The HBP-1 Family of Wheat BasicLeucine Zipper Proteins Interacts

THEJOURNAL OF BIOLOGICAL CHEMISTRY

Vol. 269,No. 13,Issue of April 1, pp. 9974-9985, 1994 Printed in U.S.A.

0 1994 by The American Society for Biochemistry and Molecular ’ Biology, Inc

The HBP-1 Family of Wheat BasicLeucine Zipper Proteins Interacts with Overlapping &-Acting Hexamer Motifs of Plant Histone Genes* (Received for publication, October 22, 1993, and in revised form, January 3, 1994)

Koji MikamiS, &ako SakamotoO, and Masaki IwabuchiM From the $Division of Developmental Biology, National Institute for Basic Biology, Okazaki 444, Japan andthe §Department of Botany, Faculty of Science, Kyoto University, Kyoto 606-01, Japan

The type I element (CCACGTCANCGATCCGCG) is a genes were classified into two groups, type I and I1 genes (4). cis-acting element that is essential for the transcrip- Promoters of the type I genes have the hexamer motif located 2 tional regulation of the wheat histone H3 (TH012)gene. base pairs upstream from the reverse-oriented octamer motif The sequence CCACGTCA in the type I element re- (GATCCGCG), whereas thoseof type I1 genes lack the hexamer sembles various plant regulatory elements that share an motif. For type I genes, it has been demonstrated that the ACGT core sequence, which can be recognized by differ- CCACGTCANCGATCCGCG sequence, designated as a type I ent basiclleucine zipper (bZIP) proteins. Here we de- element (Ref. 4; see Table I), plays an important role in S scribe theisolation and characterizationof wheat cDNA phase-specific transcription of the wheat histone H3 (TH012) clones encoding three novel bZIP proteins, designated gene (81.’ It is assumed, therefore, that cell cycle-dependent HBP(histone promoter-binding protein)-la(l), HBP- transcription of type I genes may be regulated by the common la(c14), and HBP-lb(c1). These proteins specifically trans-acting factorb)that interacts withthe type I element via bind to theACGT core sequence and, together with previously identified HBP-la(l7) and HBP-lb(c38), consti- specific DNA binding. We have previously identified the DNAtute a proteinfamily, named the HBP-1 family.Based on binding proteins HBP(histone promoter-binding protein)2-la DNA binding speci- and HBP-lb, both of which are specific to the hexamer motif, their structural characteristics and ficities, members of the HBP-1 family can be grouped and the single strand DNA-binding proteins ssDBP-1 and ssthe lower and upper into HBP-la and HBP-lb subfamilies. The HBP-la iso- DBP-2, which specifically interact with forms are characterized by their N-terminal proline-rich strands, respectively,of a region containing the typeI element domain and a C-terminal bZIP domain, which binds to (9-11). HBP-la and HBP-lb exhibit distinct DNA binding properthe CCACGT motif. In contrast, the HBP-lb isoforms have a bZIP domain at the N terminus, which binds to ties: the former binds specifically to the hexamer motifof the the hexamer the ACGTCAmotif, and a glutamine-rich domain at theC H 3 promoter, whereas the latter binds to both H3 terminus. All members of both subfamilies interact with motif and a similar hexamer motif present in nuclear, viral, and the CCACGTCA sequence, but their DNA binding speci- T-DNA gene promoters (6, 10, 12). Previously, based ondifferficities and affinities differ. Since HBP-laisoforms form ences in DNA binding specificity, we isolated two distinct cDNA heterodimers in all pairwisecombinations, heterodimer clonesfrom a wheat cDNA library, using the Southwestern formation among these bZIP proteins may generate an method (13, 14). The proteins encoded by these cDNA clones, expanded repertoireof regulatory potential forgene ex- which were named HBP-la(l7) and HBP-lb(c381, contain a pression in plants. so-called “basicAeucine zipper (bZIP) domain.” The bZIP domain is characterizedby a basic amino acid-rich region, which has contacts with DNA, and a heptad leucine repeat, located Transcription of eukaryoticprotein-codinggenes is con- immediately C-terminal to the basic region, which is required trolled by several cis-acting elements in the regulatory regions, for protein dimerization(15). We also reported that bacterially which provide binding sites for sequence-specific transcription expressed HBP-la(l7) and HBP-lb(c38) bind to the hexamer factors (trans-acting factors) (1,2). We have sought to identify motif as homodimers, but not as heterodimers (13, 14). Morecis-acting elements and trans-acting factorsthat are essential over, HBP-la(l7) containsa proline-rich region at the N termifor the transcriptional regulationof plant histone genes(3-6). nus, which has been shown to act as an activation domain in of the cis-acting hexamer Arabidopsis GBFl(16) and human CTF/NF-1(17), whereas the Based on the presence or absence (ACGTCA) and octamer (CGCGGATC) motifs (71, plant histone C-terminal regionof HBP-lb(c38) is rich in glutamine residues, as reported forthe glutamine-rich region of tobacco TGAla (18) * This work was supported in part by Grants-in-Aid for Scientific and human Spl (19). Because GBFl and TGAla have been Research from the Ministry of Education, Science and Culture of Japan shown to functionas sequence-specific plant transcriptionfacand the Research Council of the Ministry of Agriculture, Forestry, and tors (20-22), HBP-la(l7) and HBP-lb(c38) are regarded as canFisheries of Japan for original and creative research projects on biodidates for plant transcription factors. technology. Thecosts of publication of this article were defrayed in part Hexamer or hexamer-like motifs exist in the cis-control reby the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 gions of numerous plant genes known to be regulated by a solely to indicate this fact. The nucleotide seqnence(s1 reported in this paper has been submitted N. Ohtsubo and M. Iwabuchi, unpublished data. to the GenBankTMIEMBL Data Bank with accession number(s) 012919. * The abbreviations used are: HBP, histone promoter-bindingprotein; (for HBP-la(l)),Dl2920 (for HBP-la(cl4)), and Dl2921 (for HBPbZIP, basicfleucine zipper; DBP, lysine-rich DNA-binding protein; SSIb(cll1. 1To whom correspondence should be addressed: Dept. of Botany, DBP, single strand DNA-binding protein; C a w , cauliflower mosaic Faculty of Science, Kyoto University, Kyoto 606-01,Japan. Tel.: 75-753- virus; NITR, nitrate reductase; ATF/CREB, activating transcription factor/cAMP-responsiveelement-binding protein. 4125; Fax: 75-753-4142.

9974

Family HBP-1

of Wheat bZIP Proteins

variety of environmental and physiological signals (4). Moreover, it has also been reported that HBP-la- and HBP-lb-like nuclear proteins,which are similar to one another with respect to the specificity of binding to the H3 hexamermotif, are present in many plantspecies (4, 23). This broad range conservation of the hexamermotif, and itscognate DNA binding factors, may be evidence for the importanceof hexamer motif-mediated gene regulation in higher plants. Rapidly accumulating information regarding trans-acting factors indicates thatregulatory proteins with common DNA recognition properties frequently occur in families (24). These findings suggest theexistence of a family of hexamer motif-binding proteinsinplantsand prompted us to initiatea search for novel bZIP proteins specific to the hexamermotif. Here, we report the isolation and characterization of three cDNAs encoding novel wheat bZIP proteins. Considered together with HBP-la(l7) and HBP-lb(c38), the wheat bZIP proteins constitute a family that can be classified into two subfamilies, based on the properties of structure, DNA binding, and dimerization.

