TRANSLATIONAL AND CLINICAL RESEARCH The Kynurenine Pathway of Tryptophan Degradation is Activated During Osteoblastogenesis CHRISTOPHER VIDAL,a WEI LI,a BRIGITTE SANTNER-NANAN,b CHAI K. LIM,c,d GILLES J. GUILLEMIN,c,d HELEN J. BALL,e NICHOLAS H. HUNT,e RALPH NANAN,b GUSTAVO DUQUEa Key Words. Osteoblastogenesis • Mesenchymal stem cells • Interferon gamma • Osteoporosis Picolinic acid • Kynurenine
a
Musculoskeletal Ageing Research Program and b Nepean Center for Perinatal Care, Sydney Medical School Nepean, Penrith, New South Wales, Australia; cThe Australian School of Advanced Medicine, Macquarie University, Sydney, New South Wales, Australia; d Department of Pharmacology, School of Medical Sciences, University of New South Wales, Sydney, New South Wales, Australia; e Molecular Immunopathology Unit, Discipline of Pathology, School of Medical Sciences and Bosch Institute, The University of Sydney, Sydney, New South Wales, Australia Correspondence: Gustavo Duque, Ph.D., M.D., F.R.A.C.P., Sydney Medical School Nepean, Level 5, South Block, Nepean Hospital, Penrith, New South Wales 2750, Australia. Telephone: 61-2-47344278; Fax: 61-2-47341817; e-mail: gustavo.
[email protected] Received April 16, 2014; accepted for publication August 1, 2014; first published online in STEM CELLS EXPRESS September 3, 2014. C AlphaMed Press V
1066-5099/2014/$30.00/0 http://dx.doi.org/ 10.1002/stem.1836
•
ABSTRACT The mechanisms involved in the anabolic effect of interferon gamma (IFNc) on bone have not been carefully examined. Using microarray expression analysis, we found that IFNc upregulates a set of genes associated with a tryptophan degradation pathway, known as the kynurenine pathway, in osteogenic differentiating human mesenchymal stem cells (hMSC). We, therefore, hypothesized that activation of the kynurenine pathway plays a role in osteoblastogenesis even in the absence of IFNc. Initially, we observed a strong increase in tryptophan degradation during osteoblastogenesis with and without IFNc in the media. We next blocked indoleamine 2,3dioxygenase-1 (IDO1), the most important enzyme in the kynurenine pathway, using a siRNA and pharmacological approach and observed a strong inhibition of osteoblastogenesis with a concomitant decrease in osteogenic factors. We next examined the bone phenotype of Ido1 knockout (Ido12/2) mice. Compared to their wild-type littermates, Ido12/2 mice exhibited osteopenia associated with low osteoblast and high osteoclast numbers. Finally, we tested whether the end products of the kynurenine pathway have an osteogenic effect on hMSC. We identified that picolinic acid had a strong and dose-dependent osteogenic effect in vitro. In summary, we demonstrate that the activation of the kynurenine pathway plays an important role during the commitment of hMSC into the osteoblast lineage in vitro, and that this process can be accelerated by exogenous addition of IFNc. In addition, we found that mice lacking IDO1 activity are osteopenic. These data therefore support a new role for the kynurenine pathway and picolinic acid as essential regulators of osteoblastogenesis and as potential new targets of bone-forming cells in vivo. STEM CELLS 2015;33:111–121
INTRODUCTION Osteoporosis imposes a significant burden on the quality of life of older persons. Approximately 25% of those who sustain a hip fracture die within 12 months postfracture and another 50% suffer some level of dependence in their activities of daily living [1], thus representing a significant burden to health care budgets worldwide. Although treating osteoporosis to prevent fractures is an issue of major importance to human health, therapeutic options are limited. Therefore, research initiatives focusing on the development of novel therapeutic approaches, especially those that involve bone formation [2], are urgently needed. Interferon gamma (IFNc) is one of the potential bone anabolics that recently have been reported to stimulate osteoblastogenesis and bone formation while inhibiting adipogenesis both in vitro and in vivo [3–5]. We have
STEM CELLS 2015;33:111–121 www.StemCells.com
