The Human mRNA Encoding the Goodpasture Antigen Is Alternatively ...

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1993 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 268, No. 16, Isaue of June 5, pp. 12090-12094,1993 Printed in II.S.A.

The Human mRNA Encoding the Goodpasture Antigen Is Alternatively Spliced” (Received for publication, December 3, 1992, and in revised form, February 2,1993)

Dolores BernalSB, Susan Quinonesll, and Juan SausSII From the SFundacwn Valencianude Investigacwnes Biomedicas, Instituto de Investigaciones Citoldgicas, 46010 VaGncia, the Departament de Bioquimica i Biologiu Molecular, Facultad de Farmhcia, Universitat de VaGncia, 46100 VaGncia, Spain, and the UDepartment of Environmental and Community Medicine, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, New Jersey 08854

The noncollagenous (NCl) domain of the human collagen aS(1V)-chain is the primary target of autoantibodies produced in Goodpasture syndrome and, therefore, hasbeen designated as the Goodpasture antigen. Inthisreport, we show that Goodpasture antigen mRNA undergoes processing to at least two alternatively spliced forms in a variety of human tissues, resulting in the exclusion of sequence encoded by either one or two exons. Interestingly, no alternatively spliced forms were observed in bovine or rat tissues. The derived amino acid sequences of the two variant mRNA forms are identical and significantly shorter than that arising from the complete Goodpasture antigen mRNA. They lack the carboxyl-terminal region contributing to the formation of the Goodpasture epitope and all but one of thecysteines found in the complete form. These sequence characteristics suggest that, if translated, the variant Goodpasture antigen is likely to be defective in triple helix formation and no longer reactive with Goodpasture autoantibodies. Although each tissue expressing Goodpasture antigen displayed a specific mRNA pattern, the complete form was always the most abundant and was present at or not the organ levels apparently unrelated to whether of origin is a potential target inGoodpasture syndrome. Furthermore, the antigen sequence was identicalin the kidneys of normal and Goodpasture-affected individuals, and no major differences in the expression of the complete and spliced forms wereobserved.

Goodpasture syndrome is a human autoimmune disorder characterized by a rapidly progressive glomerulonephritis often associated with lung hemorrhage. The pathogenicity of this disease is mediated by autoantibodies directed against an integral component of the glomerular basement membrane

* This work was supported inpart by National Institutes of Health Grant DK-42514 (to S. Q.)and by Fondo de Investigaciones Sanitarias de la Seguridad Social (Spain) Grant 89-0406 and Comisi6n Interministerial de Ciencia y Tecnologia (Spain) Grants P B 87/0951 and SAL 91/513 (to J. S.). Additional support came from National Institutes of Health/National Institute of EnvironmentalHealth Sciences Center of Excellence Grant ESO 5022. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. $ Recipient of a fellowship from the Ministerio de Educaci6n y Ciencia (Spain). I(Profesor Titular at the Universitat de Valhcia. To whom correspondence should be adhessed Instituto de Investigaciones Cito16gicas C/Amadeo de Saboya, 4 46010 Valencia, Spain. Tel.: 34-6369-8500; Fax: 34-6-360-1453.

which has been identified as the noncollagenous (NC1)’ domain of the collagen IV chain a3(IV) (1-5). Autoantibody binding, which is dependent on the conformation of the antigen, is lost upon the reduction of the a3(IV)NCldisulfide bonds (1).We and others (6-8) have recently reported the isolation of cDNA and genomic clones specific for the Goodpasture antigen. From studies using synthetic peptides representing various regions of the derived primary structure of the a3(IV)NC1, it has been shown that, at thecarboxyl end, there is a region that specifically binds Goodpasture antibodies and therefore contributes to the formation of the Goodpasture epitope (9). An additional region at the amino-terminal endof the Goodpasture antigen is also a good candidate for being part of the epitope due to its hydrophilic and unique sequence (8). Although located at distal ends of the human a3(IV)NC1, these regions are likely to be in close proximity in the folded protein (9, 10). Multiple transcripts are generated from a number of collagen genes, such as the al-chain of collagen 11, the a2- and a3-chains of collagen VI, and the al-chain of collagen XI11 (11-17). These transcripts result from alternative splicing of sequences encoded by entire exons or portions thereof. In the cases of the al- anda2-chains of collagen I, alternative splicing has been associated with osteogenesis imperfecta and Ehlers-Danlos syndrome type VI1 (18-21). Here we report that the mRNA for the Goodpasture antigen also is alternatively spliced. The twonovel Goodpasture antigen mRNA species identified occur specifically in humans and not in bovine or rat. If translated, these spliced forms would each result in a polypeptide that is expected to be unreactive with Goodpasture patient antibodies due to the absence of all but one of the cysteines involved in disulfide bonding. We have also found that the complete and spliced forms of the Goodpasture antigen mRNA are expressed in a wide variety of human tissues, not only in those that serve as potential targets in Goodpasture syndrome. Preliminary comparative studies suggest that thesame alternative splicing occurs in the kidney of a Goodpasture patient, and no major differences exist in expression when compared to normal individuals. MATERIALS AND METHODS

