Planta (2007) 226:1277–1285 DOI 10.1007/s00425-007-0556-5
O R I G I N A L A R T I CL E
The isochorismate pathway is negatively regulated by salicylic acid signaling in O3-exposed Arabidopsis Daisuke Ogawa · Nobuyoshi Nakajima · Masanori Tamaoki · Mitsuko Aono · Akihiro Kubo · Hiroshi Kamada · Hikaru Saji
Received: 22 April 2007 / Accepted: 15 May 2007 / Published online: 23 June 2007 © Springer-Verlag 2007
Abstract Ozone (O3), a major photochemical oxidant, causes leaf injury in plants. Plants synthesize salicylic acid (SA), which is reported to greatly aVect O3 sensitivity. However, the mechanism of SA biosynthesis under O3 exposure remains unclear. Plants synthesize SA either by a pathway involving phenylalanine as a substrate or another involving isochorismate. To clarify how SA is produced in O3-exposed Arabidopsis, we examined the activities of phenylalanine ammonia lyase (PAL) and isochorismate synthase (ICS), which are components of the phenylalanine and isochorismate pathways, respectively. Exposure of Arabidopsis to O3 enhanced the accumulation of SA and the increase of ICS activity but did not aVect PAL activity. In sid2 mutants, which have a defect in ICS1, the level of SA and the activity of ICS did not increase in response to O3 exposure. These results suggest that SA is mainly synthesized from isochorismate in Arabidopsis. Furthermore, the level of ICS1 expression and the activity of ICS during O3 exposure elevated in plants deWcient for SA signaling (npr1 and eds5 mutants and NahG transgenics). Treatment of plants with SA also suppressed the enhancement of ICS1 expression by O3. These results suggest that SA synthesis is negatively regulated by SA signaling.
D. Ogawa · H. Kamada Graduate School of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8572, Japan D. Ogawa · N. Nakajima (&) · M. Tamaoki · M. Aono · A. Kubo · H. Saji Environmental Biology Division, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506, Japan e-mail:
[email protected]
Keywords Isochorismate synthase · Phenylalanine ammonia lyase Abbreviations 1-MCP 1-Methylcyclopropene CM Chorismate mutase ICS Isochorismate synthase PAL Phenylalanine ammonia lyase PPFD Photosynthetic photon Xux density SA Salicylic acid
Introduction The amount of toxic gaseous pollutants in the tropospheric environment has increased due to industrialization and urbanization since the beginning of 20th century. These toxic gases include ozone (O3), sulfur oxides, nitrogen oxides, peroxyacetyl nitrate, and Xuorides (Nouchi 2002). O3 is one of the most important air pollutants because it is highly reactive and because its concentration in the environment is increasing. In plants, O3 penetrates through the stomata and causes leaf damage, reducing the productivity of crops and forests (Preston and Tingey 1988). Plant hormones, such as salicylic acid (SA), begin to accumulate 3–4 h after O3 exposure in plants, including tobacco, Arabidopsis, and poplar (Yalpani et al. 1994; Sharma et al. 1996; Koch et al. 2000). Furthermore, a role of SA in the response to O3 has been suggested from studies of NahG transgenic plants, which do not accumulate SA because they overproduce an enzyme that converts SA into catechol. NahG transgenic Arabidopsis plants in the Col accession are more sensitive to O3 than the host Col plants. In contrast, NahG transgenic plants in the Cvi
123
1278
Planta (2007) 226:1277–1285
accession are more tolerant of O3 than the host Cvi plants (Rao and Davis 1999). These results suggest that in Arabidopsis SA has the roles to protect leaves from O3 damage and to enhance O3-induced cell death. On the other hand, O3 exposure causes less leaf damage to NahG transgenic tobacco plants than to the wild-type (Örvar et al. 1997), indicating that SA enhances O3-induced leaf damage in tobacco. Thus, SA seems to play a central role in the sensitivity of plants to O3. Previous studies have suggested that SA is synthesized exclusively from chorismate via prephenate, arogenate, phenylalanine, trans-cinnamic acid and benzoic acid in many plants, such as tobacco (Leon et al. 1993; Yalpani et al. 1993; Ribnicky et al. 1998; Ogawa et al. 2005a, b, 2006), rice (Silverman et al. 1995), cucumber (Meuwly et al. 1995), potato (Coquoz et al. 1998), and Arabidopsis (Mauch-Mani and Slusarenko 1996) (Fig. 1). Wildermuth et al. (2001), however, found that SA induction deWcient 2 (sid2) mutants which have a defect in isochorismate synthase 1 (ICS1) produce a lower level of SA than wild-type plants following pathogen attack. This indicated that Arabidopsis possesses a second pathway for synthesizing SA from chorismate via isochorismate in response to pathogen infection (Fig. 1). We have previously reported that O3 induces the synthesis of SA from phenylalanine in tobacco plants and that this response is enhanced by ethylene (Ogawa et al. 2005a). Despite the importance of SA, the mechanism of SA biosynthesis in O3-exposed Arabidopsis has not yet been investigated in detail. Here, we show that in O3exposed Arabidopsis SA is mainly synthesized from isochorismate and that SA level is negatively regulated by SA signaling.