9975

the wheat bZIP proteins for DNA binding were estimatedfrom the data of DNA binding experimentsin which increasing concentrations of 32Plabeled probe were added to a constant amount of E. coli cell extract. After gel electrophoresis, the radioactivity of bands corresponding to the bound and freeoligonucleotides were measured using Bio-image a Analyzer BAS2000 (Fuji Photo Film). The data were plotted according t o the Scatchard method (28). RESULTS

Cloning of Wheat cDNAs Encoding Novel Hemmer Motifbinding ProteinsdDNA clones encoding DNA-binding proteins that recognize the hexamer motif of the wheat H3 or CaMV 35s promoter were isolated from a wheat cDNA library using the Southwestern method (25). Based on differences in hexamer bindingspecificity between HBP-la and HBP-lb (lo), we used two synthetic oligonucleotides, containing the hexamer motif of either the H3or the 35spromoter, as probes. In addition to two cDNA clones for HBP-la(l7) and HBP-lb(c38) (13, 141, we isolated three positive phage clones. The phage clone isolated with the H3 hexamer probe wasnamed Al, whereas two other clones, named Acl and hcll, were isolated with the35s hexamer probe. Crude lysatesfrom lysogens conMATERIALSAND METHODS taining the recombinant phage clones A l , hcl, or Acll formed Isolation of cDNAs Encoding Wheat bZIP Proteins-Approximately 5 DNA-protein complexes with the H3 hexamer motif, as judged x lo6 recombinantphagefrom a wheat h g t l l cDNA librarywere screened using catenated oligomers containing the hexamer motifs of by the gel mobility shift assays (data not shown), indicating the wheat H3 or cauliflower mosaic virus (CaMV)35s promoters bythe that thesecDNAs codefor hexamer-binding proteins. Since the methods of Vinson et al. (25), with slight modifications, as described cDNAs neither cross-hybridized with each other, nor with the previously (13, 14). Afterthree roundsof purification, three clones (hl, cDNAs encoding HBP-la(l7) or HBP-lb(c38) (datanot shown), hcll, and hcl), distinct from the two previously reported clones (A17 and we surmised that the primary structuresof these newly idenAc38), were isolated. The insert DNAs of these clones were subcloned proteins differ from those of HBPinto M13mp19 and sequencedby the dideoxy sequencing method (26), tifiedhexamer-binding la(17) and HBP-lb(c38) and from one another. The cDNAs according to instruction of Sequenase DNA sequencing kit (U. S. Biochemical Corp.). For cloning of full-length cDNAs, insert DNAs were were subcloned into M13 phage DNA and sequenced. The seused as probes to screen the samecDNA library by molecular hybrid- quence data indicated the cDNA clones were not of full length, for since the 5' ends of the open-reading frames were at the 5' end ization. Of 9 x lo6 phage,eightclonesremainedascandidates full-length clonesof hcll after three roundsof phage purification. The of each cDNA. The wheatcDNA library wastherefore screened clone (hc14), which contained the longest insert, was chosen, and its again, using the individual cDNAs as probes. Afull-length nucleotide sequence determined as above. cDNA clone was isolated using Acll, but ,ones for A 1 and Acl Construction of Expression Plasmids-Plasmids that produce wheat bZIP proteins, or their derivatives, in Escherichia coli cells were con- were not obtained. The nucleotide sequence of the full-length structed, as follows, using T7 polymerase expression vectors (27). The cDNA clone differed slightly from that of Acll. Hence, this clone expression plasmids pARla(1) and pARlb(c1) were constructed by sub- was named Ac14. cloningEcoR1 fragments, containing the coding sequences of HBP-la(1) The nucleotide sequencesof the threecDNA clones, and their and HBP-lb(cl), into BamHI sites of pAR2113 and pAR2106, respectively, by using a n EcoRI-BamHIadaptor (New England Biolabs). deduced amino acid sequences, are shown in Fig. 1.The longest pARla(1)BL was generated by insertion of the BamHI cDNAfragment open reading frame found in the 1790-base pair insert of Ac14 from pARla(1) into the BamHI of site pAR2106. For the construction of starts withan ATG codon at position 231, and encodes a the expression plasmid pARla(cl4), oligonucleotide-directed mutagenpolypeptide consisting of 381 amino acids (Fig. IA), with a esis, using theoligonucleotide CTCCCTTTCCCATATGTATTTCCT,was calculated molecularmass of 40.7 kDa, which is larger than the employed to create an NdeI site at the initiation codon of the HBP36.7 kDa ofHBP-la(l7)(13). The hc14 cDNAcontains a poly(A) la(c14) coding sequence. An NdeI-EcoRI fragment, containing the entail, although, as was the case for the HBP-la(l7) clone, no tire HBP-la(cl4) coding region, was subcloned into pAR2106. For the construction of a pARla(cl4)BL, pARla(cl4) was cleaved at the XbaI obvious polyadenylation signal wasobserved in the 3"untranssite in the coding region, filled in using Klenow enzyme, and ligated lated region of the cDNA. The cDNA inserts of A 1 and Acl with a n 8-base pair BamHI linker (TAKARA). A BamHI fragment, comprise 997 and 1505 nucleotides, respectively; both reading containing the bZIP region of HBP-la(cl4) and a part of the vector frames are still open at the 5' end (Fig. 1, B and C). These DNA, was then inserted into the BamHIofsite pAR2106. The construction of pARla(l7), pARla(l7)BL, and pARlb(c38) was described previ-cDNAs code for polypeptides consisting of 257 and 476 amino acids, with molecular masses of 26.9 and 51.8 kDa, respectively. ously (13, 14). Structural Characteristics and DNA Binding Specificities of Preparation of Cell Extracts from Dansformed E. coli-E. coli cells (BL21) carrying the T7 RNA polymerase gene under control of the the Novel bZIP Proteins-Comparison of the predicted amino inducible lacUV5 promoter (27) were transformed withthe expression acid sequences of the threenovel proteins reveals that they all plasmids described above. Induction of protein synthesis and prepara- contain the bZIP domain (Figs. 1 and 2). The basic regions of tion of E. coli cell extracts containing the bZIP proteins were performed of the novel bZIP proteins sharea significant similarity to those according to the method described earlier(13, 14). HBP-la(l7) and HBP-lb(c38) (Fig. 2). This observation is conGel Mobility Shift, Competition, and Methylation Interference Assays-These assays were performed with bacterialcell extracts con- sistent with thefact that these proteinsspecifically bind to the taining bZIP proteins, as described earlier (13, 14). The wheatproH3 hexamer motif. The basic regions of bZIP proteins usuallyconmoter fragment used for assays was prepared as described previously tain two basic amino acid clusters (BR-A and BR-B in Fig. 2), (9). All 20 base pair competitors were chemically synthesized using separated by a short spacer (15).As shown in Fig. 2, the basic Cyclone Plus DNA synthesizer (Millipore). In the experiments involving typical cluster-spacerregions of A 1 and hc14 proteins take the heterodimer formation,E. coli cell extracts containing the bZIP proteins were incubated for 20 min a t 25 "C prior to the addition of the radio- cluster alignment, as seen in HBP-la(l71, whereas the BR-A region of Acl protein contain only 3 basic amino acid residues, active probe and cold competitor DNAs. Scatchard Plot Analysis-The dissociation constant (K,)values of as observed in thecorresponding region of HBP-lb(c38). Thus,

