The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid ...

The Phosphoenolpyruvate Carboxykinase Gene Glucocorticoid Response Unit: Identification of the Functional Domains of Accessory Factors HNF3b (Hepatic Nuclear Factor-3b) and HNF4 and the Necessity of Proper Alignment of Their Cognate Binding Sites

Jen-Chywan Wang, Per-Erik Stro¨mstedt*, Takashi Sugiyama, and Daryl K. Granner Department of Molecular Physiology and Biophysics Vanderbilt University Medical School Nashville, Tennessee, 37232-0615

Complete induction of hepatic phosphoenolpyruvate carboxykinase (PEPCK) gene transcription by glucocorticoids requires a complex glucocorticoid response unit (GRU). The GRU is comprised of two glucocorticoid receptor (GR)-binding sites (GR1 and GR2) and four accessory factor-binding sites [AF1, AF2, AF3, and cAMP response element (CRE)] that bind distinct transcription factors. Hepatic nuclear factor 4 (HNF4) and chicken ovalbumin upstream promoter transcription factor (COUP-TF) bind to the AF1 element and account for AF1 activity. Members of the hepatic nuclear factor 3 (HNF3) family bind to the AF2 element and provide AF2 activity. In this report, we show that the functions of AF1 and AF2 are dependent on their positions in the promoter, since they cannot substitute for each other nor can they be exchanged without a reduction in the response to glucocorticoids. We also identified the domains of HNF4 and HNF3b that are required for the AF1 and AF2 activities, respectively. The carboxy-terminal transactivation domain of HNF4 (amino acids 128–374) confers most of the AF1 activity, while the carboxyterminal transactivation domain of HNF3b (amino acids 361–458) mediates AF2 activity. These domains of HNF4 and HNF3b appear to have distinct roles in the response to glucocorticoids, as there are unique structural requirements for each, as judged by the failure of most other classes of transactivation domains to serve as accessory factors. These results suggest that

the regulation of the PEPCK gene by glucocorticoids requires specific interactions between GR, accessory factors, and coactivators, and that the transactivation domains of AF1 and AF2 are of fundamental importance in the assembly of this multiprotein complex. (Molecular Endocrinology 13: 604–618, 1999)

INTRODUCTION The hepatic phosphoenolpyruvate carboxykinase (PEPCK) gene, which encodes a rate-controlling enzyme of hepatic gluconeogenesis, is under multihormonal control at the transcriptional level (1, 2). Transcription of the PEPCK gene is stimulated by glucocorticoids, retinoic acids, and glucagon (via cAMP), while insulin and glucose repress PEPCK gene transcription (1–5). A complex glucocorticoid response unit (GRU) in the PEPCK gene promoter is required for a complete glucocorticoid response. The GRU consists of two adjacent glucocorticoid receptor (GR)-binding sites (GR1 and GR2) and four accessory elements: AF1, AF2, AF3, and the cAMP response element (CRE) (see Fig. 1) (6–8). GR1 and GR2, alone or in combination, are unable to confer a glucocorticoid response when placed in the context of a heterologous promoter (9). Although none of the four accessory elements mediates a glucocorticoid response itself, deletion or mutation of any accessory element in the PEPCK promoter causes about a 50–70% reduction in the glucocorticoid response (6, 8, 10). Furthermore, any combination of two mutations of AF1, AF2, or AF3 essentially abolishes the glucocorticoid re-

0888-8809/99/$3.00/0 Molecular Endocrinology Copyright © 1999 by The Endocrine Society

