The Leptin System during Human Endometrial Receptivity and ...

0021-972X/04/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 89(5):2442–2451 Copyright © 2004 by The Endocrine Society doi: 10.1210/jc.2003-032127

The Leptin System during Human Endometrial Receptivity and Preimplantation Development ´ ANTONIO HORCAJADAS, JULIO MARTÍN, ANTONIO PELLICER, ANA CERVERO, JOSE ´N CARLOS SIMO

AND

Instituto Valenciano de Infertilidad Foundation (A.C., J.A.H., J.M., A.P., C.S.) and Department of Pediatrics (A.C., A.P., C.S.), Obstetrics and Gynaecology, School of Medicine, University of Valencia, 46010 Valencia, Spain The leptin system is implicated in the regulation of body weight and reproductive function, acting at endocrine and paracrine levels. This ligand-receptor system is mandatory for embryonic implantation in rodents. Here, we investigate the expression pattern of total leptin receptor (OB-RT), the long form (OB-RL) and short isoforms HuB219.1 and HuB219.3 in the human endometrium. Furthermore, we studied leptin and OB-RT mRNA during human embryonic preimplantation development and the embryonic regulation of the endometrial OB-RL. Leptin receptor expression and its isoforms increase in the luteal phase and peak in the late part. Leptin receptor was localized at the epithelial and glandular epithelium using in situ hybridization. Reverse transcription-

L

EPTIN, THE PRODUCT of the OB gene, is a 16-kDa nonglycosylated polypeptide of 146 amino acids discovered in 1994 by Zhang et al. (1). Leptin receptor is the product of the LEPR or OB-R gene and is a member of the class I cytokine receptor superfamily (2). In humans, there are at least four leptin receptor isoforms, which vary according to the length of their intracytoplasmic domains (3). The short forms are considered to lack signaling capability, whereas the long form (OB-RL), with a complete intracellular domain, activates the signal transduction pathway via both the signal transducer and activator of transcription-3 (STAT3) and MAPK (4 – 6). In this way, it has been demonstrated that signaling via STAT3 is necessary for leptin regulation of energy but is not vital for reproduction (7). The leptin system is implicated in the regulation of body weight (8 –11) and reproductive function, acting at endocrine and paracrine levels (12–14). ob/ob mutant mice produce a defective, nonfunctional leptin that results in a phenotype of obesity and sterility (1). The fertility of these animals can be restored by means of exogenous leptin treatment but not by food restriction, suggesting that leptin is required for normal reproductive functioning (15, 16). db/db mutant mice, which Abbreviations: DEPC, Diethylpyrocarbonate; dNTP, deoxynucleotide triphosphate; EEC, endometrial epithelial cells; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IVF, in vitro fertilization; OB-R, leptin receptor; OB-RL, long-form leptin receptor; OB-RT, total leptin receptor; QF-PCR, quantitative fluorescent PCR; RT, reverse transcription; SSC, saline sodium citrate; STAT3, signal transducer and activator of transcription-3. JCEM is published monthly by The Endocrine Society (http://www. endo-society.org), the foremost professional society serving the endocrine community.

nested PCR showed the presence of OB-RT mRNA at all the embryonic stages, whereas leptin mRNA was only detected at the blastocyst stage. The embryonic regulation of endometrial epithelial OB-RL and HuB219.3 was studied, and no impact was found. Finally, OB-RL was immunohistochemically localized in the human cytotrophoblast and maternal decidua. These findings suggest that secretory endometrium is a target tissue for leptin action, and oocytes and preimplantation embryos possess OB-R mRNA, indicating that leptin may be necessary for embryonic development. Furthermore, leptin mRNA is specifically expressed at the blastocysts stage, suggesting a function in the blastocyst-endometrial dialogue. (J Clin Endocrinol Metab 89: 2442–2451, 2004)

produce an altered splicing form of the leptin receptor mRNA without the intracytoplasmic domain, display characteristics similar to those of ob/ob mutants (17, 18), but they cannot be reverted via administration of leptin. Furthermore, it has been demonstrated in ob/ob knockout animals that, although leptin is essential for normal preimplantation and implantation processes, it is not crucial during pregnancy and parturition (19). There is a controversy surrounding the functional role of levels of circulating leptin during the menstrual cycle. Although some groups have shown that the lowest concentration of serum leptin is measured during the early follicular phase, later peaking during the luteal phase (20, 21), other studies have failed to find significant changes in the course of the different phases (22–24). In recent years, three different groups (25–27) have reported expression of the leptin system in the human endometrium. The three groups detected OB-RL mRNA in the human endometrium using Northern blot analysis (26) and RT-PCR (25–27). Furthermore, OB-RL protein was detected by Western blot analysis (25, 26) and located immunohistochemically in glandular and luminal epithelium (25, 27). In addition, the presence of OB-RL in cultured human endometrial epithelial cells (EEC) was demonstrated by RT-PCR and Western blot (25). With respect to the embryonic counterpart, leptin has been immunolocalized in mouse and human oocytes and preimplantation embryos in a polarized manner (28). Its source is thought to be maternal due to the absence of leptin mRNA (29). Recently, two splice variants of OB-R (OB-Ra and OBRb) mRNAs have been detected in mouse oocytes and embryos throughout the preimplantation development (30). This study also reported that leptin significantly aided blas-

2442

Cervero et al. • Expression of Leptin System in Human Implantation

tocyst development and increased the total cell number of blastocysts (30). Additionally, our group has detected leptin in conditioned media from single human blastocysts at higher concentrations than those seen in arrested embryos, suggesting that this molecule is a marker for blastocyst viability (25). The aim of this study is to further establish and quantify the complete leptin system during human endometrial receptivity and embryonic development. Furthermore, the embryonic regulation of OB-RL and HuB219.3 produced in the EEC has been assessed using an in vitro model for the apposition phase of human implantation. Immunolocalization of OB-RL in human implantation sites was also performed. Patients and Methods Patients and tissues