HBP-1 Family Proteins of bZIP Wheat

9976

TABLEI Conservation of the type I element in the promoter of plant histone genes The hexamer and reverse-oriented octamer motifs in the type I element are shown in bold type. The sequences of the three parsley histone H3 genes will appear in theEMBL Nucleotide Sequence Data Base under the accession numbers M77493 (PcH3-7), M77494 (PcH3-201,and M77495 1PcH3-16). The sequence of the wheat H4 gene (TH041) is the unpublished data of Y. Fujimoto and M. Iwabuchi. Gene

H3

H3-1.1

H4

Plant

Wheat Alfalfa Parsley Wheat corn

Clone

THO12 PcH3-7 PcH3-16 PcH3-20 THO11 THO41 c7 C13

Consensus sequence

Sequence

CCACGTCACCaATCCGCG CCACGTCAtCGATCCGCG CCACGTCACCGATCCGCG CCACGTCACCGATCCGCG CCACGTCAtCGATCCGCG CCACGTCACCGATCCGCG CCACGTCACCtATCCGCG CCACGTCAgCGATCCGCG CCACGTCAgCGATCCGCG

Ref. 8

53

54 55 56

CCACGTCANCGATCCGCG

A

FIG.1. Nucleotide sequences of the cDNA clones encoding HBP-la(clli), HBP-la(l),and HBP-lb(c38)with their predicted amino acid sequences. The DNA sequences and deduced amino acid sequences ofAc14, A l , and Acl are shown as HBP-la(cl4), HBP-la(l), and HBP-lb(cl),respectively ( A X ) .Numbers on the left and right correspond tothe base pair and amino acid positions, respectively.The amino acids representing the basic region are shaded, and the leucine, valine, methionine, and glycine residues within the leucine zipper domains are boxed. The proline residues of HBP-la(cl4)and thealanine residues within the N-terminal domains of HBP-lb(c1) are underlzned (A and B ) . The leucine residues of additional repeat in HBP-la(1)and glutamine residues within the C-terminal domain of HBP-lb(c1) are double-underlined ( E and C).

thewheat bZIP proteins, including HBP-la(l7)and HBPlb(c38), can be subdivided into two groups, based on the structural characteristicsof the basic regions. This is supportedby comparison of the leucine zipper structure of these five bZIP proteins (Fig. 2); HBP-la(l7), h l , and hc14 proteins havea long zipper structure, which consists of 6 to 7 repeated leucine residues, whereas HBP-lb(c38) and Acl protein have a short zipper

structure, which contains 3 to 5 repeated hydrophobic residues. Since HBP-la(l7) and HBP-lb(c38) areknown to show different DNA binding specificity for the hexamermotifs of the H3 and CaMV 35s promoters (Refs. 13 and 14; see Fig. 3 A ) , it seemed possible that the newly identified bZIP proteins may also differ in their DNA binding specificity. To check this possibility, we examined the DNA binding specificity of the three

HBP-1 Family of Wheat bZIP Proteins

9977

novel bZIP proteins for the hexamer motif. Cell extracts, prepared from E. coli cells transformed with expression plasmids containing cDNAs for each of the wheat bZIP proteins, were used as proteinsources.Bacteriallyexpressed A 1 and hc14 proteins were capable of binding to the H3 hexamer but were unable to bind to the 35s hexamer, whereas the hcl protein bound to both H3 and35s hexamers (Fig. 3B). In combination with the structural characteristicsof the bZIP proteins, these observations indicate that the A 1 and hc14 clones contain cDNAs encoding HBP-la(l'l)-related proteins, whereas the hcl clone contains cDNA that codes for an HBP-lb(c38)-related protein. The reason why the cDNA encoding hc14 protein was cloned by using the 35s hexamer probe is still unknown. According to the nomenclature for the previously reported bZIP proteins, we termed the Al, hc14, and hcl proteins HBP-la(l), HBP-la(cl4), and HBP-lb(cl),respectively. Wheat bZlP Protein Family Consists of ltoo SubfamiliesStructural and DNA binding analyses of the wheat bZIP proteins suggest that they may constitute a protein family. The possibility that these proteins belong to a homologous group cannot be ruled out,as the wheat used in the present study was allo-hexaploid. However, this possibility has been recently negated by results obtained from restriction fragmentlength polymorphism mapping analysisof the nuclear genes encoding these bZIP proteins (29). Thus, thebZIP proteins that bind to thehexamer motif constitute aprotein family, tentatively named the HBP-1 family. In addition, the resultsshown in Fig. 3 suggest that the HBP-1family can be grouped into HBP-la and HBP-lbsubfamilies. The subgrouping of the HBP-1 family seems reasonable, as judged by the structural characteristics of the putative activation domains and their relative positions (Fig. 4).The N-terminalhalves of HBP-la(l7) and HBP-la(c14) contain the proline-rich region known as theactivation domain of plant and animal transcription factors (17,201. An additional proline-rich region is found near the bZIP domain of HBPla(c14). HBP-lb(c38) and HBP-lb(c1) have a glutamine-rich region, which can activate transcriptionof some plant and ani-

Leucine Zipper HBP-1 a ( l 7 ) HBP-I a(c14) HBP-la(1) EmBP-1 02 GBFl GBF2 GBF3 TGAl b TAF-I CPRF-I CPRF-2 CPRF-3

HBP-Ic(C38) HBP-1b(c1) OCSBF-1 OCSBF-2 bAl9 TGAl a TGAl VBPI

Ftc. 2. Comparison of amino acid sequencesin the DNA binding domainsof plant bZIP proteins. Proteins are grouped into HBP-laand HBP-lb-related proteins. Identical and conserved amino acidsshaded, are and the leucine residues within the leucine zipper highlzghted. are BR-Aand BR-B, the two clusters of the basic amino acids in the basic regions, are ouerlined. References: HBP-la(l71,Ref. 13; HBP-lb(c38), Ref. 14; GBF1,-2, and -3, Ref. 16; TGAla and -lb,Ref. 18; EmBP-1, Ref. 31; TGA1, Ref. 35; bA19, Ref. 36; 0 2 , Refs. 46 and 47; OHPl and 2, Ref. 48; TAF-1, Ref. 49; CPRF-1, -2, and -3, Ref. 50; OCSBF-1 and -2, Ref. 51; VBP1, Ref. 52.

Family HBP-1

9978

of Wheat bZIP Proteins

mal nuclear genes (19,21,22), in theirC-terminal halves. The N-terminal half of HBP-lb(c1) is rich in alanine residues; a similar alanine cluster has been implicated in therepression of transcription (30).

