosol

Localizationf

b

SAGE tag is a 26 bp sequence downstream of the NlaIII site (CATG). Putative homologous gene product of the cDNA clones containing the SuperSAGE tag. Homology searches were performed using TBLASTX. The best homology with highest identity score found in each search is shown. However, if the homologous gene with highest score is unknown or corresponds to a hypothetical protein, an alternative high-scoring gene may be shown. c Number of tags in the SuperSAGE libraries. Lowercase letters (a–h) correspond to the sample ID of Table 1. d E-value (expected value) reported by TBLASTX. e AGI (Arabidopsis Genome Initiative) codes for each cDNA sequence were determined using the TAIR (The Arabidopsis Information Resource) website. f Cellular localization of homologous genes.

a

CATGCCTGTAAAAAATAATTCTGGAT CATGGGGCTGAGTCATAGGGTTAGGG Others CATGTTCAGCTGGGCGGCGGCCCGAG CATGCTGTGGGAGATATTCCTGGAGT CATGGGTCTCTGTGAAACAGTTTTAG CATGATCCCATAGATTTGCAGTGTAG CATGCATTATATACCAGAGGTGAGAG

Glycolysis CATGCCATATGATGCTATTCTTGTAG CATGCCGATCAGAACGTCTCGCCAAA CATGATGATGTTTTCCCCTCGCGCCT CATGTTAAGCTTATCTTATGAATAAA CATGCATCTGAAGATTTTTCTTCAAA CATGGGCAGGAAAGGAGGGGAATGTC CATGCGAGTAGCCTATATAGAGTAAT TCA cycle CATGCATATGATTTGTTTCACTCAGA CATGTGGTTAGCATCGGGCAACTGCA CATGGCTGTTGGTTGCAGCCTCCTAG CATGTCAAAGGGGAGGTGTTTGTTAC CATGAGAAAACAGAGGAATAAACTTA CATGTCTGGTTTTGTTAAAGCTGCTG Pentose-phosphate cycle CATGTAATGCAATTTCTGTGAGAATA CATGACAGTAGAACCTGGTTTTGGGG Respiratory chain CATGATCAATAGTCATTGAACTCTGT CATGATTATAATTTTGTATCCTTCCG CATGCCCCGTCGACGCCATTGTTGAA CATGGGAAGAGCCAACTTTGTATGAT CATGAGCTTGGATACTTTTATAAGTT CATGCCTATAGTTGTATTTGTTATAA Carrier or channel CATGATGATGCCGAAAGAAGAAGAAA CATGGAGTCGGTCTTTTGATGAGTTG CATGGATATTCTTGAACCAGATCCAG

Tag sequence (5′→ 3′)a

Countsc

Table 3. SuperSAGE tags and corresponding putative genes related to respiratory or mitochondrial function with high expression levels in female-stage spadices

Gene expression landscape in skunk cabbage 559

560

Y. Ito-Inaba et al.

genes encode mitochondrial membrane proteins or proteins of unknown function. An orthologous sequence of AtPUMP5 (UCP) was found in mitochondrial membrane proteins, although this UCP gene shows only 36.6% similarity with SrUCPA we studied previously (Ito-Inaba et al. 2008a,b, 2009b). AOX genes were not found in this group.

Comparative analysis of gene expression in S. renifolius and Arabidopsis thaliana The comparison of gene expression profile between thermogenic and non-thermogenic plants is important to understand the molecular mechanism underlying plant thermogenesis. We hypothesized that the expression levels of orthologous genes in Arabidopsis flowers would not as be high as in the skunk cabbage spadix, if the genes actually were involved in floral thermogenesis. Using the quantitative gene expression profile of Arabidopsis inflorescences obtained by Massively Parallel Signature Sequencing (MPSS) (Brenner et al. 2000; Meyers et al. 2004a,b) (http:// mpss.udel.edu/at/mpss_index.php), we compared the expression levels of the 31 genes identified in Table 3 between Arabidopsis inflorescences and female-stage spadices of skunk cabbage (Table 4). We first picked up the optimal MPSS signature based on the position and strand relative to the annotated genes (Supporting Information Table S4). We also calculated the normalized transcript abundance of each gene in the female spadix of skunk cabbage [tag count per one million transcripts, referred to as ‘transcripts per million (TPM)’]. We then compared the TPM of each transcript between the female-stage spadix of skunk cabbage and the inflorescence of Arabidopsis; the expression ratio was calculated as Sr/At (Table 4). Among the 31 genes compared, more than 70% (22 genes; ++ and + in Table 4) were expressed more strongly in skunk cabbage. The Sr/At ratios of most of the other nine genes were higher than 0.5, and significant under-representation was only observed for three of them. Taken together, these results indicated that transcripts associated with respiratory and mitochondrial functions were overrepresented in thermogenic spadices, suggesting that their abundant expression may control floral thermogenesis in skunk cabbage.