Real-time quantitative fluorescent PCR (QF-PCR) The experiments for real-time QF-PCR were performed with the ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Foster TABLE 1. Oligonucleotide primers for real-time QF-PCR with their respective product size

GAPDH OB-RT OB-RL HuB219.1 HuB219.3

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Primer sequence (5⬘-3⬘)

Size (bp)

GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC TGGAAGGAGTGGGAAAACCAA TTAAGTCCTTGTGCCCAGGAA CAAGAATTGTTCCTGGGCACA TCAGGCTCCAAAAGAAGAGGA CAAGAATTGTTCCTGGGCACA GGTCTCTGGTTTTCCTATGCA CAAGAATTGTTCCTGGGCACA ACTGTTGGGAAGTTGGCACA

226

City, CA). In short, primers were designed using the Primer Express software (Applied Biosystems) provided with the aforementioned system to comply with the manufacturer’s universal conditions. SYBR Green I double-stranded DNA binding dye (Applied Biosystems) was used as the assay chemistry. Total RNA (1 ␮g) was reverse transcribed using an Advantage RT-for-PCR kit (Clontech, Palo Alto, CA). We used 100 ng of cDNAs for each sample analyzed. cDNA from placenta or adipose tissue was used to obtain the standard curve. All real-time QF-PCR assays were carried out according to the manufacturer’s universal thermal cycling parameters, and the final products were analyzed with the provided software (Sequence Detector v 1.7, Applied Biosystems). The primer cDNA sequences and the sizes of the amplified fragments are listened in Table 1. Each assay was performed in duplicate. Data are presented as the relative average value of the gene investigated and normalized with the average value of the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Melting curves were analyzed to confirm amplification specificity.

217 114 155 110

RT-nested PCR was performed basically according to Kru¨ssel et al. (32) but with some modifications. For each oocyte or preimplantation embryo, a 17.5-␮l RT mastermix was prepared using 4 ␮l of 25 mm MgCl2 solution, 2 ␮l of 10⫻ PCR buffer (BIOTAQ; Bioline, London, UK), 1.25 ␮l of diethylpyrocarbonate (DEPC)-treated H2O, 8 ␮l of 10 mm deoxynucleotide triphosphate (dNTP; Sigma, Madrid, Spain), 0.75 ␮l of 10 ␮m outer 3⬘ ␤-actin primer, 0.75 ␮l of 10 ␮m outer 3⬘ OB-R primer, and 0.75 ␮l of 10 ␮m outer 3⬘ OB primer in a 0.2-ml PCR tube. Downstream (3⬘ end) primers of the outer primer pairs, rather than oligo-deoxythymidine primer, were used for the RT reaction to obtain more specific cDNA products. To ensure that the product was a result of the amplification of cDNA rather than the contamination of genomic DNA, primers were designed to amplify fragments of more than one exon. The primer cDNA sequences and the sizes of the amplified fragments are presented in Table 2. Single oocytes and embryos were added to the RT mix in approximately 1 ␮l of culture medium and were immediately frozen at ⫺80 C. Samples were heated to 99 C for 1 min to release the total RNA and denature the proteins. They were then cooled down to 4 C, at which point 0.5 ␮l recombinant RNase inhibitor and 1 ␮l Moloney murine leukemia virus RT (Clontech) were added. The RT reaction was carried out at 42 C. After amplification, the enzyme was inactivated. For the first round of PCR, 3 ␮l of RT product was added to 47 ␮l PCR mix [4 ␮l of 25 mm MgCl2 solution, 5 ␮l of 10⫻ PCR buffer, 33.5 ␮l of DEPC-treated H2O, 1.5 ␮l of 10 mm dNTP, 2.5 ␮l of outer 3⬘ ⫹ 5⬘ primer mix (5 ␮m each), and 0.5 ␮l Taq DNA polymerase (BIOTAQ; Bioline)]. The PCR was performed at 58 C in 20 cycles for ␤-actin and 25 cycles for leptin and OB-R. For the second PCR, 4 ␮l of first-round PCR were added to 46 ␮l PCR mix [4 ␮l of 25 mm MgCl2 solution, 5 ␮l of 10⫻ PCR buffer, 33.5 ␮l of DEPC-treated H2O, 1.5 ␮l of 10 mm dNTP, 4 ␮l of inner 3⬘ ⫹ 5⬘ primer mix (5 ␮m each), and 0.5 ␮l of Taq DNA polymerase (BIOTAQ; Bioline). PCR was carried out at 58 C in 25 cycles for ␤-actin and at 59 C in 30 cycles for leptin and OB-R. H2O substituted cDNA as the negative control for each reaction, whereas placental cDNA was used as the positive control. The integrity

TABLE 2. Oligonucleotide primers used for RT-nested PCR Transcript

Leptin

PCR round

First Second

OB-RT

First Second

␤-Actin

First Second

2443

Reverse transcription (RT)-nested PCR of human embryos

This project was approved by the Ethical Committee and Institutional Review Board on the use of human subjects in research at the Instituto Valenciano de Infertilidad [in accordance with the Spanish Law of Assisted Reproductive Technologies (35/1988)]. Surplus embryos were donated for research by nine patients after ovarian hyperstimulation and insemination, in which routine in vitro fertilization (IVF) procedures were employed. A total of 15 endometrial biopsies were obtained from women (aged 23–39 yr) at different stages of the menstrual cycle and dated according to Noyes et al. (31). Informed consent was obtained from each woman. Endometrial samples were divided into the following groups: I, early follicular (d 1– 8, n ⫽ 3); II, mid-late (d 9 –14, n ⫽ 3); III, early luteal (d 15–18, n ⫽ 3); IV, mid (d 19 –22, n ⫽ 3); and V, late (d 23–28, n ⫽ 3). Human adipose tissue, used as positive control for leptin and OB-R expression, was obtained from patients undergoing gynecological surgery. Human placental tissue was acquired after routine delivery.