previously reported that exogenous addition of IFNc accelerated human mesenchymal stem cells (hMSC) differentiation into osteoblasts in a dose-dependent manner [3]. IFNc also induced high levels of the essential osteogenic transcription factor runt-related transcription factor 2 (RUNX2) expression during the early phase of differentiation. In addition, we reported that IFNc inhibits adipogenesis in hMSC through the inhibition of peroxisome proliferator-activated receptor gamma both in vitro and in vivo [5]. However, despite this solid body of data, the molecular mechanisms explaining this anabolic effect of IFNc on bone remained poorly understood. Considering the important role of IFNc in the innate immune response against intracellular infection and in the regulation of adaptive immune responses, it was pivotal to identify whether the anabolic effect of IFNc is exerted through either an immune-related mechanism or through a new or classic osteogenic C AlphaMed Press 2014 V
Kynurenine Pathway and Osteoblastogenesis
112
pathway. Therefore, we examined the action of IFNc on osteogenic differentiating hMSC and compared this to its effect on immune cells (Jurkat and T lymphocytes) using a cDNA array approach. We found that the osteogenic effect of IFNc had a very specific gene-targeting profile that differed significantly from its well-known immunogenic effect [6]. Interestingly, we observed that the osteogenic effect of IFNc was mostly exerted through the activation of indoleamine 2,3-dioxygenase (IDO1), an enzyme that activates the alternative tryptophan (TRP) degradation pathway known as the kynurenine (KYN) pathway [7]. These results lead us to investigate the role of this pathway in osteoblastogenesis and bone formation. TRP is an amino acid with several important functions. A small amount of dietary TRP (approximately 3%) is converted into niacin (vitamin B3) by the liver. This conversion can help to prevent the symptoms associated with niacin deficiency when dietary intake of this vitamin is low [8]. In addition, TRP serves as a precursor for serotonin, a neurotransmitter produced in the brain and gut that regulates mood, appetite, sleep patterns, and gut motility [9, 10]. Yadav et al. [11, 12] recently have reported a new role of TRP metabolites in bone metabolism. Their group also reported that gut-derived serotonin (GDS) inhibits osteoblast differentiation and bone formation [13, 14]. Based on their results, they also proposed that pharmacological inhibition of GDS could constitute a novel approach to osteoporosis treatment [11, 12]. However, the applicability of this theory remains highly controversial [15]. While the role of serotonin in bone metabolism has been extensively studied [13, 14], the knowledge on the role of the KYN pathway and its end products in bone is very limited. This pathway metabolizes 95% of the dietary TRP, starting with the activation of IDO1, followed by conversion of TRP into KYN, which is then converted into quinolinic acid (QA) or picolinic acid (PA), two compounds with a strong effect on glutamate receptors in peripheral tissues and that have been associated with cell differentiation and regulation of oxidative stress [16–18]. Interestingly, only two studies have looked at the association between elements of the KYN pathway and bone metabolism. A recent study by Apalset et al. [19] correlated serum levels of IFNc-induced kynurenines with bone mineral density (BMD) of middle aged (46–49 years) and older (71–74 years) participants (n 5 5,312). The authors report that higher BMD is associated with high serum concentrations of two IFNc-induced kynurenines, xanthurenic acid, and 3-hydroxyanthranilic acid in both groups. A second study by Forrest et al. [20] looked at markers of oxidative stress and concentrations of KYN pathway metabolites in the plasma of patients with osteoporosis before and after treatment with raloxifene or etidronate for 2 years. They report that TRP metabolism is altered in osteoporosis in a manner that could contribute to the progress of the disease. Considering that our data suggested an important role of the KYN pathway in hMSC differentiation, we therefore hypothesized that this pathway and its metabolites could be essential factors in osteoblastogenesis and bone formation—a role that could be potentiated by IFNc. To test this hypothesis, in this study we examined the potential role of the activation of this alternative pathway of TRP degradation in bone formation both in vivo and in vitro. Our data not only help to understand the mechanism of action of IFNc on osteoblastoC AlphaMed Press 2014 V
genesis but also assess a potentially new bone-forming approach to osteoporosis through a previously unknown anabolic pathway.