604

The PEPCK Gene Glucocorticoid Response Unit

sponse (6). Thus, the PEPCK GR1 and GR2, unlike simple glucocorticoid response elements (GREs) that can mediate a glucocorticoid response, are inactive in the absence of at least two accessory elements. AF1 activity is provided by either of two members of the nuclear receptor superfamily, hepatic nuclear factor 4 (HNF4), or chicken ovalbumin upstream promoter transcription factor (COUP-TF) (11). COUP-TF also binds to the AF3 element and serves as an accessory factor for the glucocorticoid response (6). Members of the hepatic nuclear factor 3 (HNF3) and CCAAT enhancer binding protein (C/EBP) families bind to the AF2 element (12, 13). The binding of HNF3, but not C/EBP, to this element correlates with AF2 activity (14). Hence, HNF3 has been identified as an accessory factor for the glucocorticoid response. Finally, the CRE binding protein (CREB) and C/EBP family members bind to the CRE (12, 15, 16). Although a physical interaction between GR and CREB has been identified in vitro (8), it appears that C/EBPb functions as the accessory factor for the glucocorticoid response through the CRE (16a). In experiments reported in this paper, we show that AF1 cannot substitute for AF2, and vice versa, as the exchange of these elements in the PEPCK GRU results in about a 50% reduction of the glucocorticoid

Fig. 1. Schematic Diagram of the PEPCK GRU The PEPCK GRU includes two GR-binding sites (GR1 and GR2) and four accessory elements (AF1, AF2, AF3, and the CRE) and their associated trans-acting factors (lower panel). The position of each cis-element, relative to the transcription initiation site, is indicated above the figure.

605

response. Thus, AF1 and AF2 both function in a position-dependent manner. We also identify the domains within HNF4 (the AF1 factor) and HNF3b (the AF2 factor) required for accessory factor activity. In both cases, previously identified transactivation domains are critical for accessory factor activity. Several distinct transactivation domains identified in other proteins cannot replace the HNF3 and HNF4 activities in the context of the PEPCK GRU. These results indicate that glucocorticoid-stimulated PEPCK gene transcription requires functional interactions between GR and the transactivation domains of at least two accessory factors, or between these two components and a third, coregulatory protein, and that these interactions require a specific spatial organization of the components of the GRU.

RESULTS AF1 and AF2 Function in a Position-Dependent Manner Constructs were made with various combinations of AF1 and AF2 substitutions in the context of the wild-type PEPCK promoter ligated to the chloramphenicol acetyltransferase (CAT) reporter gene (pAF1–2, also referred to as pPL32 in this and previous publications) to compare the roles of AF1 and AF2 in the PEPCK GRU (Fig. 2). When the AF2 element was replaced by an AF1 element (pAF1–1) or, conversely, when the AF2 element was put at the AF1 site (pAF2–2), glucocorticoid responses were 60–70% lower than those obtained from the wildtype pAF1–2 reporter (Fig. 2). These responses are equivalent to the glucocorticoid response obtained when either AF1 or AF2 is deleted or mutated (7, 10). Thus, these results show that the AF1 element is inert at the position of the AF2 element, and the AF2

Fig. 2. The Alignment of AF1 and AF2 Is Critical H4IIE cells were cotransfected with 10 mg of various reporter constructs [either pAF1–2 (pPL32), pAF1–1, pAF2–2, or pAF2–1] and 5 mg of an expression plasmid that encodes the GR. Cells were treated with or without 500 nM dexamethasone (DEX) for 18–24 h, and CAT activity was measured. Results are presented relative to the wild-type glucocorticoid response (pPL32) and represent the mean 6 SE of the number of experiments indicated.

MOL ENDO · 1999 606

element is inactive at the AF1 site in the PEPCK GRU, and suggest that AF1 and AF2 have distinct functions. These results are consistent with our previous observations (17). Next, the AF1 element and the AF2 element were switched with each other (pAF2–1, Fig. 2) to determine whether their relative positions within the GRU are critical. If a specific spatial alignment between AF1, AF2, and the other members of the GRU is not important for a complete glucocorticoid response, and only the presence of these transcription factors is required, this construct should confer a glucocorticoid response similar to that of the wild-type pAF1–2 reporter. However, the pAF2–1 reporter construct conferred a much weaker glucocorticoid response than did pAF1–2. Thus, the positional alignment of AF1 and AF2 in the PEPCK gene promoter appears to be critical for mediating optimal accessory factor activity.