chorismate mutase ( CM )
chorismate
prephenate
isochorismate synthase (ICS)
phenylalanine
isochorismate
pyruvate lyase
arogenate
phenylalanine ammonia lyase (PAL)
trans- cinnamic acid
benzoic acid benzoic acid 2-hydroxylase
salicylic acid (SA)
Fig. 1 Proposed pathways for SA biosynthesis. Arabidopsis mutant sid2, that have a defect in ICS1, does not accumulate SA in response to pathogen, implying that SA is synthesized from isochorismate pathway in Arabidopsis. However, there remains no genetic evidence supporting synthesis of SA from phenylalanine pathway
123
Materials and methods Plant materials and O3 treatment Arabidopsis thaliana (L.) Heynh accession Columbia (Col-0) seeds were provided from Dr Komeda (Tokyo University, Japan), etr1, ein2, npr1, and eds5 from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus, OH, USA), sid2 from Dr Nawrath and Dr Heck (University of Fribourg, Switzerland) and NahG in the Cvi accession from Syngenta Biotechnology (Research Triangle Park, NC, USA). Arabidopsis seeds were sown on blocks of glass wool (2–2.3 cm; Nittobo, Tokyo, Japan) and then kept at 4°C for 2 days for vernalization. The seedlings were then grown in a growth chamber at 25°C, 50–60% relative humidity, and with 14 h daily of lighting at a photosynthetic photon Xux density (PPFD) of 100 mol photons m¡2 s¡1 from white Xuorescent lamps. Plants were watered with liquid fertilizer (Hyponex 5-10-5, Osaka, Japan) diluted 2,000-fold in water. Sixteen-day-old Arabidopsis seedlings were exposed in a chamber to a single dose of 200 nl l¡1 O3 produced by an O3 generator (Sumitomo Seika Chemicals, Osaka, Japan). The exposure to O3 was carried out at 25°C, a relative humidity of 70%, and under continuous lighting at a PPFD of 100 mol photons m¡2 s¡1. Extraction and measurement of SA Salicylic acid was extracted from 0.2 g of 16-day-old Arabidopsis seedlings. Each sample was extracted with 1.5 ml of methanol. Five microliters of 1 mg ml¡1 m-hydroxybenzoic acid was added as an internal standard. After evaporating the mixture to dryness, the residue was dissolved in 150 l methanol; then 600 l of 1 mM KOH was added. Lipophilic substances were removed by extracting with chloroform. The aqueous phase was transferred to a new tube, and 10 l of phosphoric acid and 700 l of ethyl acetate were added. The solution was mixed and then centrifuged at 17,000g for 10 min. The supernatants were evaporated to dryness, and the residue was dissolved in 50% methanol and analyzed by high-performance liquid chromatography (System Gold, Beckman, Fullerton, CA, USA) with 20 mM sodium acetate (pH 2.5) containing 20% methanol as the mobile phase. SA was detected with a Xuorescence detector (RF-530, Shimadzu, Osaka, Japan) at excitation and emission wavelengths of 295 and 370 nm, respectively. Northern-blot analysis Total RNA from 16-day-old Arabidopsis seedlings was extracted using the sodium dodecyl sulfate–phenol
Planta (2007) 226:1277–1285
1279
method as described by Nakajima et al. (1995). For Northern-blot analysis, prehybridization and hybridization were performed as described by Tamaoki et al. (2003).
USA). The amount of protein was determined using a BCA protein assay kit (Pierce, Rockland, IL, USA).
Preparation of cDNA probes
Extraction and measurement of ICS were performed according to the method of Poulsen et al. (1991). Sixteen-day-old Arabidopsis seedlings were ground using a mortar and pestle in liquid nitrogen. Next, 0.3 g of the ground material was transferred to another mortar containing 0.05 g of polyvinylpolypyrrolidone and 0.8 ml of extraction buVer (0.1 M Tris– HCl, pH 7.5, 10% glycerol, 1 mM EDTA, and 1 mM DTT). After stirring, the homogenate was centrifuged at 10,000g for 30 min. The supernatant was desalted at 4°C using a NAP-10 column containing Sephadex G-25 (GE Healthcare) equilibrated with 0.1 M Tris–HCl (pH 7.5) containing 10% glycerol, 1 mM EDTA, and 1 mM DTT. A 250-l sample of the desalted solution was mixed with 250 l of a solution 0.1 M Tris–HCl (pH 7.5), 3 mM barium chorismate (Sigma, St Louis, MO, USA), and 15 mM MgCl2. After 1 h incubation at 30°C, isochorismate was quantiWed by the method of Young and Gibson (1969). Activity of ICS was linearly increased with amount of enzyme and the level of product was proportional to reaction time. The amount of protein was determined using a BCA protein assay kit.