Transcript

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

Primer sequence (5⬘-3⬘)

Size (bp)

CCAAAACCCTCATCAAGAC CACCTCTGTGGAGTAG CCAAAACCCTCATCAAGAC CTCTTAGAGAAGGCCAGCAC TGGAAGGAGTGGGAAAACCAA TTAAGTCCTTGTGCCCAGGAA AAGGAGTGGGAAAACCAAAG GTTCCAAGCAATAAGATGGAAG ATCTGGCACCACACCTTCTACAATGAGCTGCG CGTCATAGTCCTGCTTGCTGATCCACATCTGC ATCTGGCACCACACCTTCTACAATGAGCTGCG CGGTGAGGATCTTCATGAGGTA

341 256 217 127 838 331

2444

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

of each cDNA preparation was analyzed using RT-PCR of ␤-actin mRNA (33). PCR reaction products were analyzed by means of gel electrophoresis in 2% (wt/vol) agarose gel containing 0.5 ␮g/ml ethidium bromide. The bands were isolated and sequenced to verify the identity of the PCR products.

Nonradioactive in situ hybridization Total RNA from endometrium (1 ␮g) was reverse transcribed using an Advantage RT-for-PCR kit (Clontech) and PCR amplified with specific primers to detect all isoforms of human OB-R mRNA (forward: 5⬘-GTGCCAACAGCCAAACTCA-3⬘, and reverse: 5⬘-GTGTGGTAAAGACACGAGGA-3⬘). The PCR product (394 bp) was purified and inserted into the SrfI site of the pPCR-Script Amp SK(⫹) cloning vector using a commercial kit (Stratagene, La Jolla, CA). Cloning DNA sequence and orientation were determined by sequencing using T3 and T7 primers. Digoxigenin cRNA sense and antisense probes were generated by either T3 (antisense) or T7 (sense) RNA polymerase-mediated transcription of linearized plasmids with HindIII and NotI. Paraffin-embedded sections of endometrial tissue were baked for 2 h at 60 C, dewaxed with two xylene baths, and rehydrated in a series of alcohol solutions. An additional bath with 0.2 m HCl and DEPC-treated water followed. Proteinase K digestion (10 mg/ml) was carried out at 37 C for 30 min. Subsequently, an additional wash with 0.1 m triethanolamine and acetic anhydride (0.25% vol/vol) was performed. Sections were prehybridized at 42 C for 3 h with hybridization buffer containing 60% deionized formamide, 25 mm Tris-HCl (pH 7.4), 1 mm EDTA (pH 8.0), 0.4 m NaCl, dextran sulfate (12% w/v), and Denhardt’s solution (1⫻). After this, 100 ␮g/ml tRNA and 200 ␮g/ml salmon sperm DNA were added to the buffer. Hybridization was performed overnight at 42 C in a hybridization buffer with 0.1% (vol/vol) of 100 mm dithiothreitol stock solution, 1% (vol/vol) of a 10% sodium thiosulfate stock, and 1% (vol/vol) of a

Cervero et al. • Expression of Leptin System in Human Implantation

10% sodium dodecyl sulfate (SDS) stock solution with 200 ng/ml sense and antisense probes. Slides were consecutively washed in 2⫻ saline sodium citrate (SSC) at room temperature, 2⫻ SSC at 42 C, 1⫻ SCC at 42 C, and finally 0.1⫻ SSC at 42 C. RNase A (20 ␮g/ml) digestion was carried out by shaking for 1 h at 37 C. Afterward, 1⫻ blocking solution (Roche Diagnostics, GmbH, Mannheim, Germany) was added to buffer 1 (pH 7.5) containing 100 mm maleic acid and 150 mm NaCl. Sections were incubated at room temperature for 2 h with alkaline phosphatase antidigoxigenin antibody (diluted 1:500; Roche Diagnostics) in 1⫻ blocking solution with buffer 1. Color development took place at room temperature for 3 h in buffer 3 (100 mm NaCl; 50 mm MgCl2; and 100 mm Tris-HCl, pH 9.5) containing 1% NBT/BCIP (vol/vol; Roche Diagnostics) and 0.1% (vol/vol) of a 1-mm levamisole stock solution. Counterstaining with 0.1% methyl green was performed over 30 sec. Sections were mounted using Kaiser’s glycerol gelatin (Sigma). Photomicrographs were obtained using a digital camera (Coolpix 995; Nikon, Tokyo, Japan).

In vitro model for apposition This is an in vitro model for studying interactions between the human embryo and cultured EEC. It was implemented in a clinical program in which embryos were cocultured with EEC up until the blastocyst stage and then transferred back to the mother (34, 35). Embryos were obtained after ovulation induction and insemination, in which routine IVF or intracytoplasmic sperm injection procedures were used. Endometrial biopsies were minced into small pieces (⬍1 mm) and digested in a mild collagenase solution (0.1%) at 37 C for 1 h. The endometrial epithelium was isolated and purified as previously described (36). EEC were cultured until confluence in a steroid-depleted medium containing a 3:1 mixture of DMEM (Sigma), MCDB-105 (Sigma), and 5 mg insulin (Sigma), which was supplemented with 10%

FIG. 1. Quantitative mRNA analysis of different isoforms of OB-R in human endometrium throughout the menstrual cycle. OB-RT (A), OB-RL (B), HuB219.1 (C), and HuB219.3 (D) mRNA expression. Endometrial biopsies were distributed in five groups: group I, early-mid proliferative (d 1– 8); group II, late proliferative (d 9 –14); group III, early secretory (d 15–18); group IV, mid secretory (d 19 –22); group V, late secretory (d 23–28). Data were normalized with the GAPDH gene and are represented as fold increase of mRNA expression compared with the group of basal expression for each receptor form. Three experiments were performed in a total of 15 endometrial samples (three in each group) to obtain the mean presented in the graph. All isoforms presented maximal expression in the late secretory phase (group V), showing a typical luteal-premenstrual pattern.