Vol 13 No. 4

The Carboxy-Terminal Transactivation Domain of HNF3b Confers AF2 Activity The distinct and specific roles of AF1 and AF2 in the GRU suggested by the results obtained in the previous experiment prompted us to localize the domains required for the accessory factor activities in HNF4 and HNF3. We first focused our attention on HNF3. A reporter construct was made wherein the AF2 element was replaced by a yeast GAL4-binding site (pGAL4AF2, Fig. 3A) in the context of the wild-type promoter construct. The response to dexamethasone in cells transfected with pGAL4AF2 was about 30% that of the wild-type pPL32 (Fig. 3A) and is similar to that obtained when the AF2 element is deleted or mutated (a 50–70% reduction) (7, 10). Cotransfection of the pGAL4AF2 construct with expression vectors that encode the GAL4 DNA-binding domain (DBD) ligated to

Fig. 3. The C-Terminal Transactivation Domain of HNF3b Is Sufficient for AF2 Activity A, H4IIE cells were transfected with pPL32, the wild-type PEPCK promoter reporter construct or with pGAL4AF2, wherein the AF2 element is replaced with a GAL4-binding site. In this and subsequent experiments, the amount of DNA transfected is described in Materials and Methods. All cells were cotransfected with the GR expression vector. Cells were treated with or without 500 nM dexamethasone (DEX) for 18–24 h, and CAT activity was measured. Results are presented as the fold induction and represent the average 6 SE. of the number of experiments indicated in parenthesis. B, Expression plasmids encoding one of the various GAL4zHNF3b fusion proteins and the GR expression vector were cotransfected with pGAL4AF2, and the cells were treated with or without 500 nM dexamethasone. The results are presented as described above. The schematic structure of HNF3b protein is also shown. The shaded areas represent the domains critical for the transactivation activity of HNF3b (20). The conserved regions of HNF3a, -b, and -g (I-IV) are also shown.


various domains of HNF3b was performed to identify the region(s) within HNF3b required for AF2 activity (Fig. 3). HNF3b was used in this study because it represents the major constituent that binds to the AF2 element in H4IIE hepatoma cells (14). Cotransfection of H4IIE cells with the pGAL4AF2 reporter construct and an expression plasmid that encodes full-length HNF3b fused to GAL4 DBD had no effect on the glucocorticoid response, as CAT expression was equivalent to that detected in cells transfected with a simple GAL4 DBD construct (data not shown). This result is perhaps not surprising since the GAL4zHNF3b chimeric protein contains two separate DBDs. A similar phenomenon, very low transcriptional activity, was observed when chimeric proteins that contain the GAL4 DBD and either full-length C/EBPa, C/EBPb, and ATF-2 are tested (18, 19). Strong transcriptional activity is observed only when the DBDs of C/EBPa, C/EBPb, and ATF-2 are deleted (18, 19). We therefore constructed a series of expression plasmids that encode proteins in which the GAL4 DBD is ligated to various segments of HNF3b, all of which lack the DBD of the latter. GAL4zHNF3b (1–157), like the GAL4 DBD, did not influence the glucocorticoid response (Fig. 3B, lines 1 and 2). In contrast, cotransfection of cells with the pGAL4AF2 construct and an expression plasmid encoding GAL4zHNF3b(257–458) restored the glucocorticoid response to a level near that found in

607

cells transfected with pPL32 (Fig. 3B, line 3). Thus, the C-terminal domain of HNF3b mediates most of the AF2 activity. Two additional plasmids, wherein smaller segments of the C-terminal portion of HNF3b were fused to the GAL4 DBD, were cotransfected with pGAL4AF2 to further localize the minimal domain required for AF2 activity. While the expression of GAL4zHNF3b(361–458) provided a robust glucocorticoid response in H4IIE cells, nearly the equal of that obtained from pPL32, GAL4zHNF3b(257–360) expression failed to enhance the glucocorticoid response (Fig. 3B, lines 4 and 5). Hence, the accessory activity of AF2 is conferred by the region located between amino acids 361–458 (a.a. 361–458) of HNF3b. The 361–458 domain includes the primary transactivation domain of HNF3b (20). Two regions within this domain are highly conserved among HNF3 family members: a.a. 369–387 (conserved box II) and a.a. 445–458 (conserved box III) (see Fig. 4B) (20). The transactivation capacity of HNF3b is severely reduced when either of these two conserved boxes is deleted or mutated (20). We therefore made the expression plasmid GAL4zHNF3b(388–458), wherein conserved box II is deleted, and GAL4zHNF3b(361–442), wherein conserved box III is deleted (Fig. 4B). Cotransfection of GAL4zHNF3b(388–458) with pGAL4AF2 into H4IIE cells provided a partial glucocorticoid response, but cotransfection of GAL4zHNF3b(361–442) did not provide