RNA Preparation-Various human tissue samples were taken from two normal donors immediately after organ removal, chilled and cleaned to remove stroma and other material in contact with the parenchyma, and frozen at -70 “C. The human kidney samples were obtained from histologically normal portions of two independent nephrectomies, the corresponding cortex excised, and similarly stored. The Goodpasture cortex kidney sample was obtained from a patient The abbreviations used are: NC1, noncollagenous domain; PCR, polymerase chain reaction; bp, base pair; X , any amino acid.

12090

Goodpasture Syndrome nephrectomy. The bovine kidney cortexand rat kidney weresimilarly prepared immediately after sacrifice. RNA was isolated from frozen tissues after grinding them to a powderin the presence of liquid nitrogen. Powdered tissue and cells were dissolved in a pre-chilled buffer containing 4 M guanidinium thiocyanate and briefly dispersed using a Polytronhomogenizer. The resultingmaterial was either stored at -20 'C until needed or immediately centrifuged through a 5.7 M CsCl cushion to isolate total RNA essentially as described (22). The integrity of the RNA wasconfirmed by UV visualization of intact 18 S and 28 S rRNA after agarose gel electrophoresis and ethidium bromide staining. RNA-Polymerase Chain Reaction (PCR)-Total RNA (2.5 pg) was used for first strand cDNA synthesis performed in the presence of 3 pmol of a complementary oligonucleotideto the a3(IV)NC1carboxylterminal end and 35 units of reverse transcriptase from avian myoblastosis virus (Pharmacia LKB Biotechnology Inc.) in a total reaction volume of 20 pl. The oligonucleotides used were ON-BHNClc, ON-A31&, and ON-H4c for human, bovine, and rat material, respectively. The resulting cDNA (5 pl of the above reaction mixture) was then subjected to PCR using 25 pmol of the same or an adjacent 5'oligonucleotide and an additional oligonucleotide at the amino-terminal end of the a3(IV)NC1 or at the carboxyl-terminal end of the triple helix in a t o t a l volumeof100 pl. The human cDNA was amplified for 40 cyclesat 94 'C/1 min, 50 "C/1 min, and 72 "C/2 min, and the bovine and rat cDNAs were amplified for 40 cycles at 94 "C/ 1 min, 45 "C/1 min, and 72 "C/2 min. Analysis of all the PCR products (5 p l ) was performed by agarose (1.2%) gel electrophoresis. Nucleotide Sequence Anulysis-The cDNA species obtained in the PCR amplification of t o t a l human RNAweresubcloned into MI3 vector (23) and subjected to nucleotide sequencing by the dideoxy chain termination method (24) using ? % A T P (251, modified T7 DNApolymerase (26), and universal and a3(IV)-specificprimers. Both strands of each fragment were sequenced.The splicing pattern of each of the variant Goodpasture antigenmRNAs was determined by comparison with the complete Goodpasture antigenRNA and the corresponding exon sequences (8). Oligonucleotides-The sequence of each of the oligonucleotides is given in the 5' to 3' direction. The human a3(IV) oligonucleotides were ON-HNC3m (exon I, sense), GACCCTGTGGGCCAAGA; and ON-BHNClc (exon VI, antisense), BarnHI site-GTTCTTTAGGATCAAAA. The bovine a3(IV) oligonucleotides were ON-A3m (in the region homologous to human exon 11, sense), CACTGGACCACCTGCAGCAGG ON-A31& (in the region homologous to human exon VI, antisense), CATGCACACTTGACAAC; and ON-H4c (in the region homologous to human exon VI, antisense), TGGTCTCATCTTCATGC. RESULTS