Cervero et al. • Expression of Leptin System in Human Implantation

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

2445

FIG. 2. In situ hybridization of OB-RT in human endometrium throughout the menstrual cycle. A, ␤-actin sense (group III), negative control. B, ␤-actin antisense (group III) is expressed throughout the endometrium, positive control. C, Group I OB-RT sense probe. D, Group I OB-RT antisense probe in which moderate expression in the luminal epithelium can be observed (arrow). E, Group II OB-RT sense probe. F, Group II OB-RT antisense with glandular and stromal staining (arrows). (G) Group III OB-RT sense probe. H, Group III OB-RT antisense without visible staining. I, Group IV OB-RT sense probe. J, Group IV OB-RT antisense with positive signal in luminal epithelial cells. K, Group V, OB-RT sense probe. L, Group V OB-RT antisense probe localizing an intense staining in luminal epithelium and stromal cells (arrows). Magnification, ⫻200.

TABLE 3. Semiquantitative analysis of in situ hybridization results of OB-RT in human endometrium throughout the menstrual cycle

Luminal epithelium Glandular epithelium Stroma

Group I

Group II

Group III

Group IV

Group V

⫹/⫹⫹ ⫹ ⫺/⫹

⫹/⫹⫹ ⫹ ⫹/⫹⫹

⫺ ⫺ ⫺

⫹ ⫺/⫹ ⫺

⫹⫹ ⫹/⫹⫹ ⫺/⫹

Designations of ⫺ (negative), ⫹ (weakly positive), ⫹⫹ (moderately positive), and ⫹⫹⫹ (strongly positive) indicate the relative intensities of the signals averaged by three different blind observers. charcoal-dextran-treated bovine fetal serum (Hyclone, Logan, UT). The homogeneity and purity of EEC cultures were assessed using immunohistochemical markers (37) and morphological characteristics (scanning electron microscopy) (34). After confluence, the culture media were replaced by a 1:1 mixture of IVF:S2 medium (Scandinavian IVF Science AB, Gothenburg, Sweden). Forty-eight hours after insemination of oocytes, each two- to four-cell human embryo was transferred to an EEC monolayer. When embryos reached the eight-cell stage, the medium was replaced by S2 medium until the blastocyst stage. Embryonic development was monitored daily, and the medium changed every 24 h. On d 6 of coculture, blastocysts were transferred to the recipient by means of an atraumatic catheter. EECs cultured alone under the same conditions were used as controls. Individual human embryos were cocultured with EEC for 5 d (from d

2 to d 6 of embryonic development). After embryo transfer, EEC wells were divided into the following two groups: EEC with embryos that had reached the blastocyst stage and EEC without embryos (controls). Realtime QF-PCR was used to analyze OB-RL and HuB219.3 mRNA expression in these samples. Relative data were normalized with the GAPDH housekeeping gene and expressed as mean ⫾ sem. Statistical significance between experimental groups was assessed using the Student’s t test with independent variables. P ⬍ 0.05 was considered significant.

Nested PCR of leptin in human endometrium Total RNA from endometrial tissues, EEC, and placenta was extracted using Trizol reagent (Gibco BRL, Life Technologies, Paisley, Scotland, UK). First-strand cDNA was reverse transcribed from 1 ␮g RNA using a Moloney murine leukemia virus RT and Advantage RT-for-PCR kit

2446

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

Cervero et al. • Expression of Leptin System in Human Implantation

FIG. 3. Leptin mRNA expression in human endometrium and EEC cultured in the presence or absence of a human blastocyst determined by nested PCR. In the first PCR round of 40 cycles, a positive signal for leptin mRNA (341 bp) was detected only in placenta (⫹ control) (A). A band of 256 bp appears in placenta (⫹ control), human endometrium (End.), and EEC cultured with (EEC*) or without (EEC) human embryo when a second PCR of 20 cycles was performed using the product of the first amplification (B). Note the presence of both 341- and 256-bp bands in the positive control in the second PCR round. ␤-Actin expression was used as control of the mRNA integrity (A). Deionized water instead of cDNA served as negative control (⫺ control), and the leptin-amplified product of the first negative control served as negative control 2 (⫺ control 2). Placental samples were used as positive control (⫹ control). (Clontech). First PCR amplification was carried out with the following primers: 5⬘-CCAAAACCCTCATCAAGAC-3⬘ (forward) and 5⬘-CACCTCTGTGGAGTAG-3⬘ (reverse) for leptin, and 5⬘-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3⬘ (forward) and 5⬘-CGGTGAGGATCTTCATGAGGTA-3⬘ (reverse) for ␤-actin. PCR amplification was performed in a final reaction volume of 25 ␮l containing 2 ␮l cDNA. The annealing temperature was 59 C for both ␤-actin and leptin in 30 cycles for the former and 40 cycles for the latter. The second PCR for leptin detection was performed at 59 C with 3 ␮l of the first PCR during 20 cycles. For this round, the same forward primer was used, whereas the reverse primer was 5⬘-CTCTTAGAGAAGGCCAGCAC-3⬘. PCR products were analyzed by gel electrophoresis in 2% agarose gel containing 0.5 ␮g/ml ethidium bromide. The PCR assay was repeated at least three times for each cDNA sample.

Immunohistochemistry Human implantation sites (6 –9 wk after the last menstrual period) were obtained from hysterectomy specimens and curettage specimens from therapeutic abortions. Tissues were formalin-fixed and paraffin-embedded and sectioned (5 ␮m) and mounted on glass coated with Vectabon (Vector Laboratories, Burlingame, CA). After deparaffinization and rehydration with a graded series of ethanol, immunohistochemistry was performed using a LSAB peroxidase kit (Dako Corp., Barcelona, Spain). In brief, sections were incubated with 3% hydrogen peroxide at room temperature for 5 min to suppress endogenous peroxidase activity. The samples were then incubated at room temperature for 30 min with 0.5 ␮g/ml goat antihuman OB-R antibody C20 (Santa Cruz Biotechnology, Santa Cruz, CA) in a humidity chamber. PBS containing 0.5% BSA (wt/vol) replaced the primary antibody as the negative control. After 20 min incubation with the linker, streptavidin-peroxidase was added for an additional 20 min and the substrate-chromogen solution was used for 5 min to stain the slides. Subsequent to each incubation step, the tissues were washed three times with PBS 50 mm Tris-HCl buffer. Counterstaining was carried out with Mayer’s hematoxylin, and the slides were mounted with Entellan (Merck, Darmstadt, Germany).