Fig. 4. Conserved Regions II and III in HNF3 Are Required for AF2 Activity A, H4IIE cells were transfected with pPL32, the wild-type PEPCK promoter reporter construct, or with pGAL4AF2, wherein the AF2 element is replaced with a GAL4-binding site. All cells were cotransfected with the GR expression vector. Cells were treated with or without 500 nM dexamethasone (DEX) for 18–24 h, and CAT activity was measured. Results are presented relative to the wild-type glucocorticoid response (pPL32; top panel) and represent the average 6 SE of the number of experiments indicated. B, An expression plasmid encoding one of the various GAL4zHNF3b fusion proteins was cotransfected with the GR expression vector and with pGAL4AF2. Cells were treated and results are presented, with or without 500 nM dexamethasone, as described above. The schematic structure of HNF3b protein is shown, as described in Fig. 3.

MOL ENDO · 1999 608

any accessory factor activity (Fig. 4, lines 3 and 4). These data suggest that, although box III contributes most of the activity of AF2, boxes II and III are both required for full AF2 activity (compare lines 2 and 4, Fig. 4B). The inherent capacity for the activation of basal transcription by each of the GAL4zHNF3b fusion protein expression vectors was monitored by cotransfecting them with a CAT reporter plasmid that contains five copies of a GAL4-binding site positioned upstream of a E1B TATA box [(GAL4)5E1bCAT, Fig. 5]. HepG2 cells, previously used to map the transactivation domain of HNF3b (20), were also used in this study since transfection of large amounts of DNA were required to detect basal activity in H4IIE cells. The relative activity of each of the GAL4zHNF3b chimeric proteins is presented in Fig. 5. For comparison, a qualitative indication of AF2 activity of the same constructs is also presented. The activity of GAL4zHNF3b(361–458) is 2-fold higher than that of GAL4zHNF3b(388–458) and 15-fold higher than that of GAL4zHNF3b(361–442) (Fig. 5, lines 5, 6, and 7). Thus, the transactivation capacity of these three GAL4zHNF3b fusion proteins correlates well with their ability to support AF2 activity. Interestingly, expression of GAL4zHNF3b(257–458), which mediates AF2 activity, provided little basal activity (Fig. 5, line 3); perhaps there is a repression domain for

Vol 13 No. 4

basal activity located between a.a. 257–360. The Nterminal portion of HNF3b contains a region that is conserved among HNF3 family members (box IV, a.a. 14–93), and this may be important for transactivation activity (34, 37). However, GAL4zHNF3b(1–157) did not mediate AF2 activity nor did it activate the (GAL4)5E1bCAT reporter gene (Fig. 5, line 2). This is consistent with previous results, which also suggest that this conserved region cannot function as an independent activation domain (20). The expression of the GAL4zHNF3b chimeric proteins was confirmed in an independent gel mobility shift experiment using nuclear extracts prepared from GAL4zHNF3b fusion protein-expressing cells. COS cells were used for this experiment because of the very low transfection efficiency of H4IIE hepatoma cells. All of the chimeric proteins were expressed efficiently, albeit at somewhat different levels (Fig. 6). In fact, GAL4zHNF3b(361– 458), which provides the strongest AF2 activity, was expressed at a low level relative to the other GAL4zHNF3b chimeric proteins (Fig. 6). The Transactivation Domain of HNF4 Provides AF1 Activity The approach described above was also used to localize the functional domain(s) of HNF4 required for