MATERIALS
AND
METHODS
Materials Metabolites of the KYN pathway (TRP, L-KYN, PA, and QA) and chemical reagents used in high-pressure liquid chromatography (HPLC) and gas chromatography/mass spectrometry (GC/MS) were of analytical grade obtained from Sigma-Aldrich (St. Louis, MO, http://www.sigmaaldrich.com/). All antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, http://www.scbt.com) and were used according to the manufacturer’s recommended concentrations. A pharmacological inhibitor of IDO1 (1-methyl-D-TRP [MDT]) [21] was purchased from Sigma-Aldrich.
Cell Cultures hMSC (Lonza, Basel, Switzerland, www.lonza.com) are commercially available primary cells obtained from bone marrow of healthy young donors (aged 24–30 years) [22]. This model has been used in our previous studies [3, 5, 23] and is preferred over cells from older donors due to their excellent differentiation potential. hMSC were seeded at a density of 5 3 105 cells per square centimeter in 56 cm2 Petri dishes containing mesenchymal stem cells growth media (MSCGM, BulletKit PT-3001, Lonza). For osteogenesis, after hMSC reached 60% confluence, the medium was replaced with either MSCGM or osteoblastogenesis induction medium (OIM) (prepared with MSCGM, 10% [vol/ vol] fetal calf serum (FCS), 0.2 mM dexamethasone, 10 mmol/l b glycerol phosphate, and 50 mg/ml ascorbic acid). The medium was changed every 3 days. Media were obtained on day 7 of differentiation for measurement of TRP end products. To determine osteoblastogenesis, at week 2 of differentiation, cells were stained for alkaline phosphatase (ALP) using TT-blue1 and for mineralization using Alizarin red. Matrix mineralization was quantified by extracting the Alizarin red staining with 100 mM cetylpyridinium chloride at room temperature for 3 hours. The absorbance of the extracted Alizarin red S staining was measured at 570 nm, normalized to total amount of protein, and expressed as relative units compared with the optical density per milligram of protein of control cells. For adipogenesis, hMSC were plated in adipogenic induction media containing 0.1 mM dexamethasone, 10 mg/ml insulin, 0.2 mM indomethacin, 0.5 mM 3-isobutyl-1methylxanthine, 10% FBS, 0.05 U/ml penicillin, and 0.05 mg/ ml streptomycin for 3 days then alternating with adipogenic maintenance medium (10 mg/ml Insulin, 10% fetal bovine serum (FBS), 0.05 U/ml penicillin, and 0.05 mg/ml streptomycin) every 3 days for 2 weeks until obtaining an adipogenic phenotype as previously described [5]. For the immune models, peripheral blood samples from healthy donors were collected in the morning and were processed immediately after collection. CD31 T lymphocytes were isolated from mononuclear cells using magnetic separation with the na€ıve T cells kit (Miltenyi Biotec, Bergisch Gladbach, Germany, http:// www.miltenyibiotec.com) as previously described [24]. Purity of >90% was routinely achieved. Some of the isolated cells were STEM CELLS
Vidal, Li, Santner-Nanan et al.
113
Table 1. Oligonucleotide primers used for real-time PCR Primer sequences 50 –30 (forward and reverse)
Human IDO1 Human TPH1 Human RUNX2 Human OCN Human OPN Human GAPDH Mouse RUNX2 Mouse OCN Mouse OPN Mouse GAPDH
GGTCATGGAGATGTCCGTAA ACCAATAGAGAGACCAGGAAGAA CTGCAGCATGATCTCGATGT ATTGTTTGGCCAGAAGATGC TTTGCACTGGGTCATGTGTT TGGCTGCATTGAAAAGACTG TGGCCGCACTTTGCATCGCTGG CGATAGGCCTCCTGAAAGCCGATG ACTCTGGTCATCCAGCTGACTCGT CTCCTAGGCATCACCTGTGCCATA GAAATCCCATCACCATCTTCC AAATGAGCCCCAGCCTTCTC GCCGGGAATGATGAGAACTA GGACCGTCCACTGTCACTTT CTTGGTGCACACCTAGCAGA ACCTTATTGCCCTCCTGCTT TGCACCCAGATCCTATAGCC CTCCATCGTCATCATCATCG AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA
Thermal profile for all PCRs: 40 cycles; denaturation 95 C/15 seconds; annealing 60 C/15 seconds; Extension 72 C/30 seconds. Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OCN, osteocalcin; OPN, osteopontin; RUNX2, runt-related transcription factor-2.
analyzed for HLA-G expression prior to subsequent culture. Primary T lymphocytes and Jurkat cells (Cellbank Australia, Westmead, NSW, Australia, www.cellbankaustralia.com) were cultured in RPMI 1640 medium containing 2 mM L-glutamine, 100 U/ml penicillin, 100 mg/ml streptomycin, and 10% heat-inactivated FBS.