Reverse transcription-PCR was used to generate cDNAs for ICS1, ICS2, CM1, CM2, CM3, PR-1, and PR-4 from total RNA obtained from O3-exposed Arabidopsis. Primers of RT-PCR were designed according to the published Arabidopsis cDNA sequences (Table 1). The ampliWed cDNAs were subcloned into the pGEM-T Easy system (Promega, Madison, WI, USA) and sequenced with an ALFred sequencer (GE Healthcare, Chalfont Giles, Buckinghamshire, UK). The cDNA fragments for PAL1, PAL2, and PAL3 were obtained from ABRC. The sequences of these cDNA fragments were conWrmed before use. Activity of PAL Activity of phenylalanine ammonia lyase (PAL) was measured as reported by Legrand et al. (1976) with minor modiWcations. Sixteen-day-old Arabidopsis seedlings were ground with a mortar and pestle in liquid nitrogen. Two hundred micrograms of the sample were transferred to another mortar containing 700 l of extraction buVer (0.1 M borate buVer, pH 8.8, and 5 mM mercaptoethanol). After stirring, the homogenate was centrifuged at 20,000g for 10 min. The supernatant was desalted in a NAP-10 Sephadex G-25 column (GE Healthcare) equilibrated with extraction buVer. All extraction steps were performed at 4°C. A 500-l sample of the desalted solution was mixed with 33 l of 2 mM phenylalanine containing 0.0925 MBq l-(U-14C) phenylalanine and incubated for 1 h at 37°C. The reaction was stopped by the addition of 33 l of 9 N sulfuric acid; then 500 l of toluene was added to extract trans-cinnamic acid. The radioactivity in the collected organic phase was measured using a 2500TR liquid scintillation analyzer (Hewlett-Packard, Palo Alto, CA,
Table 1 Primer sets for RT-PCR to obtain the probe
Activity of ICS
Treatment of plants with SA Sixteen-day-old seedlings were sprayed with 0.1 mM SA in 0.05% Tween-20. Control plants were sprayed with 0.05% Tween-20 alone. Treatment of plants with 1-methylcyclopropene Sixteen-day-old Arabidopsis plants were placed in a closed chamber (67 l) for 12 h with a tube containing 53.6 mg of 0.14% 1-methylcyclopropene (1-MCP) powder dissolved in 804 l of distilled water. The Wnal concentration of 1-MCP in the gas phase of the chamber was 500 pl l¡1.
Gene
Forward primer
Reverse
ICS1
GTTCCAATTGACCAGCAAATCGG
CTGAGGGACTGAAAAGTAAAATG
ICS2
GTACCAATTGAGCAGAAAATTGG
CTTCGGATTGATCTCCAGTCATC
CM1
TTCTTCCCTGTCAACGATCCAGC
TTAGCTTGGATGATTTCTGTCTC
CM2
ATGGCAAGAGTCTTCGAATCGGA
ATCTTCTACGTCGTCTCGATTGA
CM3
ATGGAGGCTAAGTTACTCAAACC
TTAATCCAGTCTTCTAAGCAAGT
PR-1
CTTTGTAGCTCTTGTAGGTGC
ACACCTCACTTTGGCACATCC
PR-4
AATGGATCCACAATGCGGTCGTCAAGG
AATGAATTCTTCTGGAATCAGGCTGCC
123
1280
Planta (2007) 226:1277–1285
Results Exposure of Arabidopsis to O3 causes a dramatic increase in the activity of ICS but not PAL We previously observed that the level of SA and the activity of ICS in Arabidopsis increase 6 h after exposure to 200 nl l¡1 O3 and that this does not occur in sid2 mutants (Ogawa et al. 2005a). These measurements, however, were made for a single time point, and the contributions of the isochorismate and phenylalanine pathways were not examined. Therefore, to investigate how SA is synthesized in Arabidopsis during O3 exposure, we examined the time dependant changes in the level of SA and the induction of enzymes involved in SA biosynthesis. In Arabidopsis, SA began to accumulate within 3 h after the start of O3 exposure. The level of SA peaked between 6 and 9 h, and then decreased (Fig. 2a). To examine the contribution of the two SA biosynthesis pathways in O3exposed Arabidopsis, we analyzed the expression of genes encoding chorismate mutase (CM1, CM2, CM3), PAL (PAL1, PAL2, PAL3), and ICS (ICS1, ICS2; Figs. 1, 2b). Two additional enzymes, benzoic acid 2-hydroxylase and pyruvate lyase, are involved in SA biosynthesis, but their genes have not been cloned in plants. We measured transcript levels in Arabidopsis during exposure to O3 by Northern-blot analysis. We detected transcripts for CM3, PAL1, PAL2, and ICS1 (Fig. 2b) but not those for CM1, CM2, PAL3, or ICS2. The level of the ICS1 transcript had greatly increased by 3 h after the start of O3 exposure and
123
a