Fig. 5. Comparison of the Basal Transactivation and AF2 Activities of Various GAL4zHNF3b Fusion Proteins Expression plasmids (7.5 mg) that encode the GAL4zHNF3b fusion constructs were cotransfected into HepG2 cells with a reporter construct (2.5 mg) that contains five tandem copies of the GAL4-binding site inserted into the E1b promoter [(GAL4)5E1bCAT)]. Results are presented relative to the activity of GAL4 DBD protein and are the average 6 SE of at least five experiments. The AF2 activity of each GAL4zHNF3b fusion protein is also shown. The schematic structure of the HNF3b protein is shown, as described in Fig. 3.


609

Fig. 6. Expression and DNA Binding of Various GAL4-HNF3b Fusion Proteins COS cells were transfected with expression plasmids (40 mg) that encode various GAL4-HNF4 fusion constructs [1: GAL4DBD; 2: GAL4zHNF3b(1–157); 3: GAL4zHNF3b(257–458); 4: GAL4zHNF3b(257–360); 5: GAL4zHNF3b(361–458); 6: GAL4zHNF3b(361– 442); and 7: GAL4zHNF3b(388–458)]. Whole-cell extracts were prepared, and the gel mobility shift assay was used to analyze expression levels (as described in Materials and Methods). The arrow indicates the various GAL4zHNF3b fusion proteins. Each protein was supershifted by prior incubation with an antibody directed against the GAL4 DBD.

AF1 activity. The glucocorticoid response in H4IIE cells transfected with a pPL32-derived reporter construct in which the AF1 element is replaced with a GAL4-binding site (pGAL4AF1) was 60–70% that of wild type (Fig. 7A), an effect similar to that seen when AF1 is deleted or mutated (7, 10). The glucocorticoid response did not change when cells were cotransfected with pGAL4AF1 and a plasmid that encodes the GAL4 DBD (Fig. 7B, line 1). However, the glucocorticoid response was strongly enhanced when a plasmid that encodes a chimeric protein consisting of the fulllength HNF4 and the GAL4 DBD [GAL4zHNF4(1–455)] was cotransfected into cells with pGAL4AF1 (Fig. 7B, line 2). Cotransfection of a GAL4DBDzHNF4 chimeric protein that lacks the C-terminal 81 amino acids [GAL4zHNF4(1–374)] with the pGAL4AF1 reporter construct into cells provided a slightly greater glucocorticoid response than did GAL4zHNF4(1–455) (Fig. 7B, line 3). Thus, the 374–455 a.a. segment of HNF4 is dispensable for AF1 activity. Since the entire C-terminal transactivation domain of HNF3b is required for AF2 activity, it was of interest to determine whether the two transactivation domains of HNF4 are critical for AF1 activity. One of these domains is located within the first 24 amino acids of the N-terminal region of the protein, and the second resides between amino acids 128–370 (21). Therefore, GAL4zHNF4(1–45), which contains the N-terminal transactivation domain, or GAL4zHNF4(128–374), which contains the C-terminal transactivation domain, was independently cotransfected with pGAL4AF1 into H4IIE cells to determine