RNA and Protein Extraction Total RNA and proteins were extracted from the same cell pellet, collected at the end of the first week of differentiation using the specifications of PARIS protocol (Ambion, Inc., Austin, TX, http://www.lifetechnologies.com/). Briefly, treated cells were kept on ice rinsed with PBS, and directly disrupted by adding a cell disruption buffer (PARIS kit). Proteins were protected by adding Halt Protease and Phosphatase inhibitors (Thermo Fisher Scientific, Inc., Rockford, IL, www.thermofisher. com), collected using a rubber spatula and stored at 280 C until further analysis. RNA in the lysate was treated with bmercaptoethanol and guanidinium thiocyanate and linked to a filter cartridge according to the PARIS manufacturer conditions. RNA and proteins concentrations were estimated based on UV absorbance (260 and 280 nm, respectively) readings by spectrophotometry.
cDNA Microarray Analysis hMSC were treated for 1 week with OIM containing an osteogenic dose of IFNc (100 nM) [3] or vehicle alone. Undifferentiating hMSC, Jurkat cells, and primary human T lymphocytes were treated under the same conditions. After the first week of treatment, total RNA was extracted from IFNc-treated and untreated differentiating and undifferentiating hMSC, Jurkat cells, and primary human T lymphocytes as previously described. Generation of cDNA, fluorescent labeling, hybridization to the gene chip, and data analysis were performed by the Ramaciotti Institute as previously described [25]. We examined 21,014 human genes and expressed sequences tags on the array
www.StemCells.com
Human Gene 1.0ST (Affymetrix, Inc., Santa Clara, CA, www.affymetrix.com) and analyzed the results using the Affymetrix Expression Console Software (Affymetrix, Inc.) and BRB-Array Tools (Biometric Research Branch, National Cancer Institute) as previously described [3, 26]. Data were filtered and normalized as previously described [27] then scatter plot and class comparison analysis for differential gene expression between MSCGtreated hMSC versus OIM- and IFNc-treated hMSC and immune cells were performed. Genes with significant changes (more than or equal to twofold) were then grouped depending on their known function using the database for annotation, visualization, and integrated discovery [28, 29]. The biological function of each gene product was obtained from literature searches in medical databases. This experiment was repeated twice and significant changes in gene expression determined by the method of biological duplicates, which consists of selecting only those genes with a constant more than or equal to twofold variation in expression level between duplicates [3, 27].
Real-Time-PCR First strand complementary DNA (cDNA) synthesis was performed using 200 ng of total RNA, 50 ng random hexamers, and 50 units reverse transcriptase at 42 C for 1 hour, as described by the manufacturer (Bioline, Australia, http:// www.bioline.com/au/). Real-time (RT)-PCR for selected human genes (Table 1) was performed in a total reaction volume of 25 ml (representing 5 ng of total RNA), 3 mM MgCl2, and 250 nM of each forward and reverse specific primer for target genes and normalizer. All PCRs were performed in a Corbett Rotor-Gene 3000 (QIAGEN Pty, Venlo, The Netherlands, www.qiagen.com) using SYBR green with no-ROX reaction mix and a standard thermal profile as described by supplier (Bioline, Australia). Quantitative RT-PCR data were defined by threshold cycle (Ct) normalized for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase. Quantification of relative differences of expressed genes between different conditions was calculated using REST software (QIAGEN Pty) correcting for PCR reaction efficiencies (>0.90).