Differences in Target Sequences of the Ttuo Subfamily Members-As shown in Fig. 5A, the amino acid sequence of HBP-la(1) hasapproximately 97%homology to thatof a wheat bZIP protein, EmBP-1, which has been shown to associate specifically with the cis-acting E m l a motif of the wheat Emgene (31). As the Emla core motif, CCACGT, is identical to the A sequence of the four 5' nucleotides of the hexamer motif plus HBP-la(l7) HBP-lb(c38) the two nucleotides immediately upstream (seeTable 111, it was surmised that the HBP-la isoforms recognize the CCACGT sequence, whereas the HBP-lbisoforms interact with thehexamer motif (ACGTCA) itself. This assumption was confirmed by competitive DNA binding experiments, using syntheticoligomers containing the hexamer or E m l a motif in mobility shift assays. As shown in Fig. 5, B and C, the HBP-la isoforms bound to both the H3 hexamer and Emlamotif, whereas the HBP-lb isoforms associated withthe H3 hexamer motif but not with the Emla motif, suggesting that the HBP-la and HBP-lb isoforms recognize distincttarget sequences.Therefore, it 1 2 3 4 5 6 7 8 9 seems likely that EmBP-1 is a member of the HBP-lasubfamily. We can further suppose that specific interactions between B or HBP-lb isoforms are due the typeI element and the HBP-la to their selective binding to the CCACGT (Hex-a) or ACGTCA h l hc14 h cl (Hex-b) motifs, respectively, within the CCACGTCA sequence of the type I element. To more precisely characterize the interactions of HBP-la(l), HBP-la(cl4), and HBP-lb(c1) with DNA, weperformed methylation interference analysis, as described previously (9, 13, 14). A DNA fragment containing the composite motif CCACGTCA from the H3promoter was used as a probe. Fig. 6A shows that 0." a guanine residue at -171 and an adenine residueat -173 on the upper strand, and guanine residues at -175, -174, -172, and -169 on the lower strand, were involved in the binding of "the threeproteins to theprobe. These results are in agreement with those for HBP-la(l71, but differ slightly from those ob1 2 3 4 5 6 7 8 9 10111213 sewed with HBP-lb(c38) (Fig. 6B). Other minor differences FIG.3. DNA binding specificity of the three novel bZIP pro- were also observed. Methylation of guanine residues a t -167 teins. A, gel mobility shift assays of previously characterized HBPla(17) and HBP-lb(c38), which are used as a control for the DNA bind- and -166 on the lower strand diminished the ability of the ing specificity. Cell extracts were prepared from E. coli transformed probe to bind to HBP-lb(c1) andaffected its affinity for HBPwith HBP-la(l7) and HBP-lb(c38) expression plasmids and incubated la(1) and HBP-la(cl4). Similarly, methylation of an adenine with 32P-labeled wheat H3 probe, as described previously (9). Competiresidue a t -168 on the upper strand interfered with the binding tors added in the binding reactions are indicated at thetop of each lane. to HBP-la(1) and HBP-la(cl4) and slightly inhibof the probe The DNA sequence of the competitors is given in Table 11. Free and protein-complexed DNA fragments were separatedon 5% nondenatur- ited itsbinding to HBP-lb(c1). These resultsindicate that there ing polyacrylamide gels. B , gel mobility shift assays for theDNA bind- are subtle differences in the protein-DNA interactions among ing specificity of the three novel bZIP proteins. E. coli cell extracts the members of the HBP-1 family. containing HBP-la(l), HBP-la(cl4), and HBP-lb(c1) were incubated Additional evidence for differences in the strength of the with the 32P-labeled H3 probe under the same conditions as A. Competitors added in the binding reactions are indicated at thetop of each protein-DNA interactions was obtained by comparing the dislane. sociation constant (K,) values of the HBP-la isoforms. These "

-

HBP-1 Family HBP-la Subfamily

I

FIG.4. Schematic representation of the primary structures of theHBP-1 ! family members. Numbers of amino acids and predicted molecular masses are indicated. Ala, alanine-rich region; BR, basic region; Gln, glutamine-rich region; LZ, leucine zipper; Pro, proline-rich region.

HBP-la(cl4)

Pro

Pro

[

BR

LZ 381 aa.40.7kD

BR LZ

7 1 1 27kD) (258aa,

HBP-la(1)

HBP-1b Subfamily

BR LZ

HBP-1b(c38)

332 aa.36.8kD

Ala

BR

LZ

Gin

Gln

kW

Ly

(477 aa,51.9kD)

HBP-1 Family of Wheat bZIP Proteins

9979

A

FIG.5. Specific binding of the HJ3P-la and HBP-lb isoforms to different sequence motifs.A, comparison of the amino acid sequence of HBP-la(1) to that of EmBP-1in thesingle-letter amino acid code. Closed dots mark amino acid residues conserved in the two proteins. The basic regions and leucine residues within the leucine zippers are highlighted. B, competitive DNA binding assays of the HBP-la isoforms. The gel mobility shift assays were performed under the sameconditions a s described in A of Fig. 3. Competitors, indicateda t t h etop of each lane, were incubated in the binding reaction. The DNA sequences of the competitors are shown in Table 11. C , competitive DNA binding assays of the HBP-lb isoforms. The assays were performed as described in B.

B

-

-meom 1 2 3 4 5 6 7 8

9101112131415

C HBP-1b(c38)

1 2 3 4

HBP-1b(c1)

5 6 7

8 9 1 0

TABLEI1 Alignments and comparison of synthetic oligonucleotides employed in the Competitive gel mobility shift assays The sequences of the upper strandof the double-stranded oligomers are aligned according tothe ACGT core sequence. The oligomer mH3 is a mutant derivativeof the oligomer H3. TheHex-a (CCACGT),Hex-b (ACGTCA),and composite (CCACGTCA)motifs are underlined. The sequences indicated by (REV) are written in the opposite orientation. Gene

H3 mH3 35s Em DBP NITR

Sequence

Ref.

TCGG CCACGTCA CCAATCCG TCGG CCAAGTAA CCAATCCG ATCCCTT ACGTCA GTGGAGA(REV) GTGCGG CCACGT GTCCGGCA TGATG CCACGTCA CCTCTGT(REV) TTTTG CCACGTCA CATGCTG

8 9 57 31 32 33

were estimated from the results of saturating DNA binding experiments, in which constant amounts of the bacterially expressed HBP-la isoforms were titrated with increasing amounts of "P-labeled probe. The radioactivity of bound and free probes was measured after gel electrophoresis, and the data were used for Scatchard analysis (28). Kd values were

calculated to be 10, 1, and 0.5 nM for HBP-la(l7), HBP-la(l), and HBP-la(cl4), respectively (Fig. 7). The hierarchy, therefore, of the binding affinitiesof these proteins for the composite motif was determined to be as follows: HBP-la(cl4) > HBPla(1) > HBP-la(l7). To confirm the above results, off-rate assays were carried out

HBP-1 Family of Wheat bZIP Proteins

9980

A Strand Upper Lower Strand

GCF

GCF

GCF

B HBP-la(1) -180

HBP-1a( 17) -16080

(1

TTCGGCCACGTCACCAATCCG AAGCCGGTGCAGTGGTTAGGC e. e e co

HBP-la(cl4)

-1

-1 60

e

TTCGGCCACGTCACCAATCCG AAGCCGGTGCAGTGGTTAGGC e.

e

e e.