In-depth analysis of genes highly expressed in male-stage spadices Cellular component analysis also suggested that the proportion of transcripts corresponding to proteins of unknown cellular localization was higher in male-stage than in female-stage spadices (Fig. 3a). It also appeared that transcripts associated with stress responses were significantly increased in male-stage spadices (Fig. 3b). We investigated the nature of these transcripts and their possible involvement in the loss of thermogenic ability in more detail; annotations of these genes are listed in Table 5. Transcripts encoding a member of a family of cysteine proteases

that have been shown to localize to the vacuole (Carter et al. 2004; Shimaoka et al. 2004) were highly abundant in male-stage spadices. Therefore, it is plausible that the development of vacuoles in the cells and the subsequent loss of thermogenesis are associated with the expression of cysteine protease genes. Components of the ubiquitin proteasome pathway were also up-regulated in male-stage spadices (Table 5). Other genes involved in protein degradation were abundant in the bisexual stage and continued to be expressed in the male stage (Supporting Information Table S5). Moreover, the expression of genes involved in stress responses was significantly increased. As skunk cabbage flowers early in spring, inflorescences are most likely to encounter low temperature stress at the post-thermogenic male stage. The expression of stressrelated genes may mitigate temperature stress, thereby keeping pollen grains viable. Taken together, these results suggested that protein degradation and stress response pathways became activated when spadices entered the male stage.

Tissue-specific mRNA expression We selected several female stage-specific genes involved in respiration and mitochondrial functions, to examine whether their expression was tissue specific. Total RNAs were extracted from petal, pistil, stamen, and the outer, middle, and inner layers of the spadix pith. To optimize the sensitivity of RT-PCR, we decreased the amount of template cDNA used compared with our previous procedure (Ito-Inaba et al. 2009a). These preliminary tests showed that the expression of SrUCPA was higher in stamens and outer and middle layers of the pith than in other parts of the inflorescence (Supporting Information Fig. S3), which was consistent with the in situ hybridization analysis of the SrUCPA gene (Supporting Information Fig. S4). In general, expression of female-specific genes seemed increased in florets (petal, pistil and stamen) and in the outer layers of the pith, although expression patterns varied between genes (Supporting Information Fig. S3). Because previous studies had suggested that cells in the pith possessed low densities of mitochondria and developed vacuoles in the female stage, the high expression of these transcripts in the outer pith layer was somewhat unexpected (Ito-Inaba et al. 2009a). The subdivision of the pith into outer, middle and inner portions enabled us to detect the previously overlooked involvement of the outer pith in floral thermogenesis. We concluded that the active transcription of these genes in the periphery of the spadix during the female stage may be required for floral thermogenesis. It is worth noting that AOX expression was observed in peripheral spadix tissues as well (Supporting Information Fig. S3). We also examined the tissue specificity of cysteine protease, as the expression of this gene increased significantly during the post-thermogenic stage. The expression of cysteine protease was relatively low in stamens, but was high even in the centre of the spadix (Supporting Information Fig. S3). This was in