whether either transactivation domain harbors AF1 activity. Expression of GAL4zHNF4(1–45) in cells provided no significant AF1 activity (Fig. 7B, line 6). In contrast, the glucocorticoid response in cells transfected with GAL4zHNF4(128–374) was similar to that observed in cells that express GAL4zHNF4(1–455) (Fig. 7B, line 5). Thus, the C-terminal transactivation domain of HNF4 provides most of the AF1 activity. The region from a.a. 361- 366 is a highly conserved motif among members of the nuclear receptor superfamily, and it is essential for activity mediated through the C-terminal transactivation domain (21). Cotransfection of GAL4zHNF4(1–360), an expression plasmid that lacks this region, with the pGAL4AF1 reporter construct did not enhance the glucocorticoid response (Fig. 7B, line 4). A single-point mutation, L366E, causes a severe reduction in the transactivation activity of HNF4 (21). The same mutation, in the fusion construct GAL4zHNF4(1–374/L366E), also abolishes AF1 activity (Fig. 7B, line 7). In conclusion, these data indicate that the C-terminal transactivation domain of HNF4 is indeed critical for its ability to serve as accessory factor 1 in the glucocorticoid response. A comparison of basal transactivation with AF1 activity was performed by cotransfecting the various GAL4zHNF4 fusion protein plasmids with the (GAL4)5E1bCAT reporter construct into H4IIE cells. In general, the transactivation capacities of GAL4zHNF4(1–374), (1–360), and (1–374/L366E) correlate with their ability to provide AF1 activity (Fig. 8, lines 5–7). Interestingly, GAL4zHNF4(1–45) was the

MOL ENDO · 1999 610

Vol 13 No. 4

Fig. 7. The C-Terminal Transactivation Domain of HNF4 Is Sufficient for AF1 Activity A, H4IIE cells were transfected with pPL32, the wild-type PEPCK promoter reporter construct, or pGAL4AF1, wherein the AF1 element is replaced with a GAL4-binding site. All cells were cotransfected with the GR expression vector and were treated with or without 500 nM dexamethasone (DEX) for 18–24 h. CAT activity was then measured as described above. Results are presented relative to the wild-type glucocorticoid response (pPL32; top panel) and represent the average 6 SE of the number of experiments indicated. B, An expression plasmid encoding one of the various GAL4zHNF4 fusion proteins and the GR expression vector were cotransfected with pGAL4AF1. A schematic representation of the structure of the HNF4 protein is shown. The shaded areas represent the transactivation domain of HNF4 (21). The asterisk (*) indicates the mutation site (L366E) in one of the GAL4zHNF4fusion proteins.

strongest activator of the (GAL4)5E1bCAT reporter gene, but it demonstrated very low AF1 activity (Fig. 8, line 3). In contrast, GAL4zHNF4(128–374) mediates AF1 activity, but its transactivation activity is 8-fold lower than that of GAL4zHNF4(1–45) (Fig. 8, line 4). These results suggest that a specific domain, rather than general transactivation capacity, is the determinant of AF1 activity. Although GAL4zHNF4(1–455), (1– 360), and (1–374/L366E) provided similar basal transcriptional activity, only GAL4zHNF4(1–455) mediates AF1 activity, and it is the only one of these three constructs that contains the C-terminal transactivation domain. The basal transcriptional activity of GAL4zHNF4(1–455) is 4-fold lower than GAL4zHNF4(1– 374) (Fig. 8, lines 2 and 5). This result is consistent with the presence of a repression domain for basal transcriptional activity located between a.a. 374 and 455 (21). However, this repression domain has only a slight effect on AF1 activity (Figs. 7 and 8). The expression of the GAL4zHNF4 chimeric proteins was confirmed by an independent assessment in which gel mobility shift experiments were performed using nuclear extracts from COS cells that expressed distinct GAL4zHNF4 fusion proteins (Fig. 9). GAL4zHNF4(1–374), which provides the strongest AF1 activity, was expressed at a

level similar to that of GAL4zHNF4(1–374/L366E) and GAL4zHNF4(1–360) and was expressesed at a level lower than GAL4zHNF4(1–455), GAL4zHNF(1–45), and GAL4zHNF4(128–374) (Fig. 9). These results indicate that the inability of GAL4zHNF(1–45), GAL4zHNF4(1– 374/L366E), and GAL4zHNF4(1–360) to confer AF1 activity is not due to inadequate expression in the cells. The Activity of Other Transactivation Domains at AF1 and AF2, Respectively Plasmids that encode fusion proteins of the GAL4 DBD and various transactivation domains were cotransfected with either pGAL4AF1 or pGAL4AF2 reporter genes (Figs. 10 and 11), to determine whether other classes of transactivation domains can substitute for the accessory factor activities of HNF3 and HNF4. Cotransfection of H4IIE cells with the pGAL4AF1 construct and an expression plasmid that encodes GAL4zE1A, which consists of the GAL4 DBD and the CR3 region of adenovirus E1A protein, provided a 2- to 3-fold induction of the basal promoter activity (data not shown), and the glucocorticoid response was similar to that obtained from GAL4zHNF4(1–374) (Fig. 10B, lines 2 and 3).