12091

FIG. 1. PCR analysis of the Coodpasture antigoo mRNA in human and bovine kidney cortex and rat kidney. RNA-PCR was performed on human kidney cortex total RNA using the primers, ON-HNC3rn, and ON-RHNClc and on bovine kidney cortex total RNA using the primers, ON-A3m and ON-A31Rc. On rat kidney t o t a l RNA, first strand cDNA synthesis was performed w i n g the primer ON-H4c andthen PCR was performed with the primers ON-HNC3m and ON-A31& in order to increase the specificity of the amplification. The PCR reaction productswere analyzed by agarow gel electrophoreRis (lane 1 , human; lane 2, bovine; lane 3, rat). Lane M contains a 100-bpmolecularweightmarkerladder (Pharmacia). Themarker band of 800 bp is indicated.

internal sequence encoded by exon 111. The clones derived from the smallest band contained a cDNA corresponding to only that species lacking the exon I11 sequence. These data suggested that the band moving in the range of 875 bp had been formed due to the cross-annealing of cDNA strands of the complete and spliced forms. In agreement with this hypothesis, S1 treatment resulted in the loss of this band and a n increase in the intensity of the 725-bp band (data not shown). Fromthesedata we concluded that at leasttwomajor Goodpasture-related transcripts are expressed in humankidney.

Expression of Goodpasture Ant2en mRNA Transcripts in been deIdentification by RNA-PCR of Two Goodpasture Antigen Other Species-Goodpasture syndromehasonly Transcripts in Human Kidney-We have previously charac- scribed in humans; therefore, it was of interest to determine whether or not similar RNA processing occurred in other terized the genomic structure of the six carboxyl-terminal of the triple helix closely related species. Using a3(IV)-specific oligonucleotide exons of a3(IV) encoding the carboxyl end was performed (8). primers frombovine and human, PCR analysis andthecompleteGoodpastureantigen(aS(1V)NCl) Using oligonucleotide primers at the extreme ends of this to analyzethecontent of thecorrespondingGoodpasture region (inexons I andVI), we attempted to analyze the antigen mRNA in bovine kidney cortex and rat kidney (Fig. 1, lanes 2 and 3, respectively). In contrast to the results found expression of Goodpasture antigen mRNA in human kidney in human, these experimentsrevealed a single DNA band, in cortex by PCR. Analysis of the PCR reaction products resize expected for the vealed a multiple band pattern upon agarose gel electropho- both bovine and rat tissues, with the to the amplification resis that, in addition to containing a DNA species of the complete Goodpasture antigen according to primers used. No other smaller molecular weight bands were expected size (904 bp), also contained bands corresponding lower molecular weight species of approximately 875 and725 detected. Southern blot analysis using the complete human bp (Fig. 1, lane 1 ) . In contrast, PCR performed directly on an Goodpasture antigen cDNA as a probe indicated that these were a3(IV) (data not a3(IV)-specific cDNA with the same primers yielded only one single bovine and rat DNA species band of the expected size indicating that the RNA-derived shown). Expression of Goodpasture Antigen mRNA inOther Human bands were not an artifactof the PCR reaction. The various bands were eluted from the gel, subcloned, and sequenced in Tissues and the Identificationof an Additional Spliced FormOnly two basement membranes, glomerular alveolar, and have order to determine whether the additional DNAs observed represented other Goodpasture-related transcripts. The been reported to be attacked by Goodpasture autoantibodies clones derived from the largest band yielded the expected (5). In order to determine if this tissue-specific targeting was cDNA sequence for the complete Goodpasture antigen (8). reflected in Goodpasture antigen mRNA expression,we anawhile the intermediate molecular weight band yielded two lyzed transcript levels in a variety of human tissues (Fig. 2). levels of Goodpasture cDNAs that corresponded to the complete antigenas well as Specifically, we foundsignificant a shorter one with the same 5'- and 3'-ends but lacking the mRNAs expressedin kidney, lung,suprarenal capsule, muscle,