Norm abundance (TPM)a

(a) Glycolysis Glyceraldehyde-3-phosphate dehydrogenase Enolase Phosphoglycerate kinase Triose phosphate isomerase Phosphoenolpyruvate carboxylase Fructose-bisphosphate aldolase Hexokinase (b) TCA cycle Citrate synthase Aconitase Malate dehydrogenase Malic enzyme 2-Oxoglutarate dehydrogenase Dehydrolipoamide succinyltransferase (c) Pentose-phosphate cycle Glucose-6-phosphate dehydrogenase Ribulose-phosphate 3-epimerase (d) Respiratory chain Hypothetical protein 1 RC complex III RC complex I Cytochrome C2 RC complex I Mitochondrial ATP synthase (e) Carrier or channel AtPUMP5 ATP/ADP carrier Oxoglutarate/malate translocator Voltage-dependent anion channel Outer membrane protein porin (f) Others Hypothetical protein 2 Mt large ribosomal subunit Glycine dehydrogenase Oxidoreductase NFU4

Sr/Atb

Sr

At

3183

2051

1410 610 379 233 142 52

44 945 874 168 3 80

32 0.65 0.43 1.4 47 0.65

(+ +) (-) (-) (+) (+ +) (-)

590 464 541 278 106 108

45 105 310 363 160 6

13 4.4 1.7 0.77 0.66 18

(+ +) (+) (+) (-) (-) (+ +)

660 169

0 9

738 449 216 164 124 85

146 0 108 16 392 101

5.1 2.0 10.25 0.32 0.84

(+) (+ +) (+) (+ +) (-) (-)

478 509 343 190 193

0 77 386 42 107

6.6 0.89 4.5 1.8

(+ +) (+) (-) (+) (+)

363 180 114 124 80

0 376 32 40 77

0.48 3.6 3.1 1.0

(+ +) (-) (+) (+) (+)

561

Table 4. Comparison of the normalized values which reflect gene expression levels in inflorescences in S. renifolius (Sr) and A. thaliana (At)

1.6 (+)

- (+ +) 18 (+ +)

a

Norm abundance (normalized abundance) is the raw abundance count divided by the total number of signatures in the library, multiplied by 106 to obtain a ‘transcripts per million’ value. In S. renifolius, the values are estimated by the mean of the normalized numbers of the SuperSAGE tags retrieved from the distinct two female-stage spadices. In A. thaliana, the values are picked up from the INS libraries in the Arabidopsis MPSS plus database. b Numbers of the normalized abundance in S. renifolius are divided by those in A. thaliana. If the numbers are higher than 1 and 10, they are marked by (+) and (+ +), respectively. In contrast, they are marked by (-), if they are lower than 1.

contrast to the expression of representative genes of the female stage. Taken together, female-specific genes involved in respiration and mitochondrial functions are expressed in the spadix periphery during the thermogenic female stage, suggesting possible roles of their expression in thermogenesis.

DISCUSSION Thermogenic characteristics of several plants including skunk cabbage have been studied in detail (Skubatz et al.

1990, 1991; Bermadinger-Stabentheiner & Stabentheiner 1995; Seymour & Blaylock 1999; Barabe, Gibernau & Forest 2002; Albre, Quikichini & Gibernau 2003; Seymour et al. 2003a; Seymour & Gibernau 2008). Nonetheless, comprehensive gene expression profiles associated with thermogenesis in plants have not been reported yet.This study provides a gene expression landscape associated with floral thermogenesis for the first time. Gene ontology analysis showed that transcripts encoding proteins localized in mitochondria significantly decreased during the transition from the female to the male stage (Fig. 3). In-depth analysis of 129 genes highly


All footnotes (a–e) are the same as in Table 3.

Protein degradation CATGCTCTCCCTAAGTTTGTATGCCT CATGAACCTATGTGTTCGTCTTATTA CATGTGTGGGATCGCAATGTACCCCT CATGTCCACCCTTTGTTTCACAATGA CATGAATGAGATCTCCTGAATTAAAT CATGTAACTGTGTGATGTTGTAGATT Stress response CATGTGTCTTGGATAACATTCCAGTT CATGGTTGCTCTCTCGATAATAATAA CATGAATTCTACTTCTTTCTCGTCCG CATGGAGCTGGATGAGTGCGAAGAGA CATGTGGGGTGTTCTTCTGTGTAGTA CATGTAACTGAGTTTAGATGCACATT CATGGATTATTTTCCCCCGGTTATCT CATGCTTCTTGCCCTGGTTGGGCAGG CATGTGGATTTGGTCATCCTACTGAA CATGAGTTTTTATTTTGTTTCGTCGA CATGAATTGTATATATGTGTTAGAAT Vacuolar metabolism CATGAGGGAGGCAGAACGAAGGAAGA