Similar levels of SA are produced during O3 exposure in wild-type plants and ethylene-insensitive mutants of Arabidopsis We previously reported that endogenous ethylene enhances SA synthesis in O3-exposed tobacco by regulating the expression of CM and PAL (Ogawa et al. 2005a). Ethylene is a plant hormone synthesized in Arabidopsis during exposure to O3 (Rao et al. 2000; Overmyer et al. 2000; Tamaoki et al. 2003). To determine whether ethylene regulates SA biosynthesis in O3-exposed Arabidopsis, we examined the level of SA in etr1 and ein2 mutants, which have defects in ethylene signaling. The accumulation of SA during O3
b
3.5
0
-1
SA (µg g FW )
3
Ozone exposure time (h) 3 6 9 12
CM3
2.5 2
PAL1
1 .5 1
PAL2
0. 5 0
0
2 4 6 8 10 Ozone exposure time (h)
12
ICS1 EtBr
d PAL activity
250 200 1 50 100 50 0 0
2 4 6 8 10 12 Ozone exposure time (h)
-1
-1
30 0
(nmol mg protein h )
(ng mg protein -1 h -1 )
c ICS activity
Fig. 2 Ozone treatment increases the activity of ICS but not PAL in Arabidopsis. In all experiments, 16-day-old plants were exposed to 200 nl l¡1 O3 for up to 12 h. a Levels of SA in wild-type plants and sid2 mutants. b Northern-blot analysis of CM3, PAL1, PAL2, and ICS1 expression in O3-exposed Arabidopsis. The numbers indicate the hours after the start of O3 exposure. The row labeled “EtBr” indicates staining with ethidium bromide and shows that equal amounts of RNA were loaded in each lane. c Change in ICS activity during O3 exposure in wild-type plants and sid2 mutants. d Change in PAL activity during O3 exposure in wild-type plants and sid2 mutants. In a, c, and d, the results are mean values (n = 3) § SD. Closed circle indicates wild-type plants, Open square indicates sid2 mutants
decreased thereafter (Fig. 2b). There was a slight transient increase in the level of the PAL2 transcript by 3 h. The level of the CM3 and PAL1 transcripts was not increased by O3 treatment (Fig. 2b). Next, we measured the eVect of O3 on the activities of ICS and PAL. ICS activities in wild-type plants increased until 6 h after the start of O3 exposure and then decreased (Fig. 2c). In contrast, PAL activity in Arabidopsis decreased gradually during exposure to O3 (Fig. 2d). In sid2 mutants, which have a defect in ICS1, the level of SA and the activity of ICS did not increase during O3 exposure (Fig. 2a, c), but the decrease in PAL activity was similar to that observed in wild-type plants (Fig. 2d). These results suggest that in O3-exposed Arabidopsis SA is mainly synthesized by the isochorismate pathway rather than the phenylalanine pathway.
40 35 30 25 20 15 10 5 0
0
2 4 6 8 10 12 Ozone exposure time (h)
Planta (2007) 226:1277–1285
1281
signaling mutants. SpeciWcally, we examined the accumulation of SA by npr1, eds5, and NahG plants, which have deWciencies in pathogen-induced SA signaling. Previous studies have shown that following infection, npr1 but not the eds5 and NahG plants are able to accumulate SA (Cao et al. 1997; Lawton et al. 1995; Nawrath et al. 2002). We found that the npr1 mutants accumulated a higher level of SA than wild-type plants 6 and 12 h after the start of O3 exposure, whereas the SA level did not increase in the eds5 and NahG plants (Fig. 3). Thus, the level of SA appears to be regulated by SA signaling in O3-exposed Arabidopsis. We next investigated ICS1 expression and ICS activity in SA signaling-deWcient plants. The npr1, eds5, and NahG plants had much lower SA-inducible PR-1 expression in response to O3 exposure (Fig. 5a), indicating that SA signaling during O3 exposure is deWcient in npr1, eds5, and NahG plants. The expression of ICS1 in wildtype, npr1, eds5, and NahG plants was similar 3 h after the start of O3 exposure, whereas at 6 and 12 h, the expression in the SA signaling-deWcient plants was higher than in the wild-type plants (Fig. 5a). Furthermore, 3 h after the start of O3 exposure, the increase in the activity of ICS was similar in the SA signaling-deWcient and the wild-type plants, whereas the activity in the SA signaling-deWcient plants at 6 and 12 h was signiWcantly higher than wild-type plants (Fig. 5b). These results show that SA signaling-deWcient plants accumulate more ICS1 transcript and have higher ICS activity during O3 exposure than the wild-type plants, implying that SA signaling negatively regulates the level of ICS1 expression in Arabidopsis. To conWrm the negative eVect of SA signaling on the level of ICS1 expression, we measured ICS1 expression and ICS activity in O3-exposed Arabidopsis treated with or without SA. The induction of ICS1 expression in O3exposed Arabidopsis was suppressed by treatment with SA (Fig. 6a). In addition, the increase in ICS activity 3 and 6 h