HBP-1b(c38)

-180

00

-160

TTCGGCCACGTCACCAATCCG AAGCCGGTGCAGTGGTTAGGC e.

e

e CIS

e e

0

-180

e

-160

TTCGGCCACGTCACCAATCCG AAGCCGGTGCAGTGGTTAGGC :x e e e:)

HBP-1b(c1) 80 -1

-1 60

TTCGGCCACGTCACCAATCCG AAGCCGGTGCAGTGGTTAGGC e. e e e. FIG.6. Sequence recognition of members of the HBP-1family in protein-DNA interaction. A, methylation interference assays. DNA fragment, containing thc Hex-a and Hex-b motifs of the H3 promoter, was radiolabeled a t each end in separate reactions. The'"P-labeled probe was partially methylated and incubated with bacterial cell extracts containing HBP-la(cl4). HBP-1(1), or HRP-lb(c1). Free( F )and complexed ( C ) DNA fragments were separated on 5 0 polyacrylamide gels and eluted. After piperidine cleavage of eluted DNAs, the cleavage products were of the same DNA fragment ( G ). Closed analyzed on a 6'70 denaturing polyacrylamide gel, in parallel with the Maxam-Gilbert sequencing reactions circles indicate the G and A residues which, when methylated, completely inhibit binding to protein, and open circles show those which, when methylated, partially inhibit protein binding. B , schematic representationof the DNA binding interference data. Bases involved in protein binding are presentedabove or below the portion of the H3promoter sequence.Closed and open circles indicate methylation sites exhibiting the strong and weak inhibitory effects, respectively, on binding. The numbers refer tothe location of the DNA region within the H3 promoter, relative to the cap site ( + I ). The data for HBP-la(l7) and HBP-lb(c38) are takenfrom our previous work (13, 14).

The Kd values of the two HBP-lb isoforms could not be estiwith the HBP-laisoforms. Reaction mixtures from gel mobility shift assays were exposed to a specific competitor for the probe mated, dueto strong interferencefrom nonspecific binding proa t various times, then electrophoresed. The HBP-la(l7)-probe teins present in the crude extracts. However, we could obtain information on the DNA binding affinity of the two proteins complex was less stable than the HBP-la(c14)- and HBP-la(1)probe complexes (Fig. 8). This result is consistent with that from the resultsof off-rate assays. As shown in Fig. 8, the DNA binding stabilities of both HBP-lb(c38) and HBP-lb(c1)were obtained from the Scatchard analysis.

Bound

D

HBP-1 Family of Wheat bZIP Proteins

HBP-1 a(1)

HBP-1a(l7)

(nM)

Bound

nM

(nM)

Kd=l

9981

HBP-1a(cl4)

(nM)

Bound

Kd=l3nM

Kd=O.SnM

FIG.7. Comparison of dissociation constants ( R d )of the HBP-la isoforms. The dissociation constant (K,) for each of the bacterially expressed HBP-la isoforms was determined from quantitative evaluationof gel mobility shiR assays, performed under the same conditions as those forA of Fig. 3. When the datafrom the saturating binding assays (see "MaterialsMethods") and were plotted accordingto the method of Scatchard (ratio of bound and free probes versus bound probe), a linear correlation was observed between the two variables, allowing calculation of the dissociation constants (IC,), wherein K, = -I/slope, a s indicated.

incubation (min) competitor C

B

FIG.8. Comparison of DNA binding affinities of the members of the HBP-1 family by off-rate assays. Experimental protocol is described at the top of the figure. DNA-protein binding reactions were performed as described in the legend of Fig. 3A, except that specific H3 competitor (see Table11) was addedat the indicated times (A-D) during the incubation. Results are shown in the lower part of the figure.

0

10

20

25

30

I

I

I

I

I

t

t

t

t

A

(-)

subfamily HBP-1a

HBP-1b subfamily

- A B -CADB -CADB -CADB -CADB C D

"-

"-

-

.

la(17)

--

" 0

141)

higher than thatof HBP-a(l7) and lower than those of HBPla(c14) and HBP-la(1). Thus, we assume that the relative DNA binding affinity of the membersof the HBP-1family may be as follows: HBP-la(cl4) > HBP-la(1) > HBP-lb(c38), HBP-lb(c1) > HBP-la(17). Takentogether, our data suggest that memthe bers of the HBP-1family, which all associate with thecomposite motif CCACGTCA, differ from one another in both DNA binding specificity and affinity. Homodimer a n d Heterodimer Formation within the HBP-la Subfamily-It is well known that thebinding of bZIP proteins to DNA requires their dimerization (24). The key to dimerization of bZIP proteins is theleucine zipper motif that forms the parallel, two-stranded, anda-helical coiled-coil structure. Fig. 9 shows the leucine zipper sequencesof the five members of the HBP-1 family on schematic a-helices. Comparisonof the helical structures reveals thathelix spokes 1, 4, and 5 of the HBP-la isoforms contain either identicalor conserved amino acids (Fig. 9A) and that the leucine zippers of HBP-lb(c38) and HBPlb(c1) arevery similar to one another (Fig. 9B). We previously reported that HBP-la(l7) and HBP-lb(c38) form obligate homodimers through the leucine zipper (13, 14). To investigate whetherhomodimerization occurs in HBP-la(l), HBP-la(cl4), and HBP-lb(c1) as well, we performed mobility shift assays with truncated proteins containing thebZIP motif (Fig. 1OA). The truncated proteins HBP-la(1)BL and HBPla(cl4)BL, which were efficiently expressed in E. coli cells,

b

.(

-*"" "

1a(cl4)

1b(c38)

1 b(c1)

bound to thecomposite motif (Fig. lOB, lanes 2 and 8),indicating that thebZIP domains of HBP-la( 1)and HBP-la(cl4) are sufficient for DNA binding. When E. coli cell extracts containing eitherfull-length or truncated polypeptides were mixed, the resulting DNA-protein complexes for both HBP-la(cl4) and HBP-la(1) showed an intermediate mobility (Fig. 1OB). These results indicate that both HBP-la(1) and HBP-la(cl4) form homodimers for binding to the composite motif through their bZIP domains. We could not obtain clear-cut results for dimerization of HBP-lb(c1). However, the fact that the two HBP-lb isoforms have structural similarity in the leucine zipper regions leads one to believe that HBP-lb(cl), like HBP-lb(c38), would form a homodimer during DNA binding. The high similarity among amino acid sequences along the hydrophobic dimer interface of the leucine zipper regions of the HBP-la and HBP-lbisoforms raises thepossibility that these members form heterodimers. To test this possibility, we performed heterotypic mixing experiments with the HBP-la isoforms using gel mobility shift assays. When bacterially expressed full-length and truncatedpolypeptides were combined, three bands migrated more slowly than the free DNA (Fig. 1OC). Two of the bands correspond to the DNA-protein complexes formed by the probe and parentalhomodimers; the band with an intermediate mobility was interpreted to represent a complex between the probe and a heterodimer composed of full-length and truncated polypeptides. Thus,heterodimer for-

9982

HBP-1 Family of Wheat bZIP Proteins

A

FIG.9. Schematic representation of a-helical wheels of the HBP-la isoforms (A) and HBP-lb isoforms ( B ) . Amino acids that are sharedin each subfamily are boxed.