Tag sequence (5′→ 3′)a

Protein disulfide isomerase

Glycine-rich RNA binding protein Antifungal chitin-binding protein RARE-cold-inducible 2B Co-chaperon DNAJ protein MINI ZINC FINGER 1 NAD-dependent malate dehydrogenase activity Synaptotagmin Annexin gene family BAK1-interacting receptor-like kinase Translationaly controlled tumor protein EF hand calcium-binding protein

Cysteine proteinase Cysteine proteinase Cysteine proteinase UBC35 / UBC13A Ubiquitin-like modifier (SUMO) polypeptide 26S proteasome regulatory protein subunit

Gene/encoded proteinb

1

38 3 6 4 3 7 3 2 1 2 1

144 6 4 0 5 2

a

1

30 0 8 1 1 3 2 3 1 1 1

311 5 0 5 2 4

b

Countsc

2

32 0 4 14 0 6 4 4 4 0 2

416 8 0 8 4 4

c

3

32 3 17 12 8 7 3 5 4 3 1

171 16 0 5 5 1

d

4

40 15 8 0 0 4 5 2 5 3 3

354 14 0 5 3 3

e

0

66 8 24 5 24 3 8 8 5 3 8

964 11 0 8 5 5

f

7

48 3 16 11 6 9 11 6 5 5 1

1478 27 2 8 9 5

g

3

20 162 10 3 0 1 4 3 1 5 0

2684 17 70 1 1 1

h

2E-53

4E-42 6E-56 6E-14 6E-46 7E-13 3E-49 1E-106 5E-66 6E-92 5E-17 8E-16

8E-50 1E-40 1E-15 9E-22 6E-29 2E-74

E-valued

AT1G21750

AT2G21660 AT3G04720 AT3G05890 AT3G44110 AT1G74660 AT3G47520 AT2G20990 AT1G35720 AT5G48380 AT3G16640 AT1G24620


AGI codee

Table 5. SuperSAGE tags and the corresponding putative genes related to protein degradation, stress response, and vacuolar metabolism with high expression levels in male-stage

spadices



Gene expression landscape in skunk cabbage Symplocarpus renifolius genome Transcriptional regulation

mRNA Mitochondrial biogenesis

Large central vacuole

Respiration

Respiratory components, carrier proteins etc.

Glycolysis, PenPi cycle, TCA, RC, AOX, UCP, etc.

Stress response

Protein degradation

Stress-inducible genes, SOD, etc

Numerous mitochondria

Cysteine protease, ubiquitinproteasome system, etc

Senescence, programmed cell death

Up-regulation of basal metabolism Thermogenesis

Post-thermogenesis

Temperature (ºC)

Stamen development, pollen maturation

Female

Bisexual

Anther dehiscence, pollen release

Male

Ts Ta

Floral development (days)

Figure 4. Hypothetical model of the regulation of floral thermogenesis. Genes highly expressed in female-stage spadices may play roles in mitochondrial biogenesis and respiration, leading to the up-regulation of basal metabolism. At this developmental stage, cells possess increased numbers of mitochondria. On the other hand, genes highly expressed in the bisexual and male stages when the number of mitochondria is reduced and vacuoles form, may promote vacuolar development, stress responses and protein degradation, leading to senescence and programmed cell death. The expressions of genes involved in these cellular processes are regulated at the transcriptional level. During the thermogenic stage, stamens develop and pollen grains mature. At this stage, the spadix can keep its temperature at around 20 °C for 1–2 weeks. When anther dehiscence and pollen release have occurred, thermogenesis becomes unstable and finally undetectable. Ts and Ta represent typical changes in spadix and air temperature, respectively.