16 14
SA (µg g FW -1 )
12 10 8 6 4 2 0
WT
etr1
ein2
npr1
eds5
Na h G
Fig. 3 Accumulation of SA during O3 exposure in ethylene or SA signaling-deWcient mutants. The levels of SA in wild-type, etr1, ein2, npr1, eds5, and NahG plants are shown. Sixteen day-old plants were exposed to 200 nl l¡1 O3 for up to 12 h. White bars indicate 0 h; hatched bars indicate 6 h; black bars indicate 12 h. The results are mean values (n = 3) § SD. The mean values marked with an asterisk are signiWcantly diVerent than in the respective control plants (P < 0.01)
exposure was similar in wild-type plants and ethylene-insensitive mutants (Fig. 3). We also examined SA synthesis in plants treated with 1-MCP, an inhibitor of the ethylene receptor. The expression of PR-4, a marker of ethylene signaling, was lower during O3 exposure in plants pretreated with 1-MCP than in control plants (Fig. 4a), conWrming that ethylene signaling was blocked by 1-MCP. The level of SA, however, was similar in control and 1-MCP-pretreated plants (Fig. 4b). These results suggest that ethylene does not aVect the synthesis of SA in Arabidopsis during exposure to O3. ICS1 expression and ICS activity during O3 exposure are increased in SA signaling-deWcient plants To clarify how the level of SA is regulated in Arabidopsis exposed to O3, we examined SA accumulation in SA
b 3.5 -1
SA (µg g FW )
3
a Control 0
3
6 12 0
1-MCP 3
6 12
(h)
PR-4
2.5 2 1.5 1 0.5
EtBr
0 6 12 0 Ozone exposure time (h)
Fig. 4 1-Methylcyclopropene does not aVect O3-induced accumulation of SA. Sixteen day-old plants were exposed to 200 nl l¡1 O3 for 12 h. Numbers show the hours after the start of O3 exposure. a Northern-blot analysis of PR-4 expression in O3-exposed Arabidopsis pretreated with or without 1-MCP. The row labeled “EtBr” indicates
staining with ethidium bromide and shows that equal amounts of RNA were loaded in each lane. b Levels of SA in O3-exposed Arabidopsis pretreated with or without 1-MCP. White bars indicate control plants; gray bars indicate 1-MCP-pretreated plants. The results are mean values (n = 3) § SD
123
1282
Planta (2007) 226:1277–1285
(a)
(b)
npr1 WT 0 3 6 12 0 3 6 12 (h)
700 600
(ng mg protein h )
ICS1
500
ICS1
-1
-1
WT eds5 0 3 6 12 0 3 6 12 (h)
ICS activity
PR-1 EtBr
400 300 200
PR-1
100
EtBr
0 0
WT NahG 0 3 6 12 0 3 6 12 (h)
3 6 12 Ozone exposure time (h)
ICS1 PR-1 EtBr Fig. 5 The defect of SA signaling enhances O3-induced increase in ICS1 transcripts and ICS activity. Sixteen day-old plants were exposed to 200 nl l¡1 O3 for 12 h. a Northern-blot analysis of ICS1 and PR-1 expression in O3-exposed wild-type, npr1, eds5, and NahG plants. Numbers show the hours after the start of O3 exposure. The row labeled “EtBr” indicates staining with ethidium bromide and shows that equal
amounts of RNA were loaded in each lane. b ICS activity in O3-exposed wild-type (white bars), npr1 (hatched bars), eds5 (gray bars), and NahG plants (black bars). The results are mean values (n = 3) § SD. The mean values marked with an asterisk are signiWcantly diVerent than in the respective control plants (P < 0.01)
b
a
-SA 0
3
+S A 6
3
6
(h)
ICS1
EtBr
-1
ICS activity
-1
(ng mg protein h )
200
150 100
50 0
0 6 3 Ozone exposure time (h)
Fig. 6 Treatment with SA suppresses the increase in ICS1 transcripts and ICS activity induced by O3 exposure. Sixteen day-old plants were exposed to 200 nl l¡1 O3 for 6 h. a Northern-blot analysis of ICS1 expression during O3 exposure in Arabidopsis plants treated with (plus) or without (minus) SA. Numbers indicate the hours after the start of O3 exposure. The row labeled “EtBr” indicates staining with ethi-
dium bromide and shows that equal amounts of RNA were loaded in each lane. b ICS activity during O3 exposure in Arabidopsis plants treated with (gray bars) or without (white bars) SA. The results are mean values (n = 3) § SD. The mean values marked with an asterisk are signiWcantly diVerent than in the respective control plants (P < 0.01)
after the start of O3 exposure was signiWcantly reduced by SA (Fig. 6b). These results suggest that SA signaling reduces the level of SA in Arabidopsis by suppressing O3 induction of ICS1 expression.