Results Gene expression and localization of total leptin receptor (OB-RT), OB-RL, and the short isoforms (HuB219.1 and HuB219.3) in the human endometrium during the menstrual cycle

The dynamics of the mRNA expression of OB-R isoforms were analyzed during the menstrual cycle using real-time

QF-PCR in three separate experiments with different sets of endometrial samples. Data are presented as a relative average value for each isoform studied and have been normalized according to the average value of the housekeeping gene (Fig. 1). The lowest value in each phase of the menstrual cycle was considered to be the basal expression and quantified as 1. The mRNA levels in a specific phase are expressed as fold increase compared with the basal expression. Real-time QF-PCR experiments revealed a similar expression pattern in the human endometrium for all OB-R isoforms studied (Fig. 1). OB-R mRNA presented cycle variation, with an increased expression at the end of the menstrual cycle (group V, d 23–28) that was higher in the late vs. early secretory phase (8.2-fold increase for OB-RT, 9.5-fold increase for OB-RL, 7-fold increase for HuB219.1, and 4.9-fold increase for HuB219.3). To confirm these data and to localize the OB-RT mRNA in the endometrial tissue, nonradioactive in situ hybridization experiments were performed on paraffin sections. The five groups of the menstrual cycle were analyzed, and the results are shown in Fig. 2 and Table 3. OB-RT mRNA was expressed predominantly in the luminal epithelium, where it showed minimal expression in the early secretory phase (group III) and maximal expression in the late secretory phase (group V). The glandular epithelium displayed a similar, although weaker, pattern of expression, and the stromal cells showed a slight expression during all phases. Expression of leptin mRNA in human endometrium

We performed nested PCR to identify the expression of leptin mRNA in human endometrium and cultured EEC in the presence or absence of a human blastocyst. We did not detect any signal for leptin in any of the samples analyzed performing a single PCR of 40 cycles (Fig. 3A). When a second PCR of 20 cycles was carried out using the product of the first amplification, a clear band of 256 bp was identified in the positive control, endometrium, and EEC (Fig. 3B).

Cervero et al. • Expression of Leptin System in Human Implantation

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

2447

FIG. 4. RT-nested PCR of leptin and OB-RT mRNAs in human oocytes and preimplantation embryos. OB-RT mRNA was detected as a 126-bp band in oocytes and at two-cell, four-cell, eight-cell, morula, expanded, and hatched blastocyst stages. Leptin mRNA was present only at expanded and hatched blastocyst stages as a 256-bp band. As an internal control, ␤-actin was used. The positive control for leptin and OB-R was placental cDNA, and the negative control was distilled water instead of cDNA.

Placental mRNA was used as positive control. The mRNA integrity was controlled based on the ␤-actin expression. Leptin and OB-RT RT-nested PCR during human embryonic development

RT-nested PCR was performed to detect leptin and OB-RT mRNA in human oocytes and preimplantation embryos at different stages (oocyte metaphase II, two-cell, four-cell, eight-cell, morula, expanded blastocyst, and hatched blastocyst). Leptin mRNA expression was not detected in oocytes and preimplantation embryos until the blastocyst stage (Fig. 4), whereas OB-RT mRNA was detected at all the embryonic stages studied (Fig. 4). The identity of the PCR products obtained was verified by sequence analysis. Embryonic regulation of OB-RL and HuB219.3 in cultured EEC

The embryonic effect on endometrial epithelial OB-RL and HuB219.3 mRNA expression in cultured EEC was assessed via real-time QF-PCR using an in vitro model of human implantation as described in Patients and Methods. No significant differences were observed in these two isoforms of the OB-R based on the presence or absence (control EEC) of a human blastocyst. GAPDH was used as the housekeeping gene to normalize the results (Fig. 5). Immunohistochemistry of OB-RL in human implantation sites

By means of immunohistochemical analysis, we identified immunoreactivity against the OB-RL in human implantation sites. A positive signal was found in cytotrophoblast cells of villous trophoblast in an 8-wk-old human implantation site and in the epithelial and stromal cells of the maternal deciduas (Fig. 6). In control experiments, immunostaining was not present when the primary antibody was omitted (Fig. 6). Discussion

OB-R was originally described in the choroid plexus (2), but today, its presence is very well documented in several

FIG. 5. Quantification of OB-RL and the soluble isoform HuB219.3 mRNA in EEC cultured with (EEC*) and without (EEC) a human blastocyst. Relative values were normalized with the GAPDH gene and are expressed as mean ⫾ SEM (EEC, control group, n ⫽ 2; EEC*, EEC cocultured with human blastocyst, n ⫽ 6). No statistical differences were found between the control group and EEC cultured in the presence of blastocyst in any of the isoforms investigated (OB-RL, P ⫽ 0.80; and HuB219.3, P ⫽ 0.27, Student’s t test).

reproductive tissues (13). In this study, we present data that uncover the complete leptin system at the human blastocystendometrial interface and highlight the possible biological relevance of this system in human embryonic implantation. We describe how OB-RT mRNA and OB-RL undergo a cyclical variation, with an increased expression during the late secretory phase. Real-time QF-PCR data are confirmed by in situ hybridization analysis, which reveals the localization of OB-RT mRNA mainly at the epithelial and glandular epithelium. Kitawaki et al. (26) previously showed, using Northern blot and semiquantitative PCR, that OB-R and OB-RL were expressed in the endometrium with a peak in the early secretory phase. Our data agree with the results published by Alfer et al. (27), in which the OB-R was more