expressed in female-stage spadices revealed that 31 gene products were associated with respiration and mitochondrial functions (Table 3).The expression levels of more than 70% of these genes were higher in inflorescences of S. renifolius than in those of A. thaliana (Table 4). On the other hand, transcripts encoding proteins related to protein degradation, stress responses and vacuolar development significantly increased during the transition from the female to the male stage (Fig. 3 and Table 5).Analysis of 51 and 74 genes highly expressed in bisexual-stage and male-stage spadices, respectively, indicated that 26 gene products were related to cellular functions observed in post-thermogenesis (Table 5 and Supporting Information Table S5). Thus, unique gene expression patterns are associated with the regulation of floral thermogenesis. Thermogenesis of skunk cabbage may be explained by two possible processes (Fig. 4). On one hand, there appears

563

to exist short-term physiological mechanisms which depend on increased cellular respiration. On the other hand, longterm effects of mitochondrial biogenesis on the number and structure of mitochondria probably are involved.According to our analysis, 21 genes involved in cellular respiration were highly expressed in the thermogenic female stage, and the expression levels of most of these genes in female-stage spadices were higher than those of orthologous genes in Arabidopsis inflorescences. Therefore, it is conceivable that proteins encoded by these genes accumulate significantly in female-stage spadices, thereby promoting cellular respiration and the ability to produce heat. Carrier and channel proteins of mitochondrial membranes (Table 3) may also play a role in the maintenance of mitochondrial homeostasis. On the other hand, there are substantial differences in amounts of mitochondrial proteins per unit tissue weight between thermogenic and non-thermogenic plants (ItoInaba et al. 2009a,b). For example, mitochondrial yield from skunk cabbage spadices was 0.54 mg protein g-1 fresh weight (Ito-Inaba et al. 2009a), while the yield from Arabidopsis leaves was 0.024 mg protein g-1 fresh weight (Keech, Dizengremel & Gardestrom 2005). As most of the female stage-specific genes encoding mitochondrial proteins were expressed more strongly in skunk cabbage spadices than in Arabidopsis flowers (Table 4), the large number of mitochondria observed in skunk cabbage spadices may in part be attributable to the enhanced expression of mitochondrial proteins. We conclude that the expression of these genes may have short- as well as long-term effects on thermogenic activity. Large central vacuoles form in cells of spadices in the post-thermogenic stage (Ito-Inaba et al. 2009a). Vacuoles contain water, dissolved inorganic ions and a variety of secondary metabolites which often play roles in plant defence responses against various environmental stresses. In addition, vacuoles also contain degradative enzymes which leak out into the cytosol when the cell undergoes senescence. According to our transcriptome analysis, several transcripts encoding vacuolar proteins increased during the transition from the female- to the male-stage spadix (Fig. 3, Table 5 and Supporting Information Table S5). The expression level of a vacuolar cysteine protease (ortholog of Arabidopsis At1g47128) is high in the female stage and further increases in male-stage spadices (Table 5). This class of cysteine protease is involved in programmed cell death (Beyene, Foyer & Kunert 2006) and stress responses (Stevens et al. 1996) in other organisms. In addition, several stress-responsive genes and genes encoding degradative enzyme or ubiquitin-proteasome system components showed increased expression at the postthermogenic stage. The massive expression of vacuolar cysteine protease genes accompanies the increase of vacuolar volume. Subsequently, cysteine protease and other degradative enzymes leaked from the vacuole may degrade mitochondria, terminating thermogenesis at the male stage (Fig. 4). It is also possible that the expression of stress response genes accelerates senescence and programmed cell death. This hypothetical model is well consistent with


564 Y. Ito-Inaba et al. our previous electron microscopic observation that the amount of vacuoles in cells of petals and pistils increases during the transition from the female to male-stage spadix (Ito-Inaba et al. 2009a). In summary, our study suggests that spatiotemporal expression patterns of certain classes of genes in the spadix is associated with floral thermogenesis in skunk cabbage. Genes encoding enzymes involved in cellular respiration appear to increase respiration and metabolic activity during thermogenesis, while cysteine protease and other degradative enzymes accelerate senescence and terminate thermogenesis. Although interactions between mitochondria and vacuoles seem to play crucial roles in thermogenesis itself, the mechanism by which constant temperatures are maintained remains unclear. Given the fact that the difference between spadix and ambient temperatures is largest in the morning and decreases thereafter, fine-tuning mechanisms that adjust the level of thermogenic activity must be operating. Further analysis of floral thermogenesis in skunk cabbage should address this question and elucidate basic principles of floral thermogenesis.