O3 exposure. Furthermore, the level of SA and the ICS activity increased in O3-exposed wild-type but not sid2 mutants. These results suggest that the isochorismate pathway is important for SA biosynthesis in O3-exposed Arabidopsis. Is the phenylalanine pathway used for SA biosynthesis in O3-exposed Arabidopsis? We previously reported that essentially all of the SA is synthesized by the phenylalanine pathway in O3-exposed tobacco plants (Ogawa et al. 2005a). In that report, we showed that the expression of PAL genes and the enzyme activity of PAL are markedly
Discussion In this study, we examined the pathway by which SA is synthesized in O3-exposed Arabidopsis. The expression of ICS1 and the activity of ICS were greatly increased during
123
Planta (2007) 226:1277–1285
increased in O3-exposed tobacco plants. In Arabidopsis, however, the activity of PAL was not increased in response to O3 exposure, although there was a slight increase in the amount of PAL2 transcript. Therefore, the phenylalanine pathway does not appear to make a substantial contribution to SA biosynthesis in O3-exposed Arabidopsis. Salicylic acid is reported to be synthesized by the phenylalanine pathway in many kinds of plants. Arabidopsis was the Wrst reported example of a plant that synthesizes SA via the isochorismate pathway (Wildermuth et al. 2001). A gene encoding ICS (AJ006065) has been isolated and ICS has been puriWed from cell cultures of Catharanthus roseus (van Tegelen et al. 1999). Also, putative ICS genes have been found in rice (AP008215), tobacco (AY740529), tomato (DQ149918), and hot pepper (AY743431), although whether the isochorismate pathway is used for SA biosynthesis in these plants has not been reported. Therefore, Arabidopsis is currently the only plant in which SA is known to be synthesized via the isochorismate pathway. In Pseudomonas aeruginosa, PchA, which is identical to ICS, limits the production of SA, suggesting that ICS is the rate-limiting enzyme for SA biosynthesis in bacteria (Gaille et al. 2003). In Arabidopsis, the peak of ICS1 expression, ICS activity, and accumulation of SA occur about 3, 6, and 9 h after the start of O3 exposure, respectively, indicating that SA accumulation accompanies an increase in ICS1 expression and ICS activity. In addition, npr1 mutants, which has enhanced O3-induced ICS activity, exhibited a higher level of SA during O3 exposure, indicating that accumulation of SA is associated with an increase in ICS activity. Therefore, it is likely that ICS is the rate-limiting enzyme for SA biosynthesis in Arabidopsis. Similar levels of SA were produced during O3 exposure in wild-type plants and ethylene-insensitive mutants etr1 and ein2. Furthermore, control and 1-MCP-pretreated plants accumulated similar levels of SA during O3 exposure, even though 1-MCP inhibited ethylene signaling. These results suggest that ethylene does not play a signiWcant role in the regulation of SA biosynthesis during O3 exposure in Arabidopsis. Our current conclusions conXict with the results of Rao et al. (2002), who reported that ethylene-overproducing mutants eto1 and eto3 accumulate higher levels of SA than wild-type plants in response to O3 exposure. We interpret their experimental data as follows. O3 induces the generation of reactive oxygen species in leaves. Also, O3-induced cell death indirectly causes the generation of massive amounts of reactive oxygen species in damaged leaves. Rao et al. (2002) showed that O3 caused leaf injury in eto1 and eto3 mutants but not in wild-type plants in their report. A high level of SA may be accumulated in eto1 and eto3 mutants during O3 exposure because of the induction of cell death and exposure to a high level of reactive oxygen
1283
species (Rao et al. 2002; Tamaoki et al. 2003). On the other hand, in our experiments, O3 treatment did not cause leaf injury in wild-type, etr1, ein2, or 1-MCP-pretreated Arabidopsis plants (data not shown). This indicates that we checked the eVect of ethylene on SA biosynthesis during O3 exposure without the inXuence of leaf injury. Therefore, it is reasonable to conclude that the level of SA is not regulated by ethylene in O3-exposed Arabidopsis when O3 exposure does not generate leaf injury. The npr1 mutants accumulated a higher level of SA than wild-type plants during O3 exposure. Also, the expression of ICS1 and the ICS activity in npr1, eds5, and NahG plants was elevated starting about 6 h after the initiation of O3 exposure. In addition, treatment with SA inhibited both the increase of ICS1 expression and ICS activity induced by O3 exposure in wild-type Arabidopsis. These results suggest that SA synthesis in Arabidopsis is negatively regulated by SA signaling and that NPR1 participates in this process. It has been reported that pathogen infection causes the accumulation of higher levels of ICS1 mRNA and SA in npr1 mutants than in wild-type plants (Wildermuth et al. 2001), supporting the idea that NPR1 is a negative regulator of ICS1 expression. In contrast to our current results, pathogen infection was reported to have little eVect on the expression of ICS1 in NahG transgenic plants (Wildermuth et al. 2001), which implies that ICS1 expression in pathogeninfected plants is regulated by partially diVerent mechanisms than those that regulate it in O3-exposed plants. Why did Arabidopsis develop machinery for negatively regulating SA biosynthesis? Studies of transgenic and mutants show that excessive accumulation of SA is detrimental to the growth and development of Arabidopsis. For example, in transgenic Arabidopsis constitutively expressing bacterial pchB and pchA, which encode pyruvate lyase and ICS, respectively, the amount of SA is elevated more than 20-fold compared to the wild-type, and the plants display dwarf phenotypes (Mauch et al. 2001). Also, dwarf phenotypes, lesions, or both are observed in Arabidopsis mutants that constitutively produce high levels of SA, such as constitutive expresser of PR genes (cpr1, cpr5, and cpr6), constitutive immunity (cim5-7 and cim9-14), mpk4, lesions simulating disease, and constitutively activated cell death (Bowling et al. 1994, 1997; Clarke et al. 1998; Petersen et al. 2000; Maleck et al. 2002; Morita-Yamamuro et al. 2005). These Wndings suggest that negative regulation by SA signaling must have been developed to reduce SA biosynthesis. Intriguingly, a high level of SA accumulates in rice under nonstressed conditions. This is reported to be important for resistance to pathogens and oxidative stress (Silverman et al. 1995; Yang et al. 2004). We are interested in determining why Arabidopsis, unlike rice, does not grow at high SA levels and whether the role of SA diVers between plant species.