12092

ho. 2. Hpmrn timeme dimtribution of the complete and spliced Goodpastare antigen forms. Total humanRNA was subjected to RNA-PCR using primers ON-HNC3mand ON-BNClc. The resulting PCR reaction products are shown for kidney ( l a n e 1 ), lung ( l a n e 2), suprarenal capsule ( l a n e 3), muscle ( l a n e 4 ) , spleen ( l a n e 5 ) , placenta ( l a n e 6 ) , mesangium ( l a n e 7), and skin ( l a n e 8). Lune M contains a 100-bp marker ladder (Pharmacia) in which the marker band of 800 bp is indicated. Similar results were obtained from, at least, two independently prepared samples.

and spleen. In each of these tissues, although the alternatively spliced mRNA form lacking exon 111-encoded sequence was present, the complete mRNA form was the most abundant. Furthermore, the ratio of the complete to spliced form appeared to be tissue-specific (Fig. 2). Using the same amplification conditions and oligonucleotide primers, we could not detect any a3(IV)mRNA transcripts in placenta, mesangium, and skin (Fig. 2, lanes 6-8) or in pleura and cultured umbilical endothelial cells (data not shown). Very low levels of each mRNA transcript were found in artery, fat, pericardium, and peripherical nerve (data not shown). The suprarenal capsule RNA-PCR band patterncontained three additional bands (approximately 800, 700, and 550 bp) not immediately apparent in other a3(IV)-expressingtissues (Fig. 2, lane 3). S1 nuclease treatment resulted in an increase in the abundance of the 550-bp band and a loss of the 800and 700-bp bands (datanot shown). Nucleotide sequence analysis of the 550-bp band identified it as representing an additional Goodpasture antigen mRNA species lacking both exon 111- and exon V-encoded sequence.The 800- and 700-bp bands were, therefore, probably the result of cross-annealing of cDNA chains representing the exon III/V-lacking mRNA with that of the complete form and the exon 111-lacking mRNA, respectively. From these data, we concluded that the Goodpasture antigen is expressed in a wide variety of tissues at specific ratios regardless of their involvement in the associated disorder and that at least two alternatively spliced mRNA forms exist in addition to the complete antigen mRNA. Comparison of Goodpasture Antigen Expression in Normal Human and Patient Kidney-In order to investigate whether there were differences in Goodpasture antigen mRNA transcription that could be correlated to the disease state, we obtained a kidney biopsy froma Goodpasture patient in which indirect immunofluorescence had revealed linear deposita of anti-glomerular basement membrane antibodies. RNAwas isolated from the patient kidney, subjected to PCR, and the resulting products were compared to those of a normal human kidney (Fig. 3). No major differences in the band pattern of

ho. 3. PCR d y e a i of Coodp..tPrs UI~~~OII mRNA in normal and Goodpasture kidney. Total RNA was subjected to RNAPCR under the same conditions as described in the legend to Fig. 2. Lune I contains the PCR products of normal human kidney; lane 2 contains those of a Goodpasture patient kidney. A 100-bp molecular weight marker is shown ( l a n e M )in which the marker band of 800 bp is indicated. Similar resultswere obtained with two normal human kidney samples and the RNA-PCR amplification was done, at least, five times. Because the extent of the cross-annealing between 904and 725-bp cDNA chains to yield the 875-bp band varied between individual PCR amplifications, the banding patterns showed some variation. However, the decreaee in the ratio of the 904-bp to the 725-bp band in the Goodpasture sample was constant and densitometrically tested.

the amplified material were observed when comparing normal and patientGoodpasture antigen mRNAs, indicating that the same complete and spliced forms exist in the affected organ. There was, however,a small but reproducible decrease in the ratio of the complete to exon 111-spliced form in the patient kidney (Fig. 3). Nucleotide sequencing revealed that the derived Goodpasture antigen primary structure from the affected patient organ was identical to that previously reported (8), suggestingthat if modifications exist in the antigen structure in the Goodpasture patient, they likely occurpost-translationally. Characteristicsof the mRNA and Derived Primary Structure of the Multiple Forms-The two shorter alternatively spliced mRNA forms identified result from the splicing out of exon I11 sequence in one case and of both exons I11 and V in the other (Fig. 4). The derived primary structure of each of the variant forms is, however, identical since the removal of exon I11 sequence results in a frameshift and early termination within the sequence encoded by exon IV (Fig. 4 and Table I). The primary structure of the complete and variant forms retains the region at the amino-terminal end containing cell adhesion and protein kinase recognition sites (8). Further examination of this amino-terminal sequence usingthe GCG package (Ref. 27, updated 1988) has also revealed an overlapping potential amidation site (K'GKR) fitting the consensus XG(R,K)(R,K). Due to the sequence alteration and truncation at the carboxyl end of the a3(IV)NC1, however, the variant forms lack the COOH-terminal region shown to contribute to the antigenic motif (9) as well as 11 of the 12 disulfide-bondedcysteines of the complete form (Table I). DISCUSSION

The primary transcripts of a large number ofgene% are known to undergo alternative splicing (for review, see Ref.