ACKNOWLEDGMENTS We thank Ms Fumi Adachi (University of Miyazaki) for her technical support. We also thank Dr Tomohiro Kakizaki for discussion. This work was supported by Grants-in-Aid for Young Investigator (Nos. 20780070 and 20780236) and Challenging Exploratory Research (No. 23658094), the New Energy and Industrial Technology Development Organization (NEDO), Fumi Yamamura Memorial Foundation for Female Natural Scientists, the Program to Disseminate Tenure Tracking System from the Japanese Ministry of Education, Culture, Sports, Science and Technology, and a grant for Scientific Research on Priority Areas from the University of Miyazaki.

REFERENCES Albre J., Quikichini A. & Gibernau M. (2003) Pollination ecology of Arum Italicum (Araceae). Botanical Journal of the Linnean Society 141, 205–214. Barabe D., Gibernau M. & Forest F. (2002) Zonal thermogeneticdynamics of two species of Philodendron from two different subgenera (Araceae). Botanical Journal of the Linnean Society 139, 79–86. Bermadinger-Stabentheiner E. & Stabentheiner A. (1995) Dynamics of thermogenesis and structure of epidermal tissues in inflorescences of Arum maculatum. New Phytologist 131, 41–50. Beyene G., Foyer C.H. & Kunert K.J. (2006) Two new cysteine proteinases with specific expression patterns in mature and senescent tobacco (Nicotiana tabacum L.) leaves. Journal of Experimental Botany 57, 1431–1443. Borecky J., Nogueira F.T., de Oliveira K.A., Maia I.G., Vercesi A.E. & Arruda P. (2006) The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the gene families of uncoupling protein and alternative oxidase in monocots and dicots. Journal of Experimental Botany 57, 849–864.

Brenner S., Jounson M., Bridgham J., et al. (2000) Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays. Nature Biotechnology 18, 630– 634. Cai L., Huang H., Blackshaw S., Liu J.S., Cepko C. & Wong W.H. (2004) Clustering analysis of SAGE data using a Poisson approach. Genome Biology 5, R51. Carter C., Pan S., Zouhar J., Avila E.L., Girke T. & Raikhel N.V. (2004) The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. The Plant Cell 16, 3285–3303. Grant N., Onda Y., Kakizaki Y., Ito K., Watling J. & Robinson S. (2009) Two cys or not two cys? That is the question; alternative oxidase in the thermogenic plant sacred Lotus. Plant Physiology 150, 987–995. Grant N.M., Miller R.E., Watling J.R. & Robinson S.A. (2008) Synchronicity of thermogenic activity, alternative pathway respiratory flux, AOX protein content, and carbohydrates in receptacle tissues of sacred lotus during floral development. Journal of Experimental Botany 59, 705–714. Huang H., Cai L. & Wong W.H. (2008) Clustering analysis of SAGE transcription profiles using a Poisson approach. Methods in Molecular Biology 387, 185–198. Ito-Inaba Y., Hida Y., Ichikawa M., Kato Y. & Yamashita T. (2008a) Characterization of the plant uncoupling protein, SrUCPA, expressed in spadix mitochondria of the thermogenic skunk cabbage. Journal of Experimental Botany 59, 995– 1005. Ito-Inaba Y., Hida Y., Mori H. & Inaba T. (2008b) Molecular identity of uncoupling proteins in thermogenic skunk cabbage. Plant and Cell Physiology 49, 1911–1916. Ito-Inaba Y., Sato M., Masuko H., Hida Y., Toyooka K., Watanabe M. & Inaba T. (2009a) Developmental changes and organelle biogenesis in the reproductive organs of thermogenic skunk cabbage (Symplocarpus renifolius). Journal of Experimental Botany 60, 3909–3922. Ito-Inaba Y., Hida Y. & Inaba T. (2009b) What is critical for plant thermogenesis? Differences in mitochondrial activity and protein expression between thermogenic and non-thermogenic skunk cabbages. Planta 231, 121–130. Keech O., Dizengremel P. & Gardestrom P. (2005) Preparation of leaf mitochondria from Arabidopsis thaliana. Physiologia Plantarum 124, 403–409. Kiyosaki T., Asakura T., Matsumoto I., Tamura T., Terauchi K., Funaki J., Kuroda M., Misaka T. & Abe K. (2009) Wheat cysteine proteases triticain alpha, beta and gamma exhibit mutually distinct responses to gibberellin in germinating seeds. Journal of Plant Physiology 166, 101–106. Knutson R.M. (1974) Heat production and temperature regulation in eastern skunk cabbage. Science 186, 746–747. Lamarck J. (1778) Flore Francoise (Paris), vol. 3: pp. 537–539. Imprimerie royale. Matsumura H., Reich S., Ito A., Saitoh H., Kamoun S., Winter P., Kahl G., Reuter M., Kruger D.H. & Terauchi R. (2003) Gene expression analysis of plant host-pathogen interactions by SuperSAGE. Proceedings of the National Academy of Sciences of the United States of America 100, 15718–15723. Matsumura H., Kruger D.H., Kahl G. & Terauchi R. (2008a) SuperSAGE: a modern platform for genome-wide quantitative transcript profiling. Current Pharmaceutical Biotechnology 9, 368–374. Matsumura H., Reuter M., Kruger D.H., Winter P., Kahl G. & Terauchi R. (2008b) SuperSAGE. Methods in Molecular Biology 387, 55–70. Meyers B.C., Lee D.K., Vu T.H., Tej S.S., Edberg S.B., Matvienko M. & Tindell L.D. (2004a) Arabidopsis MPSS. An online resource