Quantification of Intermediates from TRP Degradation Culture supernatants were assayed for 10 intermediate and end products of TRP degradation using HPLC and GC/MS as described previously [30, 31]. Prior to analysis, samples were deproteinized with equal volume of 10% (w1v) TCA and then passed through a 0.45 mm PTFE syringe filter (Merck Milipore, Darmstadt, DEU). TRP and KYN were measured using an Agilent 1200 series HPLC equipped with a temperature controlled autosampler, variable wavelength detector, and a xenon lamp fluorescence detector (Agilent Technologies, CA, www.agilent.com). These analytes were separated using a Zorbax Eclipse XDB-C18 (5 mm, 150 3 4.6 i.d.) reverse phase column at an injection volume of 30 ml and mobile phase consisting of ammonia acetate buffer (0.1 M, pH 4.65) pumped isocratically at a flow rate of 1 ml/minute. TRP was quantified by fluorescence at an excitation wavelength of 254 nm and emission wavelength of 404 nm while L-KYN was measured by UV absorbance at 365 nm. Intermediate and end products were determined by GC/ MS using 50 ml of samples with addition of deuterated internal standards respective to the metabolites of interest. The mixtures are allowed to dry using a speedvac concentrator (Thermo) leaving residues that were then derivatize with C AlphaMed Press 2014 V
114
Kynurenine Pathway and Osteoblastogenesis
trifluoroacetic acid and hexafluoroisopropanol to form the hexafluoroisopropyl ester of the respective acids heated at 60 C for an hour. The esterified products were dissolved in toluene, washed with 5% sodium bicarbonate and ultrapure water prior to drying with anhydrous sodium sulfate. The end product (1 ml) was injected into Agilent 7890A GC coupled with Agilent 5975C mass selective detector (Agilent Technologies) for quantification operating at negative ionization mode. Data related to cellular production of KYN pathway metabolites have the background values (because of traces in serum supplementation and medium) for each metabolite subtracted to represent net cellular production. Finally, serotonin concentrations in cell supernatants were quantified using ELISA kit from Genway (San Diego, CA, http://www.genwaybio.com). Each experiment was performed in triplicates.
son, WI, www.promega.com) were performed. Briefly, a stock solution of MTS was dissolved in PBS at a concentration of 5 mg/ml and was added in a 1:10 ratio (MTS/Dulbecco’s modified Eagle’s medium [DMEM]) to each well, incubated at 37 C for 2 hours, and the optical density determined at a wavelength of 490 nm on a microplate reader model 3550 (FLUOstar; BMG Labtech, Durham, NC, www.bmglabtech.com). The percent survival was defined as ([experimental absorbance 2 blank absorbance]/[control absorbance 2 blank absorbance]) 3 100, where the control absorbance is the optical density obtained for 1 3 104 cells/well (number of cells plated at the start of the experiment), and blank absorbance is the optical density determined in wells containing medium and MTS alone. This experiment was replicated three times.
IDO1 Knockdown by siRNA
To test whether the anabolic effect of IFNc on bone is associated with the activation of TRP degradation pathways, 8-weekold virgin female C57BL/6 mice (n 5 8/group) were oophorectomized (OVX) under general anesthesia (isoflurane 5%). Two weeks after surgery, mice received intraperitoneal injections of either 2,000 international units (IU) IFNc (R&D Systems, Inc., Minneapolis, MN, www.rndsystems.com) or vehicle (PBS) three times a week for a total of 6 weeks as previously described [4]. In addition, to determine the changes in bone phenotype induced by IDO1 deficiency in vivo, we compared female wildtype (WT) C57BL/6 mice (n 5 8; 16–18 weeks; 24.4 6 0.9 g) and Ido1 gene-deficient (Ido12/2) C57BL/6 mice (n 5 8, 16–18 weeks; 27.2 6 0.6 g). These mice were originally obtained from Dr. A. Mellor [21], have low serum levels of KYN metabolites [32], and have no apparent phenotypical differences when compared with their WT littermates, including same food intake, weight, and life span. Mice were housed in cages in a limited access room at the Medical Foundation Building, University of Sydney. After euthanasia with CO2 inhalation, femur and tibiae obtained from IFNc- and vehicle-treated C57BL/6 mice and from WT and mutant animals were dissected and isolated for further analyses. Serum samples were obtained and placed at 280 C for further experiments. The Animal Ethics Committees of the University of Sydney approved the protocol.