12093

Goodpasture Syndrome I

FIG.4. Schematicrepresentation of the structureof the complete and spliced Goodpasture antigen forms. Shown are the positions of the six carboxyl-terminal exons of the human a3(IV) gene within the intervening sequence (top of figure) andthe corresponding exon-encoded sequence included in the three primary transcripts described in this report. Complete (a), -exon I11 ( b ) ,and -exons I11 and V (c). The approximate length of the derived protein primary structure is shown in each case.

a.

I

IV

I1

I11

I11 V

111

v

I

I NHI

vI 1

IV

VI

VI

COOH

NHa

C.

VI

COOH

NH,

b.

V

I1

I

IV

I

VI

I

COOH

TABLE I Sequence features of the complete and spliced Goodpasture antigen forms Selected derived amino acid (aa) sequences of the complete and spliced forms of the Goodpasture antigen mRNA are shown from the putative collagenase cleavage site (8). These include the common region at the amino terminus containing cell adhesion, phosphorylation, and COOH-terminal a-amidation sites (underlined) and the differing sequence at the carboxyl terminus resulting from the presence or absence of sequence encoded by exon 111. Positions of cysteines (C) are noted. The 15 and27 amino acids at the amino and carboxyl side, respectively, of the cysteine common to both the complete and variant antigens are identical in all forms. Consensus sequences (referenced) and the corresponding sites in the Goodpasture antigen are shown. Both the complete and spliced forms share the indicated sites. The asterisks denote the position of the stop codon in the spliced forms or the phosphorylation or COOH-terminal a-amidation consensus sites. Form

.~~

Sequence-derivedbiological functions

Comdete (244 aa) ~

~

GLKGKRGDSGSPATWTTR.15aa.(C).27aa.GTLGS(C)LQRFT..(l72aa) Phosphorylation (KRXXS*

= KRGDS*, RXXS' = RGDS*, XS'PX = GS*PA)(33,34) Cell adhesion (RGD)(35) COOH-terminal or-amidation [X*G(R,K)(R,K) = K*GKR] (27) Immunopathogenicity Triple helix formation

Spliced (72 aa)

GLKGKRGDSGSPATWTTR.15aa.(C).27aa.DALFVKVLRSP*

28). Although many cases have been reported in which the precise function of the splicing event is unknown, two major, nonexclusive roles have been suggested to explain this biological phenomenon (28). The first is that alternative splicing acts as a way to control gene expression and the subsequent production of mature protein via the synthesis of nonfunctional protein or variant mRNAs of differing translational efficiency and/orstability. The second is that alternative splicing permits the synthesis of multiple proteins with diverse functions from a single gene. In humans, both fibrillar (type 11) and nonfibrillar collagens (types VI and XIII) have been found to undergo alternative splicing (11-17). In addition, several different mutations within the a-chains of collagen I have been reported to result in exon skipping associated with osteogenesis imperfecta and Ehler-Danlossyndrome type VI1 (18-21). In thispaper, we report alternativesplicing events involving the carboxyl-terminal domain of human a3(IV), also designated as the Goodpasture antigen. This domain is unique because of its pathogenic role in Goodpasture syndrome and also because of its highly hydrophilic amino-terminal region

Phosphorylation Cell adhesion COOH-terminal a-amidation

containing both cell adhesion and protein kinase recognition sites in an arrangement uncharacteristic of other collagen IV The splicing phenomenon described was detectchains (5,8). able only in humans and does not appear to involve any of the adjacent 650 bp of triple helix-encoding sequence? suggesting that this is also a unique feature of the NC1 domain of human a3(IV). Furthermore, no similar splicing patterns have been reported for any other humancollagen IV chain. The NC1 domain of collagens is involved in the alignment of individual a-chains to form molecules with the proper triple-helical structure, and thus, a(1V)-chains lacking the NC1 domain do not efficiently assemble into collagen IV molecules (29). Proper refolding of denatureda3(IV)NC1 domain is fully achieved upon removal of denaturing agents only if disulfide bridges are preserved (30), supporting the idea that these disulfide bonds are important in the maintenance of the nativestructure. This is reasonable since a disulfide knot at the carboxyl end of collagen I11 is required for the folding of this molecule (31, 32). NC1 disulfide bonds D. Bernal, S. Quinones, and J. Saus, unpublished results.