Gene expression landscape in skunk cabbage for quantitative expression analysis. Plant Physiology 135, 801– 813. Meyers B.C., Tej S.S., Vu T.H., Haudenschild C.D., Agrawal V., Edberg S.B., Ghazal H. & Decola S. (2004b) The use of MPSS for whole-genome transcriptional analysis in Arabidopsis. Genome Research 14, 1641–1653. Onda Y., Kato Y., Abe Y., et al. (2007) Pyruvate-sensitive AOX exists as a non-covalently associated dimer in the homeothermic spadix of the skunk cabbage, Symplocarpus renifolius. FEBS Letters 581, 5852–5858. Seymour R.S. (2001) Biophysics and physiology of temperature regulation in thermogenic flowers. Bioscience Reports 21, 223– 236. Seymour R.S. (2004) Dynamics and precision of thermoregulatory reponses of eastern skunk cabbage Symplocarpus foetidus. Plant, Cell & Environment 27, 1014–1022. Seymour R.S. & Blaylock A.J. (1999) Switching off the heater: influence of ambient temperature on thermoregulation by eastern skunk cabbage Symplocarpus foetidus. Journal of Experimental Botany 50, 1525–1532. Seymour R.S. & Schultze-Motel P. (1999) Respiration, temperature regulation and energitics of thermogenic inflorescences of the dragon lily Dracunculus vulgaris (Arceae). The Royal Society 266, 1975–1983. Seymour R.S. & Gibernau M. (2008) Respiration of thermogenic inflorescences of Philodendron melinonii: natural pattern and responses to experimental temperatures. Journal of Experimental Botany 59, 1353–1362. Seymour R.S., Gibernau M. & Ito K. (2003a) Thermogenesis and respiration of inflorescences of the dead horse arum Helicodiceros muscivorus, a pseudothermoregulatory aroid associated with fly pollination. Functional Ecology 17, 886–894. Seymour R.S., White C.R. & Gibernau M. (2003b) Environmental biology: heat reward for insect pollinators. Nature 426, 243– 244. Shimaoka T., Ohnishi M., Sazuka T., Mitsuhashi N., HaraNishimura I., Shimazaki K., Maeshima M., Yokota A., Tomizawa K. & Mimura T. (2004) Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. Plant and Cell Physiology 45, 672– 683. Skubatz H., Nelson T.A., Dong A.M., Meeuse B.J.D. & Bendich A.J. (1990) Infrared thermography of Arum lily inflorescences. Planta 182, 432–436. Skubatz H., Nelson T.A., Meeuse B.J. & Bendich A.J. (1991) Heat production in the Voodoo Lily (Sauromatum guttatum) as monitored by infrared thermography. Plant Physiology 95, 1084–1088. Stevens C., Titarenko E., Hargreaves J.A. & Gurr S.J. (1996) Defence-related gene activation during an incompatible interaction between Stagonospora (Septoria) nodorum and barley (Hordeum vulgare L.) coleoptile cells. Plant Molecular Biology 31, 741–749. Suwabe K., Suzuki G., Takahashi H., et al. (2008) Separated transcriptomes of male gametophyte and tapetum in rice: validity of a laser microdissection (LM) microarray. Plant and Cell Physiology 49, 1407–1416. Uemura S., Ohkawara K., Kudo G., Wada N. & Higashi S. (1993) Heat-production and cross-polination of the asian skunk cabbage Symplocarpus renifolius. American Journal of Botany 80, 635–640. Vanlerberghe G.C. & McIntosh L. (1997) ALTERNATIVE OXIDASE: from gene to function. Annual Reviews of Plant Physiology and Plant Molecular Biology 48, 703–734. Vercesi A.E., Borecky J., Maia Ide G., Arruda P., Cuccovia I.M. & Chaimovich H. (2006) Plant uncoupling mitochondrial proteins. Annual Review of Plant Biology 57, 383–404.