HBP-la(17)

HBP-la(cl4)

HBP-la(1)

B A

HBP-1 b(c38)

mation occurs between the members of the HBP-lasubfamily. Heterodimer formation would also be expected to occur between the HBP-lb isoforms, which have very similar bZIP domains, as mentioned above, although this still remains to be tested. Interactions between HBP-1 Family Members and the Composite Motif CCACGTCA in Other Plant Gene Promoters-As shown in Table 11, the CCACGTCA motif exists in thepromoters of the Arabzdopsis lysine-rich DNA-binding protein (DBP) gene and the rice nitrate reductase (NITR) gene (32, 33), implying that members of the HBP-la and HBP-lbsubfamilies may also be involved in transcriptional regulation of these genes via the composite motif. To test this possibility, we performed competitive DNA binding assays, using the synthetic oligonucleotides shown in Table 11. In the case of the HBP-la isoforms, formation of complexes between the homodimers or the heterodimers and the H3 probe was strongly inhibited by the homologous or the DBP competitors and weakly by the Em or the NITR competitors(Fig. 11, A X ) . These data are in partial agreement with our previous observation that HBPla(17) binds to the H3composite motif with a higher afinity DBP, and NITR than to the composite motifs present in the Em, gene promoters (14). In the case of the HBP-lb isoforms, both HBP-lb(c38) and HBP-lb(c1) hada stronger association with the H3composite motif than with the DBP and NITR composite motifs and the 35s hexamer motif (Fig. 11,D and E ) , which is in good agreement with our previous result (14). These observations suggest that the HBP-la and HBP-lb isoforms may participate in the transcriptional regulation of the DBP and NITR genes, as well as that of wheat histone genes.

HBP-lb(c1)

specific DNA binding to the Hex-a motif (CCACGT). In contrast, the N-terminal halves of the two HBP-lb isoforms contain a structurally similarbZIP domain that canrecognize the Hex-b motif (ACGTCA), whereas the C-terminal halves are enriched in glutamine residues. Since the Hex-a and Hex-b motifs share an ACGT core, the sequences flanking the core motif may play an important role in determining the DNA binding specificities of the members of the two subfamilies. Moreover, proline- and glutamine-rich regions of several animal and plant transcription factors have been known to act as transactivation domains (17, 19-22). We conclude, therefore, that all themembers of the HBP-1family are sequence-specific transcription factors. All the HBP-1 cDNA clones were isolated from a common cDNA library, and therefore, all five bZIP proteins must be simultaneously expressed in developing wheat cells. However, it isdifficult to determinewhich bZIP protein(s) areinvolved in transcription of the wheat H3gene. Recently, we observed that the mRNA levels of HBP-la(l7) and HBP-lb(c38) were enriched in meristematic tissues, in which cells in S phase are abundant, while the steady-state levels of the mRNAs of the bZIP proteins identified in the present study were too low to be detected in any tissue by Northern blotting (34).The expression profiles of HBP-la(l7) and HBP-lb(c38)mRNAs basically resemble those of the histone mRNAs (34). Considered together with the results of the presentstudy, these datasuggest that at least HBP-la(l7) and HBP-lb(c38) are involved in cell cycledependent transcriptionof the H3gene, as proposed previously (14). Recently, cDNA clones encoding plant bZIP proteins that recognize the Hex-a or Hex-b motif have been isolated in sevDISCUSSION eral laboratories (Fig. 2). Based on the criteria of our classifiIn this study, we isolated cDNA clones encoding three dis- cation, the plant bZIP proteins reported so far can be loosely tinct bZIP proteins, designated HBP-la(cl4), HBP-la(l), and grouped into two types: Hex-a-binding proteins (TGAlb, TAF, HBP-lb(cl), which resemble the previously identified bZIP pro- 0 2 , GBFs, and CPRF-1 and -3) and Hex-b-binding proteins teins HBP-la(l7) and HBP-lb(c38). Basedon our characteriza- (TGAla, OCSBFs, TGA1, bA19, and VBP1) (Fig. 2). This sugtion of the primary structures andDNA binding properties of gests that bZIP protein families similar to the wheat HBP-1 these five bZIP proteins, we have concluded that these DNA- family may be present in a variety of plant species and could binding proteins constitute anHBP-1 family (Figs.1-31, which build a bZIP protein superfamily as plant DNA-binding proown, several can be classified into the HBP-la and HBP-lb subfamilies teins.In both Cashmore's laboratoryandour (Figs. 3-5). The three HBP-laisoforms are characterizedby a n cDNA clones encoding HBP-la-andHBP-lb-likeproteins N-terminal proline-rich region, a C-terminal bZIP motif, and (GBFs, TGA1, and bA19) have been independentlyisolated

Family HBP-1

of bZIP Wheat

Proteins

9983

A

BR LZ

HBP-la(l7)BL

244 m

m

3

4

9

Pro 381

HBP-la(cl4)BL

HBP-la(1)

1

HBP-la(1)BL

BR

LZ

0R

LZ

121

d

I - /

HBP-la(1)

+ + + + la(c14)

+ + + -

-I-

" , "

-

-

-

la(1).

la(cl4)/la(cl4)BL la(cl4)BL

-

HBP-la(1)BL

la(l)Ha(l)BLla(1)BL-

.

1 2 3 4 5 6

I

7 8 9 1 0 1 1 12

C

HBP-la(l7)

A

HBP-W)

HBP-la(cl4)BL

- + + ++ -

HBP-la(l7)BL

la(17)-

-

la((17)11a(c14)BL

la(cl4)BL

-

"9 "

--

la(1) la(l)/la(l7)BL

HBP-la(1)

- + + + +

--

la(l7)BL-

-

HBP-la(c14)BL

- + + + +

-

la(1 "

la(l)/la(cl4)BI

"

a "

la(cl4)BI

" " "

"

-00"

1 2 3 4 5 6 7 8 9101112 13 14 1516 17 18 FIG.10. Formation of protein dimers between the HBP-la isoforms. A, schematic representation of the expression constructs used for ( B R ) ,and leucine zippers (LZ)are highlighted. truncated HBP-laisoforms. The proline-rich regions(Pro), basic regions generating full-length and The N and C termini of each proteins are shownat the right andleft sides of constructs, respectively. B , homodimerization betweenHBP-la(cl4) and HBP-la(1). E. coli cell extracts containing full-length and/or truncated derivatives of HBP-la(1) and HBP-la(cl4) were incubated with the 32P-labeledH3 probe under the same reaction conditions as described in the legend to Fig. 3A. Lanes 1 and 7, R2P-labeled probe was incubated without protein. Lanes 2, 6, 8, and 12, labeled probe was incubated withthe full-length or truncated proteins. Lanes3 5 and 9-11, labeled probe was incubated with a mixture of increasing amounts of full-length protein and constant amounts of truncated proteins. C , heterodimerization between the HBP-la isoforms. Gel mobility shift assays were performeda s for B, except that heterotypic mixingof E. coli cell extracts containing full-length or truncated proteins was performed. Lanes 1, 7, and 13, "P-labeled probe was incubated without protein. Lanes 2, 6 8 , 12, 14, and 18, labeled probe was incubated with full-length or truncated proteins. Lanes 3 5 9 - 1 1 , and 15-17, labeled probe was incubated with mix of increasing amounts of full-length proteins and constant amountsof truncated proteins.