Knockdown of IDO1 expression was obtained by gene siRNA in differentiating MSC as previously described [23]. Briefly, hMSC in six-well plates were grown to 60% confluence in MSCGM containing 10% FCS. Medium was then removed and replaced with serum-free MSCGM and transfected with siRNA (final concentration 33 and 66 nM) using lipofectamine 2000 (Invitrogen Australia, Sydney, Australia, http://www.lifetechnologies.com/ au), according to the manufacturer’s instructions. We used a pool of three siRNA oligonucleotides against human IDO1 (sc45939) and a negative control siRNA (sc-37007) from Santa Cruz Biotechnology. Cells were incubated for 8 hours in serumfree MSCGM and the medium then replaced with OIM with the addition of either 100 ng/ml IFNc or vehicle. siRNA transfection was repeated every 3 days and cells treated for up to 7 days. Control siRNA did not lead to any specific degradation of known cellular mRNA and was selected because it exhibited no cellular toxicity (as indicated by no changes in the cell phenotype) or in cell viability quantified using MTS Formazan. RT-PCR of the IDO1 gene showed a knockdown efficiency of 90% at day 7, which corresponds to previous experiments using a similar approach [23]. Total RNA was collected as described before after 3 and 7 days post-transfection and analyzed by quantitative real-time PCR. Changes in osteoblast differentiation and mineralization were determined using ALP and Alizarin red, respectively.
Chemical Inhibition of IDO1 IDO1 activity was inhibited using MDT [21]. hMSC in six-well plates were grown in MSCGM up to 60% confluence as described above. MDT was dissolved in 0.1 N NaOH. MSCGM was replaced with OIM, with the addition of 100 ng/ml IFNc with or without MDT to reach final concentrations of 0.2, 0.3, and 0.4 mM. Differentiating hMSC were incubated for 14 days, changing the medium twice a week. Total RNA was collected after 14 days of differentiation and analyzed by realtime PCR.
MTS Viability Assay To test the effect of treatments on cell survival, differentiating hMSC were seeded in 96-well plates. At 60% confluence, treatments (siRNA and chemical) were performed as previously described. At day 7 of treatment, 3-(4,5-dimethylthiazol2-yl)25-(3-carboxymethoxyphenyl)22-(4-sulfophenyl)22H-tetrazolium (MTS)-Formazan cell viability assays (Promega, MadiC AlphaMed Press 2014 V
Animal Experiments
Histological Technique After fixation, right femur was washed for 12 hours at 4 C in each of the following series of solutions: 0.01 M PBS containing 5% glycerol, 0.01 M PBS containing 10% glycerol, and 0.01 M PBS containing 15% glycerol. The specimens were then decalcified in EDTA-G solution (14.5 g EDTA, 1.25 g NaOH, and 15 ml glycerol were dissolved in distilled water and the pH was adjusted to pH 7.3). The EDTA-G solution was replaced every 5 days until confirming decalcification. To remove EDTA and glycerol from the decalcified tissues, they were washed at 5 C for 12 hours in successive washes of sucrose. Finally, tissues were dehydrated in a graded series of alcohols and embedded in low-melting-point paraffin using a Leica automatic tissue processor (Reichert-Jung Leica, Heerbrugg, Switzerland, www.leica.com). The left femur from each animal in each group of WT and Ido12/2 mice was fixed in 70% ethanol and used for CT analysis followed by dehydration and embedding undecalcified in methyl methacrylate (J-T Baker, Phillipsburg, NJ). In addition, brain (parietal lobe) and STEM CELLS
Vidal, Li, Santner-Nanan et al. gut were removed, fixed in 4% paraformaldehyde and then embedded in paraffin and plastic blocks.