12094

Goodpasture Syndrome

have indeed been shown to be necessary for the formation of Merino for the protein computer analysis, Ignacio Pkrez-Roger for the Goodpasture antigen, since reduction results in the loss some of the figure preparation, and Vicente Rubio for the critical of reactivity with Goodpasture antibodies (1).The truncated reading of this manuscript. form of the Goodpasture antigen derived from the variant REFERENCES transcripts lacks the carboxyl end of the NC1 domain, includ1. Wieslander, J., Bygren, P., and Heinegard, D. (1984) Proc. Nutl. Acad. Sci. U. S. A. 81,1544-1548 ing 11 of the 12 disulfide bonded cysteines found in the 2. Kleppel, M. M., Michael, A. F., and Fish, A. J. (1986) J. BioL Chem. 2 6 1 , complete form (6-8). Therefore, it is expected that the trun16547-16552 3. Butkowski, R. J., Langeveld, J. P. M., Wieslander, J., Hamilton, J., and cated antigen should not function in triple helix formation Hudson, B. G. (1987) J. Bwl. Chem. 262,7874-7877 nor be reactive with Goodpasture antibodies. 4. Saus, J., Wieslander, J., Langeveld J. P. M., Quinones, S., and Hudson, B. G. (1988) J. Bid. Chem. 263,13'374-13380 A number of different roles for the alternative splicing of 5. Hudson, B. G., Wieslander, J., Wisdom, B. J., Jr., and Noelken, M.E. the Goodpasture antigen can be postulated. For example, the (1989) Lab. Inuest. 61,256-269 6. Morrlson, K. E., Mariyama, M., Yang-Feng, T. L., and Reeders, S. T. (1991) variant form of the Goodpasture antigen could hinder the Am. J. Hum. Genet. 49,545-554 formation of collagen IV molecules by competing with full7. Turner, N., Mason, P. J., Brown, R., Fox, M., Povey, S., Rees, A,, and Pusey, C. D. (1992) J. Clin. Inuest. 89,592-601 length chains. The existence of variant spliced transcripts at 8. Quinones, S., Bernal, D., Garcia-Sogo, M., Elena, S. F., and Saus,J. (1992) specific ratios in every tissue containing the complete form J. Biol. Chem. 2 6 7 , 19780-19784 9. Kalluri, R., Gunwar, S., Reeders, S. T., Morrison, K. C., Mariyama, M., suggests that this phenomenon could serve as a mechanism Ebner, K. E., Noelken, M. E., and Hudson, B. G. (1991) J. Bid. Chem. for tissue-specific regulation of the amount of mature collagen 266,24018-24024 B., Duetzmann, R., and Kuhn, K. (1988) Eur. J. Biochem. 1 7 6 , IV produced, or for determining collagen IV diversity and 10. Siebold, 617-624 Goodpasture reactivity within both single and different base- 11. Ryan, M. C., and Sandell, L. J. (1990) J. Biol. Chem. 266, 10334-10339 B., Stokes, D. G., Visaing, H., Timpl, R., and Chu, M. L. (1990) J. ment membranes (4). Alternatively, since the peptide se- 12. Saitta, Biol. Chern. 266,6473-6480 quence derived from the two variant transcripts carries the 13. Chu, M. L., Zhang, R. Z., Pan, T. C., Stokes, D., Conwa , D., Kuo, H. J., Glanville, R., Mayer, U., Mann, K., Deutzmann, R., andlTimp1, R. (1990) amino-terminal region containing the same cell adhesion and EMBO J. 9,385-393 phosphorylation consensus sites as the complete form (Table 14. Stokes, D. G., Saitta, B., Timpl, R., and Chu, M. L. (1991) J. Bwl. Chem. 266. - - ,Rfi26-8633 ---I), thisalternative RNA splicing could be a physiological 15. Pihlajaniemi, T., Myllyla, R., Seyer, J., Kurkinen, M., and Prockop, D. strategy to regulate the phosphorylation and cell attachment (1987) Proc. Nutl. Acud. Sci. U. S. A. 8 4 , 940-944 16. Tikka, L., Pihla'aniemi, T., Henttu, P., Prockop, D. J., and Tryggvason, K. of collagen IV independently of triple helix formation and (1988) Proc. k t l . Acud. Sci. U. S. A. 86, 7491-7495 secretion. 