HBP-1Family of Wheat bZIP Proteins

9984

-

1 2 3 4 5 6 7 8 9 10111213

1 2 3 4 5 6 7 8 910111213

B

NlTR

H3 DBP Em

E

" "

-- - -

-- - - -

~3

comwltlor(ng)O 10 2U 40 10 20 40 IO 20 40 10 20 40

la(17) la(l7)lla(cl4)BL

0-

1 2 3 4

"

- -

Em

DBP

NlTR

" "

compelilor(ng)

ma

0 10 20 40

10 20 40 10 20 40 10 20 40

5 6 7 8 9 10111213 -

C

"DBP H3

compelllor(ng) 0

Em

NlTR

H3

10 20 40 IO 20 40 10 20 40

0 10 20

40

-"

1 2 3 4 5 6 7 8 9 10111213

IO 20 40

la(l) la(l)/la(cl4)BL' la(cl4)BL.

1

2 3

4

5 6

7

8

910

1 1 1 2 1 3 14

15 16

17

FIG.11.Binding of the HBP-1 family membersto the composite motif CCACGTCAof plant histone and other promoters. Competitive DNA binding assays, using syntheticoligonucleotides, were performed for each protein. The gel mobility shift assays were done under the same conditions a s indicated in the legend to Fig. 3 A . The binding reactions were performed with different amounts of various competitor DNAs, as indicated above each lane. TheDNA sequences of the competitors are shown in Table11. The DNA binding patternsof the HBP-1 family members are shown inA-E. A, HBP-la(l7) and HBP-la(1); B , HBP-la(l7) and HBP-la(cl4); C,HBP-la(1) and HBP-la(cl4); D,HBP-lb(c38); E, HBP-lb(c1).

from Arabidopsis cDNA libraries (16, 35, 36), indicating that such a bZIP protein family may indeed exist in Arabidopsis. Hence, it seemslikely that transcriptionfactors homologous to members of the HBP-1 family may be required for S phasespecific transcription of type I histone genes in other plants. The Hex-a motif corresponds in part to the G-box (CCACGTGG) of the promoters of UV and light-responsive plant genes (37-39), the Emla motif (CCACGTGT) of the motif I (CGCCACGTAC) wheat Em gene promoter (31), and the of the rice rub gene promoter (40). The Hex-b motif is also conserved in the promoter regions of plant genes, including those of the C a m 35s andTi-plasmid ocs, nos, and mas genes (41). Moreover, the composite motif, consisting of the Hex-a and Hex-b motifs, also exists in the DBP and NITR gene promoters (see Table 11). In fact, all members of the HBP-1family bind to these motifs (Ref. 14; Figs. 3,5, and11).Functional diversity of bZIP proteins has recently been reported for the mammalian ATFICREB family, which contains a t least 13 related, but distinct, bZIP proteins (24). It ishighly probable that, in analogy to the ATFICREB family, individual members of the HBP-1 family are involved in transcriptional regulation of different genes. Indeed, maize 0 2 protein, which resembles the HBP-la isoforms, can specifically activate transcription of the 22kDzein gene (42). Furthermore, HBP-la isoforms are able toform homo- andheterodimers upon DNA binding(Fig. lo), and HBP-lb isoforms are expected to dimerize with themselves. Suchheterodimerizationmay be necessary to increase the functional diversity of members of the HBP-1 family in plant gene transcription.

In general, differences in amino acid sequence in the bZIP regionsinfluence DNA binding and dimerization specificity (24). For example, Fos-related proteins dimerize preferentially with Jun-related proteins, yet neitherFos- nor Jun-related proteins can cross-dimerize with CCAATIenhancer-binding proteins. With regardtoHBP-laandHBP-lb isoforms, heterodimerization is not expected to occur easily betweenHBP-la and HBP-lb subfamilies, as judged from their overall structures and DNA binding specificity. This prediction is based on our previous results, in which no heterodimer was formed between HBP-la(l7) and HBP-lb(c38) (14). Gene regulation by cross-talk between transcription factors via mutually exclusive DNA binding has been reported to occur between the ATFI CREB and FosIJun families (24) andbetween the FoslJun and steroid hormone receptor families (43). In fact, we have observed that mutually exclusive DNA binding occurs between native HBP-la and HBP-lb at the wheat H3 promoter (10). Since overlapping Hex-a and Hex-b motifs can be found in the promoters of a variety of plant genes (Table 111, wepropose that members of the HBP-la and HBP-lb subfamilies may crosstalk in transcriptional regulation through mutually exclusive interactions with the composite motif. Finally, we consider the possibility of protein-protein interactions between members of the HBP-1 family and otherDNAbinding proteins. Cooperation between the Hex-a motif and the other cis-elements, suchasthe GT-1 (GG'M'AA) and I-box (GATAAG) motifs, which are involved in light-regulated transcription of the Arabidopsis rbcS-1A gene, has been suggested to be crucial for transcriptional regulation (44).It hasalso been

HBP-1 Family of Wheat bZIP Proteins reported that theHex-a motif can work cooperatively with the H-box (CCTACC(N),CT) of the bean chalcone synthase gene (45). As shown in Table I, the octamer motif is located immediately downstream of the Hex-a and Hex-b motifs in the type I element. Since this motif is conserved in the promoters of all plant histone genes so far isolated (3-6), it is likely to be an important cis-element for regulator of histone gene expression in higher plants. Therefore, we speculate that members of the HBP-1 family may interact with the DNA-binding protein(s) that associate with the octamer motif. Although ssDBP-1 and ssDBP-2 are candidatesfor the octamer motif-binding protein, these are single strand DNA-binding proteins that interact with the entire type I element, including the composite motif. Recently, we have detected octamer motif binding factor^,^ but these factors have not yet been fully characterized. Therefore, furthercharacterization of octamermotif-binding proteins other than ssDBP-1 and ssDBP-2 should assist in determining the function of the member(s)of the HBP-1 family involved in S phase-specific transcriptionalregulation of plant histone genes via the type I element. Acknowledgments-We are grateful to Michiko Kat0 for technical assistance in our experiments. We thank Dr. Margaret K. Nelson for critical reading of the manuscript, Dr. Kenta Nakai for assistance in drawings the a-helical wheels, andDrs. Hisabumi Takase, EikiMomotani, and Takuya Nakayama for helpful discussions and comments. REFERENCES 1. Mitchell, P. J., and Tjian, R. (1989) Science 245, 371-378 2. Johnson, R. F., and McKnight, S. L. (1989) Annu. Reu. Biochem. 58, 799-839 3. Kawata, T., Nakayama, T., Ohtsuho, N., Tabata, T., and Iwabuchi, M. (1990) Deu. Genet. 11, 205-213 4. Mikami, K., and Iwabuchi, M. (1993) in Control of Plant Gene Expression (Verma. D. P. S.. ed) DD. 5 1 4 8 . CRC Press. Boca Raton. FL 5. Nakayama, T., and Iwai&hi, M. i1993) Crit. keu. Plant Sci. 12,97-110 6. Takase, H., and Iwahuchi, M. (1993) J. Plant Res. Special Issue 3, 37-50 7. Nakayama, T., Sakamoto, A,, Yang, P., Minami, M., Fujimoto, Y., Ito, T., and Iwabuchi, M. (1992) FEBS Lett. 300, 167-170 8. Tabata, T., Fukasawa, M., and Iwabuchi, M. (1984) Mol. & Gen. Genet. 196, 397400 9. Mikami, K., Tabata, T., Kawata, T., Nakayama, T., and Iwabuchi, M. (1987) FEBS Lett. 223, 273-278 10. Mikami, K., Takase, H., Tahata, T., and Iwabuchi, M. (1989) FEBS Lett. 256, 67-70 11. Takase,H.,Minami, M., andIwabuchi, M. (1991) Biochem. Biophys. Res. Commun. 176, 1593-1600 12. Mikami, K., Sakamoto, A., Takase, H., Tabata, T., and Iwabuchi, M. (1989) Nucleic Acids Res. 17, 9707-9717 13. Tabata, T., Takase, H., Takayama, S., Mikami, K., Nakatsuka, A., Kawata, T., Nakayama, T., and Iwahuchi, M. (1989) Science 245, 965-967 14. Tabata, T., Nakayama, T., Mikami, K., and Iwabuchi, M. (1991) EMBO J . 10, 1459-1467 15. Busch, S. J., and Sassone-Corsi, P. (1990) Dends Genet. 6, 3-0 16. Schindler, U., Menkens, A. E., Beckmann, H., Ecker, J. R., and Cashmore, A. R. (1992) EMBO J. 11, 1261-1273 17. Mermod, N., ONeill, E. A,. Kelly, T. J., and Tjian, R. (1989) Cell 58, 741-753