611

Fig. 8. Comparison of the Basal Transactivation and AF1 Activities of Various GAL4zHNF4 Fusion Proteins Expression plasmids (2 mg) that encode various GAL4zHNF4 fusion constructs were cotransfected into H4IIE cells with a reporter construct (5 mg) that contains five tandem copies of the GAL4-binding site inserted into the E1b promoter [(GAL4)5E1bCAT]. Results are presented relative to the activity of GAL4 DBD protein and represent the average 6 SE of at least five experiments. The AF1 activity of each GAL4zHNF4fusion protein is also shown. The asterisk (*) indicates the mutation site (L366E) of the GAL4zHNF4fusion protein.

GAL4zE1A also provided a 3- to 5-fold increase of basal promoter activity and conferred some AF2 activity when cotransfected with pGAL4AF2 into the cells (data not shown and Fig. 11B, lines 2 and 3). GAL4zVP16, which contains the GAL4 DBD and the C-terminal acidic transactivation domain of herpes simplex virus VP16 protein, also resulted in a 2- to 3-fold increase of basal promoter activity from pGAL4AF1 and a 3- to 5-fold increase from pGAL4AF2 (data not shown). However, GAL4zVP16 conferred only partial AF1 activity and failed to provide AF2 activity (Fig. 10B, line 4, and Fig. 11B, line 4). GAL4zSP1, which consists of the glutamine-rich activation domain of SP1 fused to the GAL4 DBD, and GAL4zCTF, which consists of the proline-rich activation domain of NF1/CTF fused to the GAL4 DBD, did not increase the basal promoter activity (data not shown) or provide accessory factor activity from either element (Fig. 10B, lines 5 and 6, and Fig. 11B, lines 5 and 6). Hence, among these four distinct classes of transactivation domains, only the E1A CR3 region provided strong AF1 activity, and none afforded complete AF2 activity. These results suggest there is a high degree of specificity associated with the transactivation domains of HNF4 and HNF3b in their roles as accessory factors in the PEPCK GRU.

DISCUSSION Much has been learned from the analysis of simple hormone response elements (HREs) placed, as single or multimerized copies, in the context of heterologous promoter reporter gene constructs. It is not clear, however, whether such receptor-binding elements are sufficient for function in native promoters. Multicomponent assemblies, including the HRE and cis-elements with associated DNA-binding proteins (socalled accessory factors), in an arrangement referred to as a hormone response unit (HRU), appears to be much more common (22). Additional complexity is provided by a number of coregulators, which can bind to the hormone receptor and/or the accessory factors to modulate the rate of transcription of a given gene. A specific HRU thus consists of a number of proteinDNA and protein-protein interactions involving the hormone receptor, accessory factors (.30 have been identified) and coregulators. The PEPCK gene GRU is an example of the HRU described above. A complete response of the PEPCK gene to glucocorticoids requires the presence of four accessory factor elements and associated proteins (AF1, AF2, AF3, CRE) and two GREs (GR1 and GR2) with associated ligand-receptor complexes (see Fig.

MOL ENDO · 1999 612

Vol 13 No. 4

Fig. 9. Expression and DNA Binding of Various GAL4-HNF4 Fusion Proteins COS cells were transfected with expression plasmids (40 mg) that encode various GAL4zHNF4 fusion constructs [1: GAL4 DBD; 2: GAL4zHNF4(1–455); 3: GAL4zHNF4(1–45); 4: GAL4zHNF4(128–374); 5: GAL4zHNF4(1–374); 6: GAL4zHNF4(1–374/L366E); and 7: GAL4zHNF4(1–360)]. Whole-cell extracts were prepared, and the gel mobility shift assay was used to analyze expression levels (as described in Materials and Methods). The result using the GAL4 DBD was also shown in Fig. 6. The arrow indicates the various GAL4zHNF4 fusion proteins. Each protein was supershifted by prior incubation with an antibody directed against the GAL4 DBD.