Immunohistochemistry The details of these methods were described previously [3–5]. Briefly, sections (5 mm) of bone, brain, and gut were deparafinized and then incubated overnight at 4 C with antibodies against IDO1, TPH1, and serotonin. Primary antibody was detected by incubation with an anti-goat IgG secondary antibody conjugated with horseradish peroxidase (1:300 in bovine serum albumin 1%, Sigma-Aldrich). Antibody complexes were visualized with DAB, a 3,3-diaminobenzine solution containing hydrogen peroxide (Zymed Laboratories, Inc., San Francisco, CA) and then counterstained in 1% hematoxylin. Photographs were taken under an Olympus fluorescence microscope controlled by an IPLab system. Brightness and contrast adjustments were performed in Photoshop (Adobe). Levels of IDO1, TPH, and serotonin in gut and levels of IDO1 and TPH1 expression in bone were quantified as percentage of tissue surface using the Bioquant Life Sciences (Nashville, TN, www.lifescience.bioqant.com).
Radiography and l-Computed Tomography (CT) Analysis m-CT was performed in left femur of WT and Ido12/2 mice as described previously [4, 5]. Briefly, after removal of soft tissues and overnight fixation in 4% paraformaldehyde, the distal metaphysis was scanned with a Skyscan 1072 m-CT instrument (Skyscan, Antwerp, Belgium). Image acquisition was performed at 100 kV and 98 mA, with a 0.9 rotation between frames. The segmentation of the image was made by a global threshold and a voxel size of 21.90 3 21.90 3 21.90 mm; the same threshold setting was used for all the samples. The twodimensional images were used to generate three-dimensional reconstructions to obtain quantitative data with the 3D Creator software supplied with the instrument. Bone volume/total volume (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N) were compared between WT and Ido12/2 mice. Nomenclature and abbreviations of 3D-mCT parameters follow the recommendations of the American Society of Bone and Mineral Research [33].
Histological and Histomorphometrical Analysis of Bone At 50 mm intervals, longitudinal sections 5-mm thick were cut using a Polycut-E microtome (Reichert-Jung Leica, Heerbrugg, Switzerland), placed on gelatin-coated glass slides, deplasticized, and stained with Goldner’s trichrome as previously described [4, 5]. Detection of ALP for osteoblast quantification and tartrate-resistant acid phosphatase (TRAP) activity for osteoclast quantification was carried using Naphthol-AS-TR (Sigma-Aldrich) as substrate for both enzymes and Fast Blue BB salt (Sigma-Aldrich) as a coupler for ALP. Images were captured at two different magnifications (340 and 3100) using a Nikon Eclipse E100 microscope (Nikon Instruments, Inc., Melville, NY, www.nikoninstruments.com) and the primary histomorphometric data obtained using Bioquant Nova Prime image analysis software (Bioquant Image Analysis). Osteoblast number (Ob.N) and osteoclast number (Oc.N) per bone perimeter were quantified as previously described [4, 5]. Nomenclature and abbreviations of histomorphometric parameters follow the recommendations of the American Society of Bone and Mineral Research [34].
www.StemCells.com
115
Ex Vivo Cultures of Bone Marrow Cells Bone marrow stromal cells (BMSC) were prepared and induced to differentiate into osteoblast as previously described [3–5]. Briefly, one side tibiae from WT and Ido2/2 mice (n 5 10 per group) was flushed using a 21-gauge needle attached to a 10 ml syringe filled with DMEM. The bone marrow cells were filtered through a cell strainer with a 70-mm nylon mesh (BD Bioscience, Bedford, MA, www.bdbiosciences.com) and plated in 10 cm2 tissue culture dishes. The cells were incubated in MSCGM at 37 C with 5% humidified CO2 and isolated by their adherence to tissue culture plastic. Medium was aspirated and replaced with fresh medium every 2–3 days to remove nonadherent cells. The adherent BMSC were grown to confluence for about 7 days and defined as MSCs at passage 0, harvested with 0.25% trypsin, and 1 mM EDTA for 5 minutes at 37 C, diluted 1:3 in MSCGM, plated, and grown to confluence for further expansion. After second and third passages, MSCs were used for subsequent experiments. To induce differentiation, a total of 104 cells were diluted in OIM and plated in 24 dishes per group, each 4 cm2. In addition, PA (50 and 100 mM), QA (500 and 750 nM), and L-KYN (0.5 mg/ml) or vehicle were added to the OIM. Medium was aspirated and replaced with fresh medium every 3 days. At 7 days, medium was removed and cultures were fixed in 10% (vol/vol) formol/saline solution for 5 minutes. Colonyforming units-osteoblasts (CFU-OB) were detected by Alizarin Red (pH 7.4) staining. Two independent investigators counted the total number of CFU-OB per dish macroscopically using a flat bed scanner fitted with a transparency adapter.