123
1284
In conclusion, this is the Wrst report that SA is mainly synthesized from the isochorismate pathway rather than the phenylalanine pathway in O3-exposed Arabidopsis. Furthermore, we showed that the biosynthesis of SA is negatively regulated by SA signaling. Which SA signaling components in addition to NPR1 participate in suppressing ICS1 expression remains unknown. Accordingly, additional studies are needed to elucidate the detailed mechanism of this negative feedback regulation. Acknowledgments We thank Christiane Nawrath and Silvia Heck (University of Fribourg, Switzerland) for providing the sid2 mutant, Yoshifumi Komeda (Tokyo University, Japan) for providing Col-0 accession of Arabidopsis, Arabidopsis Biological Resource Center (Ohio State University, Columbus, NC, USA) for providing several mutants and cDNAs, and Syngenta Biotechnology inc. (Research Triangle Park, NC, USA) for providing NahG. We also gratefully acknowledge the skillful technical assistance of Hideko Watanabe, Katsumi Matsumoto, Yukiko Matsumoto, Teruko Okubo, and the O3 chamber administrator, Yoshimitsu Takimoto.
References Bowling SA, Guo A, Cao H, Gordon AS, Klessig DF, Dong X (1994) A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6:1845–1857 Bowling SA, Clarke JD, Liu Y, Klessig DF, Dong X (1997) The cpr5 mutant of Arabidopsis expresses both NPR1-dependent and NPR1- independent resistance. Plant Cell 9:1573–1584 Cao H, Glazebrook J, Clarke JD, Volko S, Dong X (1997) The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88:57–63 Clarke JD, Liu Y, Klessig DF, Dong X (1998) Uncoupling PR gene expression from NPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1 mutant. Plant Cell 10:557– 569 Coquoz J, Buchala A, Metraux JP (1998) The biosynthesis of salicylic acid in potato plants. Plant Physiol 117:1095–1101 Gaille C, Reimmann C, Haas D (2003) Isochorismate synthase (PchA), the Wrst and rate-limiting enzyme in salicylate biosynthesis of Pseudomonas aeruginosa. J Biol Chem 278:16893–16898 Koch JR, Creelman RA, Eshita SM, Seskar M, Mullet JE, Davis KR (2000) Ozone sensitivity in hybrid poplar correlates with insensitivity to both salicylic acid and jasmonic acid. The role of programmed cell death in lesion formation. Plant Physiol 123:487– 496 Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals J (1995) Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol Plant Microbe Interact 8:863–870 Legrand M, Fritig B, Hirth L (1976) Enzyme of the phenylpropanoid pathway and the necrotic reaction of hypersensitive tobacco to tobacco mosaic virus. Phytochem 15:1353–1359 Leon J, Yalpani N, Raskin I, Lawton MA (1993) Induction of benzoic acid 2-hydroxylase in virus-inoculated tobacco. Plant Physiol 103:323–328 Maleck K, Neuenschwander U, Cade RM, Dietrich RA, Dangl JL, Ryals JA (2002) Isolation and characterization of broad-spectrum disease-resistant Arabidopsis mutants. Genetics 160:1661–1671 Mauch F, Mauch-Mani B, Gaille C, Kull B, Haas D, Reimmann C (2001) Manipulation of salicylate content in Arabidopsis thaliana by the expression of an engineered bacterial salicylate synthase. Plant J 25:67–77
123
Planta (2007) 226:1277–1285 Mauch-Mani B, Slusarenko AJ (1996) Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of Arabidopsis to Peronospora parasitica. Plant Cell 8:203–212 Meuwly P, Molders W, Buchala A, Metraux JP (1995) Local and systemic biosynthesis of salicylic acid in infected cucumber plants. Plant Physiol 109:1107–1114 Morita-Yamamuro C, Tsutsui T, Sato M, Yoshioka H, Tamaoki M, Ogawa D, Matsuura H, Yoshihara T, Ikeda A, Uyeda I, Yamaguchi J (2005) The Arabidopsis gene CAD1 controls programmed cell death in the plant immune system and encodes a protein containing a MACPF domain. Plant Cell Physiol 46:902–912 Nakajima N, Saji H, Aono M, Kondo N (1995) Isolation of cDNA for a plasma membrane H+-ATPase from guard cells of Vicia faba L. Plant Cell Physiol 36:919–924 Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essential component of salicylic acid-dependent signaling for disease resistance in Arabidopsis, is a member of the MATE transporter