2448

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

Cervero et al. • Expression of Leptin System in Human Implantation

FIG. 6. Immunohistochemical localization of OB-RL in human implantation sites. A–C, Identification of OB-RL in villous trophoblasts in an 8-wk-old human implantation site. A, Negative control by deletion of the primary antibody. B, OB-RL immunostaining is apparent in cytotrophoblast cells (see arrows) and almost absent in syncytiotrophoblast. C, Detail of the intense immunostaining present in cytotrophoblast cells (arrows). D and E, Immunolocalization of OB-RL in the maternal decidua of an 8-wk-old human implantation site. D, Negative control. E, Staining is present in the cytoplasm of decidual cells, and a strong signal can be observed in the luminal epithelium (see arrows). F and G, Negative and positive adipose tissue control.

expressed during the proliferative and late secretory phase than in the early secretory phase. In the Alfer et al. (27) study, the immunoreactive OB-R was low during the early secretory phase, as we have demonstrated at mRNA level using realtime QF-PCR and in situ hybridization. With respect to the soluble isoforms HuB219.1 and HuB219.3, which had not been previously analyzed, both follow the same pattern of expression as that of the OB-RT and OB-RL, with maximal expression occurring during the late secretory phase and minimal expression noted at the early secretory phase. Therefore, endometrial OB-RL and the soluble forms of OB-R are present in the endometrial epithelium, are available at the time of endometrial receptivity, and display a premenstrual increase. The OB-RL activates the signal pathway via Janus kinases/ STAT or another intracellular mediator (4 –7), and it seems that the endometrium requires leptin to become receptive to the implantation of a blastocyst in the midluteal phase. This hypothesis is supported by our work, in which we report, for the first time, the dynamics of leptin and OB-R mRNA expression from the oocyte stage through to the hatched blastocyst stage of human embryonic development. OB-RT mRNA was detected in human oocytes and at all preimplantation embryonic stages studied. In contrast, leptin mRNA was expressed only in expanded and hatched blastocysts. This endorses the belief that the leptin detected in human oocytes and early preimplantation embryos (28) is of a maternal source, confirms the absence of leptin mRNA in human oocytes (29), and corroborates results reported in

mouse (30) that detected leptin mRNA expression only at the blastocyst stage, whereas OB-Rb and OB-Ra expression was noted throughout the mouse embryonic development. The similarity of the leptin system in the preimplantation embryonic development in both mouse and human models is encouraging given the solid evidence that the leptin presence is mandatory in embryonic implantation in the mouse model (15, 16, 19, 30). We have studied the OB-RT without distinguishing between the isoforms, but because the OB-R and the mediator STAT3 protein are present (28), it is likely that the functional long form of the receptor is among the expressed isoforms. Thus, it is possible that leptin stimulates the development of the human embryo through its receptor because the latter is present at all preimplantation stages. Indeed, there have been in vitro experiments performed in mouse in which blastocysts cultured with 100 ng/ml of leptin increased their total cell number (30). Moreover, significant differences have been found between arrested and competent embryos cultured in vitro (25). Hatched blastocysts that were cultured alone secreted significantly higher concentrations of leptin than arrested blastocysts (25). Due to previous controversial results in the detection of leptin mRNA in human endometrium using RT-PCR, we have further verified its presence using nested PCR in human endometrium and EEC cultured with and without human blastocysts. No signal was found in the first PCR round of 40 cycles with 2 ␮l of cDNA loading. However, when a second set of inner primers was used in the product of the previous

Cervero et al. • Expression of Leptin System in Human Implantation

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

2449

FIG. 7. General hypothesis of the human leptin system interactions at the maternal-embryonic interphase during the preimplantation and implantation phases. During the preimplantation phase, the embryo possesses the leptin receptor, which can be activated through the endocrine and endometrial leptin, thereby promoting the embryonic metabolism. When the embryo reaches the blastocyst stage, leptin is expressed, and this molecule may activate the leptin receptor, which peaks in the receptive endometrium, thereby facilitating the embryo implantation process.

RT-PCR (nested PCR), a clear band of the expected size was observed in human endometrium and EEC. Thus, leptin is expressed in the human endometrium, which confirms our own previously published data (25). Nevertheless, the mRNA levels are very low and only detectable by nested PCR or cDNA overloading. Such low expression could explain why leptin was not detected in human endometrium in other studies (26, 27). Therefore, the human endometrial OB-R may be activated by leptin of embryonic origin, paracrine/autocrine endometrial leptin, and/or endocrine leptin. A specific molecular crosstalk between endometrium and embryo during human implantation has been reported (38, 39). These molecular interactions seem to be initiated in the endometrial epithelium (40 – 42). We performed embryonic regulation experiments to verify whether the presence of blastocyst increased the expression of OB-RL and the soluble form HuB219.3 mRNA in cultured EEC. The human blastocyst did not regulate OB-R mRNA expression. Nevertheless, other effects of OB-R activation on the endometrium, such as sharing the STAT3 pathway used by leukemia inhibitory factor (43), a synergistic angiogenic effect with vascular endothelial growth factor (44), or the activation of different

genes related to embryonic adhesion that have not yet been studied, could be involved. Finally, we reveal the immunolocalization of OB-RL in the cytotrophoblast cells of villous trophoblasts and in the luminal epithelial and stromal cells of maternal decidua. In this way, syncytiotrophoblast cells are a source of leptin (45) that could act on the cytotrophoblast in a paracrine loop or even in an autocrine manner because they supposedly possess OB-R (27), although we did not note a clear staining in syncytiotrophoblast cells. This may promote a more invasive role for the blastocyst modulating, among other possible molecules, the expression of metalloproteinases that enhance the embryo implantation (46). The application of genome-wide analysis with DNA microarrays to human endometrial receptivity reveals, at mRNA level, the hierarchical quantitative contribution of genes to this function (47–50). In these studies, the leptin system did not reveal itself as a prominently regulated gene family. However, quantity is not necessarily related to functionality, and additional studies are required to establish the existence of this relationship. In conclusion, we have demonstrated the maximal expres-