Biochemical Analysis WT and Ido2/2 mice were euthanized and blood was removed by cardiac puncture. Calciotropic hormones were measured using specific kits for parathyroid hormone (PTH) (Immunotopics, Inc., San Clemente, CA, www.immutopics. com) and 25-hydroxy-vitamin D (25[OH]D) (ImmunoDiagnostic Systems, Ltd., U.K., http://www.idsplc.com). The amino-terminal propeptide of type I collagen (P1NP), a marker of bone formation, was measured in 20 ml of serum using the mouse P1NP immunoradiometric assay kit (Immutopics, San Clemente, CA). In addition, serum levels of N-telopeptide (NTx), a marker of bone resorption, were measured in 20 ml of serum using the Mouse NTx Assay kit (Immunodiagnostic Systems, Ltd., Scottsdale, AZ).
Treatment of Osteogenic Differentiating hMSC with Intermediate and End Products of the KYN Pathway hMSC were induced to differentiate into osteoblasts as previously described. At time 0 of differentiation, end products (L-KYN, QA, and PA) of the KYN pathway were added to the differentiation media at doses previously tested and demonstrated to be safe in other cell models [31]. After 2 weeks of differentiation and treatment, cells were fixed and levels of mineralization were quantified using alizarin red as previously described.
Statistical Methods All data are expressed as mean 6 SD of three replicate determinations. Unpaired t tests were performed on the results obtained at week 1 for GC/MS. p values were generated comparing KYN pathway metabolite production or degradation by C AlphaMed Press 2014 V
116
Kynurenine Pathway and Osteoblastogenesis
Figure 1. IDO1 activation and tryptophan degradation are increased in hMSC under osteogenic conditions. (A): We compared cDNA data obtained from untreated hMSC versus cDNA obtained from OIM- and IFNc-treated hMSC (MSCGM), IFNc-treated osteogenic differentiating hMSC (OIM), human primary T lymphocytes, and Jurkat cells. The changes in relative gene expression of TPH1 and IDO1 identified by cDNA microarrays in Jurkat, human T lymphocytes, and hMSC treated with either IFNc (100 ng/ml) or vehicle for 7 days were confirmed using RT-PCR. Left panel (TPH1): *, p < .01 versus IFNc-treated T lymphocytes; Right panel (IDO1): *, p < .01 versus IFNc-treated osteogenic differentiating hMSC; #, p < .01 versus OIM-treated hMSC. (B): hMSC under osteogenic conditions show higher levels of TRP degradation as demonstrated by a higher KYN/TRP ratio. *, p < .001, #, p < .01 IFNc-treated hMSC versus untreated cells. (C): No changes in serotonin concentrations in the supernatants were found in either IFNc-treated or untreated cells. (D–F): Effect of IFNc on TRP degradation pathway in gut and bone marrow. Eight-month-old OVX C57BL/6 mice received intraperitoneal injections of either IFNc (2,000 IU) or vehicle (PBS) three times a week for a total of 6 weeks. IFNc-treated mice showed higher levels of IDO1 protein in their gut (D, E) and bone marrow (F). In contrast, treatment with IFNc increased the expression of TPH1 in bone (F) while gut was unaffected (D, E). Finally, GDS was decreased by IFNc treatment in a nonsignificant manner (D, E). *, p < .01 PBS- versus IFNc-treated mice. Abbreviations: GDS, gut-derived serotonin; hMSC, human mesenchymal stem cells; IFNc, interferon gamma; KYN, kynurenine; MSCGM, mesenchymal stem cells growth media; OIM, osteoblastogenesis induction medium; TRP, tryptophan.
unstimulated cells and IFNc stimulated cells at the same time point. For other in vitro experiments, statistical analysis was performed by one-way ANOVA or Student’s t test. For in vivo experiments, differences of the structural and static parameters of bone histomorphometry between different groups of mice were determined using Levene’s test for homogeneity of variances and the unpaired t test for equality of means. A p value of