M. Minami and M. Iwabuchi, unpublished data.

9985

18. Katagiri, F., Lam, E., and Chua, N.-H. (1989) Nature 340, 727-730 19. Courey, A. J.,Holtzman, D. A,, Jackson, S. P., and Tjian, R. (1989) Cell 59, 827-836 20. Schindler, U., Terzaghi, W., Beckmann, H., Kadesch, T., and Cashmore, A. R. (1992) EMBO J. 11, 1275-1289 21. Katagiri, F., Yamazaki, K., Horikoshi, M., Roeder, R. G., and Chua, N.-H. (1990) Genes & Deu. 4,1899-1909 22. Yamazaki, K., Katagiri, F., Imazeki, H., and Chua, N.-H. (1990) Proc. Natl. Acad. Sci. U. S . A . 87, 7035-7039 23. Kuhlemeier, C. (1992) Plant Mol. B i d . 19, 1-14 24. Lamb, P., and McKnight, S.L. (1991) Dends Biochem. Sci. 1 6 , 4 1 7 4 2 2 25. Vinson, C. R., LaMarco, K. L., Johnson, P. F., Landschulz, W. L., and McKnight, S.L. (1988) Genes & Deu. 2. 801-806 26. Sanger, F., Nicklen, S., and Coulson, A. R. (1977)Proc. Natl. Acad. Sci. U. S. A. 74. 5463-5467 27. Studier, F. W., and Moffatt, B. A. (1986) J . Mol. Bid. 189, 113-130 28. Scatchard, G. (1949) Ann. N. Y Acad. Sci. 51, 6 6 0 4 7 2 29. Nasuda, S., Liu, Y.-G., Sakamoto, A., Nakayama, T., Iwabuchi, M., and Tsunewaki, K. (1993) Plant Mol. Biol. 22, 6 0 3 4 1 4 30. Licht, J . D.,Grossel, M. J., Figge, J., and Hansen, V. M. (1990) Nature 346, 7679 31. Guiltinan, M. J.,Marcotte, W. R., and Quatrano, R. S. (1990) Science 250, 267-271 M.,and 32. Alliotte, T., Tire, C., Engler, G., Peleman, J., Caplan,A., van Montagu, Inze, D.(1989) Plant Physiol. (Bethesda) 89, 743-752 33. Choi, H. K., Kleinhofs, A,, and A n , G. (1989) Plant Mol. B i d . 13, 731-733 34. Minami, M., Huh, G.-H.,Yang,P., and Iwabuchi, M. (1993lPlant Mol. Biol. 23, 429-434 35. Schindler, U., Beckmann, H., and Cashmore, A. R. (19921 Plant Cell 4, 13091319 36. Kawata, T., Imada, T., Shiraishi, H., Okada,K., Shimura, Y., and Iwabuchi, M. (19921 Nucleic Acids Res. 20, 1141 37. Schulze-Lefert, P., Dangl, J . L., Becker-Andre, M., Hahlbrock, K., and Schulz, W. (1989) EMBO J . 8, 6 5 1 4 5 6 38. Staiger, D., Kaulen, H., and Schell, J. (1989)Proc. Natl. Acad. Sci. U. S. A. 86, 6930-6934 39. Giuliano, G., Pichersky, E., Malik, V. S., Timko, M.P., Scolink, P. A,, and Cashmore, A. R. (1989) Proc Natl. Acad. Sci. U. S. A. 85, 7089-7093 40. Mundy, J., Yamaguchi-Shinozaki, K., and Chua,N:H. (1990)Proc. Natl. Acad. Sci. U. S. A . 87, 14061410 41. Bouchez, D., Tokuhisa, J. G., Llewellyn, D. J., Dennis, E. S., and Ellis, J. G. (1989) EMBO J . 8, 4 1 9 7 4 2 0 4 42. Kodrzycki, R., Boston, R. S., and Larkins, B. A. (1989) Plant Cell 1, 105-114 43. Schule, R., and Evans, R. M. (1991) Dends Genet. 7,377-381 44. Donald, R. G. K., and Cashmore, A. R. (1990) EMBO J . 9, 1717-1726 45. h a k e , G. J., Faktor, O., Lamb, C. L., and Dixon, R. A. (1992)Proc. Natl. Acad. Sci. U. S. A. 89, 9230-9234 46. Hartings, H., Maddaloni,M., Lazzaroni, N., Di Fonzo, N., Motto, M., Salamini, F., and Thompson, R (1989) EMBO J . 8,2795-2801 47. Schmidt, R. J., Burr, F. R., Aukerman, M. T., and Burr, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4 6 5 0 48. Pysh, L. D., Aukerman, M. J., and Schmidt,R. J. (1993) Plant Cell 5,227-236 49. Oeda, K., Salinas, J., and Chua, N:H. (1991) EMBO J. 10, 1793-1802 50. Weisshaar, B.,Armstrong,G. A,, Block,A., da Costa e Silva, 0..and Hahlhrock, K. (1991) EMBO J. 10, 1777-1786 51. Singh, K., Dennis, E. S., Ellis, J. G., Llewellyn, D. J., Tokuhisa, J . G., Waheithner, J. A,, and Peacock, W. J. (1990) Plant Cell 2, 891-903 52. Ehrlich, K. C., Cary, J . W., and Ehrlich, M. (1992) Gene (Amst.)117, 169-178 53. Wu, S.-C., Bogre, L., Vincze, E., Kiss, G. B., and Dudits, D. (1988) Plant Mol. B i d . 11, 6 4 1 4 4 9 54. Tabata, T., Sasaki, K., and Iwabuchi, M. (1983) Nucleic Acids Res. 11,58655875 55. Philipps, G., Chaubet, N., Chaboute, M.-E., Ehling, M., and Gigot, C. (1986) Gene (Amst.)42, 225-229 56. Gigot, C., Chaubet, N., Chaboute, M.-E., Ehling, M., and Philipps, G . (1987) Plant Physiol. Biochem. 25, 235-247 57. Franck, A., Guilley, H., Jonard, G., Richards, K., and Hirth, L. (1980) Cell 21, 285-294