2450

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

sion of OB-RT, OB-RL, and the soluble isoforms HuB219.1 and HuB219.3 in the human endometrium during the late luteal phase. We have also illustrated the expression of OB-RT in human oocytes and preimplantation embryos, whereas embryonic leptin appears only at the blastocyst stage. Moreover, we have shown that OB-RL is present in cytotrophoblast cells. Therefore, it seems that the leptin system may play an important role in the crosstalk between the preimplantation embryo and the receptive endometrium during the human implantation process (Fig. 7), as it does in the mouse model (19). Acknowledgments We thank Francisco Domı´nguez for support and Marı´a Jose´ Escriba´ for assisting with the sample collection. Received December 11, 2003. Accepted February 4, 2004. Address all correspondence and requests for reprints to: Carlos Simo´n, Instituto Valenciano de Infertilidad, Plaza Policı´a Local 3, 46015 Valencia, Spain. E-mail: [email protected]. This work was supported by Fondo de Investigaciones Sanitarias Grant FISS 02/1169 and Sociedad Espan˜ola de Fertilidad (2001 Research Grant). A.C. is a predoctoral fellow financed by Programa para la Formacio´n de Personal Universitario from the Ministerio de Educacio´n, Cultura y Deporte (Madrid, Spain) of the Spanish Government. Results from this work were presented in part at the 50th Annual Meeting of the Society for Gynecologic Investigation, Washington, DC, March 2003.

References 1. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 372:425– 432 2. Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J, Muir C, Sanker S, Moriarty A, Moore KJ, Smutko JS, Mays GG, Woolf EA, Monroe CA, Tepper RI 1995 Identification and expression cloning of a leptin receptor. Cell 83:1263–1271 3. Cioffi JA, Shafer AW, Zupancic TJ, Smith-Gbur J, Mikhail A, Platika D, Snodgrass HR 1996 Novel B219/OB receptor isoforms: possible role of leptin in hematopoiesis and reproduction. Nat Med 2:585–589 4. Bjorbaek C, Uotani S, da Silva B, Flier JS 1996 Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272:32686 – 32695 5. Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Kim H, Lai CF, Tartaglia LA 1996 The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors. Proc Natl Acad Sci USA 93:8374 – 8378 6. Banks AS, Davis SM, Bates SH, Myers Jr MG 2000 Activation of downstream signals by the long form of the leptin receptor. J Biol Chem 275:14563–14572 7. Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers Jr MG 2003 STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856 – 859 8. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, Burgett SG, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, MacKellar W, Rosteck PR, Schoner B, Smith D, Tinslev FC, Zhang WY, Heiman M 1995 The role of neuropeptide Y in the antiobesity action of the obese gene product. Nature 377:530 –532 9. Houseknecht KL, Baile CA, Matteri RL, Spurlock ME 1998 The biology of leptin: a review. J Anim Sci 76:1405–1420 10. Friedman JM, Halaas JL 1998 Leptin and the regulation of body weight in mammals. Nature 395:763–770 11. Messinis IE, Milingos SD 1999 Leptin in human reproduction. Hum Reprod Update 5:52– 63 12. Holness MJ, Munns MJ, Sugden MC 1999 Current concepts concerning the role of leptin in reproductive function. Mol Cell Endocrinol 157:11–20 13. Gonza´lez RR, Simon C, Caballero-Campo P, Norman R, Chardonnens D, Devoto L, Bischof P 2000 Leptin and reproduction. Hum Reprod Update 6:290 –300 14. Moschos S, Chan JL, Mantzoros CS 2002 Leptin and reproduction: a review. Fertil Steril 77:433– 444 15. Chehab FF, Lim ME, Lu R 1996 Correction of the sterility defect in homozygous obese female mice by treatment with the human recombinant leptin. Nat Genet 12:318 –320