565

Zhu Y., Lu J., Wang J., Chen F., Leng F. & Li H. (2011) Regulation of thermogenesis in plants: the interaction of alternative oxidase and plant uncoupling mitochondrial protein. Journal of Integrative Plant Biology 53, 7–13. Received 21 July 2011; received in revised form 21 September 2011; accepted for publication 25 September 2011

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Figure S1. Clustering of SuperSAGE transcription profiles. The 3266 tags which had occurred in at least 16 normalized copies in all libraries were analysed by a Poisson Approach according to the method of Huang et al. (2008). These tags were classified into 16 clusters. Figure S2. Overview of respiration and the number of genes identified in this study. Respiratory reactions can be assigned to four major processes: glycolysis, the citric acid cycle, the pentose phosphate pathway and oxidative phospholylation through the respiratory chain. The numbers in parenthesis represent the number of genes identified in this study/the number of reactions in each pathway. For example, of three enzymes [Hexose phosphate isomerase, PPi-dependent phosphofructokinase, and Fructose-1, 6-bisphosphate Aldolase (FBA)] involved in the transformation of Hexose-P into Triose-P, one gene encoding FBA was identified in this study. Figure S3. Tissue-specific expression of genes related to respiratory and mitochondrial functions, and a gene encoding cysteine protease. mRNA expression of the genes in petal, pistil, stamen and the pith (outer, middle, and inner layer) was examined by RT-PCR. Gene expression of SrAOX and SrUCPA is also shown for comparison. Relative expression levels in each tissue are categorized as +++ (high), ++ (medium) or + (low). Figure S4. In situ localization of SrUCPA transcripts in female-stage spadices. DIG-labelled antisense RNA probes were hybridized on the cross section of the femalestage spadices (a). The gene encoding SrUCPA was specifically expressed in anther tissues (b) and the outer layer of the pith (c). (b) and (c) are magnified views of the boxes marked in (a). As a control, sense RNA probes were hybridized on the cross section of female-stage spadices (d). (e) and (f) are magnified views of the boxes marked in (d). In situ hybridization analysis was performed using HYBRIMASTER HS-300 (ALOKA) according to the manufacturer’s instructions. Pith was divided into three parts; outer layer (OLP), middle layer (MLP) and inner layer (ILP) of pith. Bar = 1000 mm (a,d), 100 mm (b,c,e,f). Table S1. Inflorescences sampled for SuperSAGE analysis. Table S2. Sequence of the primers and linkers used for SuperSAGE library construction. Table S3. Gene-specific primers used in RT-PCR.


566 Y. Ito-Inaba et al. Table S4. MPSS signatures retrieved from the Arabidopsis MPSS plus database. Table S5. SuperSAGE tags and the corresponding putative genes related to protein degradation, stress response, vacuolar metabolism and others with high expression levels in bisexual-stage spadices.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.