17. Pihlajaniemi, T., and Tamminen, M. (1990) J. Bid. Chem. 2 6 6 , 1692216928 The Goodpasture antigen is widely expressed in many or- 18. Bonadio, J., Ramirez, F., and Barr, M. (1990) J. Bbl. Chem. 266, 226299CQ gans regardless of their involvement in this disease and the D. J., Olsen, A., Kontusaari, S., Hyland, J., Ala-Kokko, L., Vasan, ratio of the three transcripts varies among organs. These 19. Prockop, N. S., Barton, E. Buck, S., Harrison, K., and Brent, R. L. (1990) Ann. N . Y. Acud. Sci. 680,330-339 differences may have important consequences in terms of D., D'Alessio, M., Ramirez, F., de Wet, W., Cole, W. G., Chan, D., collagen IV molecule composition, formation, and secretion 20. Weil, and Bateman, J. F. (1989) EMBOJ. 8, 1705-1710 Weil D., D'Alessio, M. Ramirez, F., Steinmann, B., Wirtz, M. K., Glanville, 21. as discussed above. In addition, the ratio between the comR.'W., and Holliste;, D. W. (1989) J. Bwl. Chern. 264,16804-16809 plete and exon I11 spliced forms is decreased in the Goodpas- 22. Chirgwin, J. J., Przbyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299 ture patient kidney studied. However, because of the limited 23. Messing, J. (1983) Methods Enzymol. 101,ZO-78 number of samples tested, it is premature to speculate as to 24. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Nutl. Acud. Sci. Li. S. A. 74,5463-5467 the possible role of this decrease in the pathogenesis of this 25. Bi gin, M. D., Gibson, T. J., and Hong, G. R. (1983) Proc. Nutl. Acud. Sci. disease. Additional quantitative analysis of the various a3(IV) b.S.S., A. 80,3963-3965 and Richardson, C. C. (1987) Proc. Natl. A d . Sci. Li. S. A. 8 4 , transcriptsand of the different collagenIVmolecules in 26. Tabor, 4767-4771 specific basement membranes from normal and affected in- 21. Devereux, J., Haeberly, P., and Smithies, 0. (1984) Nucleic Acids Res. 1 2 , 7u7-7ac. "". -"" dividuals together with studies on post-transcriptional regu- 28. Smith, C. W. J., Patton, J. G., and Nadal-Ginard, B. (1989) Ann. Reu. lation will be necessary to clarify these questions. Genet. 23,527-577 ~

~~~~~

""

l " "

Acknowledgments-We express our gratitude to Angels Fabra, Ger6nimo Forteza, Billy Hudson, Samuel Navarro-Fos, Joaquin OrtegaSerrano, Ramesh Saxena, and Jorgen Wieslander for providing tissues or cultured cells from normal or Goodpasture-affected individuals. Jorgen Wieslander also performed the indirect immunofluorescence on the kidney biopsy of the Goodpasture patient. Wealso thank Maria Jose Agull6 for her excellent technical assistance, Alejandro

29. Doh, R., Engel, J., and Kuhn, K. (1988) Eur. J. Biochem. 178,357-366 30. Wieslander, J., Langeveld, J., Butkowski, R., Jodlowski, M., Noelken, M., and Hudson, B. G. (1985) J. Bwl. Chem. 260,8564-8570 31. Bruckner, P., Bachmger, H. P., and Engel, J. (1978) Eur. J. Bwchem. 9 0 , c.auax 32. Bachinger, H. P., Bruckner, P., Timpl, R., Prockop, D. J., and Engel, J. (1980) Eur. J. Bzochem. 106,619-632 33. Kemp, B. E., and Pearson, R. B. (1990) Trends Biochem. Sci. 16,342-346 34. Tavlor. S. S.. Buechler. J. A.. and Yonemoto, W. (1990) Annu. Reu. Ewckm. 69,971-1005 35. Ruoslahti, E., and Pierschbacher, M. D. (1986) Cell 44,517-518

"-" -""