Cervero et al. • Expression of Leptin System in Human Implantation

16. Mounzih K, Lu R, Chehab FF 1997 Leptin treatment rescues the sterility of genetically obese ob/ob males. Endocrinology 138:1190 –1193 17. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM 1996 Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632– 635 18. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP 1996 Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491– 495 19. Malik NM, Carter ND, Murray JF, Scaramuzzi RJ, Wilson CA, Stock MJ 2001 Leptin requirement for conception, implantation and gestation in the mouse. Endocrinology 142:5198 –5202 20. Hardie L, Trayhurn P, Abramovich D, Fowler P 1997 Circulating leptin in women: a longitudinal study in the menstrual cycle and during the pregnancy. Clin Endocrinol 47:101–106 21. Quinton ND, Laird SM, Okon MA, Li TC, Smith RF, Ross RJ, Blakemore AI 1999 Serum leptin levels during the menstrual cycle of healthy fertile women. Br J Biomed Sci 56:16 –19 22. Teirmaa T, Luukkaa V, Rouru J, Koulu M, Huupponen R 1998 Correlation between circulating leptin and luteinizing hormone during the menstrual cycle in normal-weight women. Eur J Endocrinol 139:190 –194 23. Stock SM, Sande EM, Bremme KA 1999 Leptin levels vary significantly during the menstrual cycle, pregnancy, and in vitro fertilization treatment: possible relation to estradiol. Fertil Steril 72:657– 662 24. Yamada M, Irahara M, Tezuka M, Murakami T, Shima K, Aono T 2000 Serum leptin profiles in the normal menstrual cycles and gonadotropin treatment cycles. Gynecol Obstet Invest 49:119 –123 25. Gonza´lez RR, Caballero-Campo P, Jasper M, Mercader A, Devoto L, Pellicer A, Simo´n C 2000 Leptin and leptin receptor are expressed in the human endometrium and endometrial leptin secretion is regulated by the human blastocyst. J Clin Endocrinol Metab 85:4883– 4888 26. Kitawaki J, Koshiba H, Ishihara H, Kusuki I, Tsukamoto K, Honjo H 2000 Expression of leptin receptor in human endometrium and fluctuation during the menstrual cycle. J Clin Endocrinol Metab 85:1946 –1950 27. Alfer J, Muller-Schottle F, Classen-Linke I, von Rango U, Happel L, BeierHellwig K, Rath W, Beier HM 2000 The endometrium as a novel target for leptin: differences in fertility and subfertility. Mol Hum Reprod 6:595– 601 28. Antczak M, Van Blerkom JV 1997 Oocyte influences on early development: the regulatory proteins leptin and STAT3 are polarized in mouse and human oocytes and differentially distributed within the cells of the preimplantation stage embryo. Mol Hum Reprod 3:1067–1086 29. Cioffi JA, Van Blerkom J, Antczak M, Shafer A, Wittmer S, Snodgrass HR 1997 The expression of leptin and its receptors in pre-ovulatory human follicles. Mol Hum Reprod 3:467– 472 30. Kawamura K, Sato N, Fukuda J, Kodama H, Kumagai J, Tanikawa H, Nakamura A, Tanaka T 2002 Leptin promotes the development of mouse preimplantation embryos in vitro. Endocrinology 143:1922–1931 31. Noyes RW, Hertig AT, Rock J 1950 Dating the endometrial biopsy. Fertil Steril 1:3–25 32. Kru¨ssel JS, Behr B, Hirchenhain J, Wen Y, Milki AA, Cupisti S, Bielfeld P, Polan ML 2000 Expression of vascular endothelial growth factor mRNA in human preimplantation embryos derived from tripronuclear zygotes. Fertil Steril 74:1220 –1226 33. Ponte P, Ng SY, Engel J, Gunning P, Kedes L 1984 Evolutionary conservation in the untranslated regions of actin mRNA: DNA sequence of a human ␤-actin cDNA. Nucleic Acids Res 12:1687–1696 34. Simo´n C, Mercader A, Garcı´a-Velasco JA, Nikas G, Moreno C, Remohı´ J, Pellicer A 1999 Coculture of human embryos with autologous human endometrial cells in patients with implantation failure. J Clin Endocrinol Metab 84:2638 –2646 35. Mercader A, Garcia-Velasco JA, Escudero E, Remohı´ J, Pellicer A, Simo´n C 2003 Clinical experience and perinatal outcome of blastocyst transfer after coculture of human embryos with human endometrial epithelial cells: a 5-year follow-up study. Fertil Steril 80:1162–1168 36. Simo´n C, Piquette G, Frances A, Polan ML 1993 Localization of interleukin-1 type I receptor and interleukin-1 ␤ in human endometrium throughout the menstrual cycle. J Clin Endocrinol Metab 77:549 –555 37. Simo´n C, Piquette GN, Frances A, El-Danashouri I, Polan ML 1994 The effect of interleukin-1 ␤ (IL-1 ␤) on the regulation of IL-1 receptor type 1 messenger ribonucleic acid and protein levels expression in cultured human endometrial stromal and glandular cells. J Clin Endocrinol Metab 78:675– 682 38. Glasser SR, Mulholland J, Mani SK 1991 Blastocyst endometrial relationships: reciprocal interactions between uterine epithelial and stromal cells and blastocysts. Trophoblast Res 5:225–280 39. De los Santos MJ, Mercader A, France´s A, Portole´s E, Remohı´ J, Pellicer A, Simo´n C 1996 Role of endometrial factors in regulating secretion of components of the immunoreactive human embryonic interleukin-1 system during embryonic development. Biol Reprod 54:563–574 40. Simo´n C, Gimeno MJ, Mercader A, O’Connor JE, Remohı´, Polan ML, Pellicer A 1997 Embryonic regulation of integrins ␤ 3, ␣ 4 and ␣ 1 in human endometrial epithelial cells in vitro. J Clin Endocrinol Metab 82:2607–2616 41. Gala´n A, O’Connor JE, Valbuena D, Herrer R, Remohı´ J, Pampfer S, Pellicer

Cervero et al. • Expression of Leptin System in Human Implantation

42.

43.

44. 45. 46.

A, Simon C 2000 The human blastocyst regulates endometrial epithelial apoptosis in embryonic adhesions. Biol Reprod 63:430 – 439 Meseguer M, Aplin D, Caballero-Campo P, O’Connor JE, Martı´n JC, Remohı´ J, Pellicer A, Simon C 2001 Human endometrial mucin MUC1 is up-regulated by progesterone and down-regulated in vitro by the human blastocyst. Biol Reprod 64:590 – 601 Cheng Jr G, Chen R, Hernandez L, Alvord G, Stewart C 2001 Dual control of LIF expression and LIF receptor function regulate Stat3 activation at the onset of uterine receptivity and embryo implantation. Proc Natl Acad Sci USA 98:8680 – 8685 Cao R, Brakenhielm E, Wahlestedt C, Thyberg J, Cao Y 2001 Leptin induces vascular permeability and synergistically stimulates angiogenesis with FGF-2 and VEGF. Proc Natl Acad Sci USA 98:6390 – 6395 Senaris R, Garcia-Caballero T, Casabiell X, Gallego R, Castro R, Considine RV, Dieguez C, Casanueva, FF 1997 Synthesis of leptin in human placenta. Endocrinology 138:4501– 4504 Castelluci M, De Matteis R, Meisser A, Cancello R, Monsurro` V, Islami D,

J Clin Endocrinol Metab, May 2004, 89(5):2442–2451

47. 48.

49. 50.

2451

Sarzani R, Marzioni D, Cinti S, Bischof P 2000 Leptin modulates extracellular matrix molecules and metalloproteinases: possible implications for trophoblast invasion. Mol Hum Reprod 6:951–958 Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA, Giudice LC 2002 Global gene profiling in human endometrium during the window implantation. Endocrinology 143:2119 –2138 Carson D, Lagow E, Thathiah A, Al-Shami R, Farach-Carson M, Vernon M, Yuan L, Fritz M, Lessey B 2002 Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Mol Hum Reprod 8:971– 879 Borthwick J, Charnock-Jones S, Tom B, Hull L, Teirney R, Phillips S, Smith S 2003 Determination of the transcript profile of human endometrium. Mol Hum Reprod 9:19 –33 Riesewijk A, Martı´n J, van Os R, Horcajadas JA, Polman J, Pellicer A, Mosselman S, Simo´n C 2003 Gene expression profiling of human endometrial receptivity on days LH⫹2 versus LH⫹7 by microarray technology. Mol Hum Reprod 9:253–264

JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.