family. Plant Cell 14:275–286 Nouchi I (2002) Responses of whole plants to air pollutants. In: Omasa K, Saji H, YousseWan S, Kondo N (eds) Air pollution and plant biotechnology. Springer, Tokyo, pp 3–26 Ogawa D, Nakajima N, Sano T, Tamaoki M, Aono M, Kubo A, Kanna M, Ioki M, Kamada H, Saji H (2005a) Salicylic acid accumulation under O3 exposure is regulated by ethylene in tobacco plants. Plant Cell Physiol 46:1062–1072 Ogawa D, Nakajima N, Sano T, Tamaoki M, Aono M, Kubo A, Kamada H, Saji H (2005b) Regulation of salicylic acid synthesis in ozone-exposed tobacco and Arabidopsis. Phyton 45:169–175 Ogawa D, Nakajima N, Seo S, Mitsuhara I, Kamada H, Ohashi Y (2006) The phenylalanine pathway is the main route of salicylic acid biosynthesis in tobacco mosaic virus -infected tobacco leaves. Plant Biotechnol 23:395–398 Örvar BL, McPherson J, Ellis BE (1997) Pre-activating wounding response in tobacco prior to high-level ozone exposure prevents necrotic injury. Plant J 11:203–212 Overmyer K, Tuominen H, Kettunen R, Betz C, Langebartels C, Sandermann H, Kangasjarvi J (2000) Ozone-sensitive Arabidopsis rcd1 mutant reveals opposite roles for ethylene and jasmonate signaling pathways in regulating superoxide-dependent cell death. Plant Cell 12:1849–1862 Petersen M, Brodersen P, Naested H, Andreasson E, Lindhart U, Johansen B, Nielsen HB, Lacy M, Austin MJ, Parker JE, Sharma SB, Klessig DF, Martienssen R, Mattsson O, Jensen AB, Mundy J (2000) Arabidopsis MAP kinase 4 negatively regulates systemic acquired resistance. Cell 103:1111–1120 Poulsen C, Vanderheijden R, Verpoorte R (1991) Assay of isochorismate synthase from plant-cell cultures by high-performance liquid chromatography. Phytochem 30:2873–2876 Preston EM, Tingey DT (1988) The NCLAN program for crop loss assessment. In: Heck WW (ed) Assessment of crop loss from air pollution. Elsevier Applied Science Publishers, London, pp 45–62 Rao MV, Davis KR (1999) Ozone-induced cell death occurs via two distinct mechanisms in Arabidopsis: the role of salicylic acid. Plant J 17:603–614 Rao MV, Lee H, Creelman RA, Mullet JE, Davis KR (2000) Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12:1633–1646 Rao MV, Lee H, Davis KR (2002) Ozone-induced ethylene production is dependent on salicylic acid, and both salicylic acid and ethylene act in concert to regulate ozone-induced cell death. Plant J 32:447–456 Ribnicky DM, Shulaev V, Raskin I (1998) Intermediates of salicylic acid biosynthesis in tobacco. Plant Physiol 118:565–572 Sharma YK, Leon J, Raskin I, Davis KR (1996) Ozone-induced responses in Arabidopsis thaliana: the role of salicylic acid in the
Planta (2007) 226:1277–1285 accumulation of defense-related transcripts and induced resistance. Proc Natl Acad Sci USA 93:5099–5104 Silverman P, Seskar M, Kanter D, Schweizer P, Metraux JP, Raskin I (1995) Salicylic acid in rice (biosynthesis, conjugation, and possible role). Plant Physiol 108:633–639 Tamaoki M, Matsuyama T, Kanna M, Nakajima N, Kubo A, Saji H (2003) DiVerential ozone sensitivity among Arabidopsis accessions and its relevance to ethylene synthesis. Planta 216:552–560 van Tegelen LJ, Moreno PR, Croes AF, Verpoorte R, Wullems GJ (1999) PuriWcation and cDNA cloning of isochorismate synthase from elicited cell cultures of Catharanthus roseus. Plant Physiol 119:705–712 Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defense. Nature 414:562–565
1285 Yalpani N, Leon J, Lawton MA, Raskin I (1993) Pathway of salicylic acid biosynthesis in healthy and virus-inoculated tobacco. Plant Physiol 103:315–321 Yalpani N, Enyedi AJ, Leon J, Raskin I (1994) Ultraviolet-light and ozone stimulate accumulation of salicylic acid, pathogenesis-related protein and virus-resistance in tobacco. Planta 193:372–376 Yang Y, Qi M, Mei C (2004) Endogenous salicylic acid protects rice plants from oxidative damage caused by aging as well as biotic and abiotic stress. Plant J 40:909–919 Young IG, Gibson F (1969) Regulation of the enzymes involved in the biosynthesis of 2,3-dihydroxybenzoic acid in Aerobacter aerogenes and Escherichia coli. Biochim Biophys Acta 177:401–411
123