1). The loss of function of any one of these accessory element factor complexes results as a ;50% reduction of the glucocorticoid response (6, 8, 10). Loss of function of any combination of two results in a complete loss of the glucocorticoid response. Similarly, a partial response is obtained if either of the GREs is deleted, but GR1 is quantitatively more important than GR2 (9). It is evident that considerable redundancy has been built into this system. Having defined the components of the GRU, we can now begin to address several key questions. For example, are there unique structural requirements with respect to the orientation, positioning, and spacing of the accessory factors with respect to each other and the GREs? What domains are responsible for the accessory factor action of these proteins? Are coregulatory proteins involved? And finally, how does all of this come together to control the rate of transcription of the PEPCK gene? The work in this paper addresses the first two of these questions. In the studies described above, it is apparent that AF1 cannot substitute for AF2, and vice versa. Also, the two elements do not work well when inverted with respect to the rest of the GRU (Fig. 2). Therefore, it appears that a specific spatial organization of AF1 and AF2 within the PEPCK gene GRU is critical for the complete glucocorticoid response. These results also suggest that AF1 and AF2 have distinct functions. If so, specific domains that either activate transcription directly, or through a coregulatory intermediate, should be present in the accessory factors that bind to these elements, namely HNF4 and HNF3.

AF1 activity is conferred by the carboxy-terminal transactivation domain of HNF4 (a.a. 128–374) (Fig. 8). It is not known whether this domain functions directly or indirectly. The fact that this accessory function can be assumed by the activation domains of E1A or VP16, which have no obvious similarity to the HNF4 domain (Fig. 9A), suggests that a protein-protein interaction is involved. HNF4 binds to TFIIB and facilitates formation of the preinitiation complex (23); however, an HNF4 mutant that lacks the C-terminal activation domain still binds to TFIIB (23), so the effect may be mediated through the N-terminal transactivation domain, a region not necessary for accessory factor action in our studies (Fig. 8). Several coactivators, such as steroid receptor coactivator-1 (SRC-1) (24), CBP/p300 (25– 27), glucocorticoid receptor interacting protein 1 (GRIP1)/TIF2 (28–30), and RAC3/ACTR (31–33), associate with the C-terminal activation domain of various members of the nuclear receptor superfamily. These proteins, including HNF4, have very similar C-terminal transactivation domains (21). Indeed, we and others have recently shown that SRC-1, GRIP1, and CBP/ p300 function as coactivators for HNF4 (34, 35). The CR3 region of E1A exhibits AF1 activity, so this domain and the C-terminal region of HNF4 may interact with a common coactivator. The CR3 domain associates with a wide variety of transcription factors and components of the basal transcription machinery, including the TATA-box binding protein (TBP), certain TBPassociated factors (TAF) such as human TAF 135 (36), Drosophila TAF 110, and TAF 250 (37), and several other DNA binding proteins, including ATF2, USF, and


613

Fig. 10. Domain Specificity of AF1 Activity A, H4IIE cells were transfected with pPL32, the wild-type PEPCK promoter reporter construct or with pGAL4AF1, wherein the AF1 element is replaced with a GAL4-binding site. All cells were cotransfected with the GR expression vector. Cells were treated with or without 500 nM dexamethasone (DEX) for 18–24 h, and CAT activity was measured. Results are presented relative to the wild-type glucocorticoid response (pPL32) and represent the average 6 SE of the number of experiments indicated. B, An expression plasmid, encoding one of the various GAL4 DBD and transactivation domain fusion proteins, and the GR expression vector were cotransfected with pGAL4AF1. Other details are as described in panel A.

SP1 (38). However, the interaction between the CR3 region of E1A and SRC-1, GRIP1, and CBP/p300 has not been reported. Therefore, it is also possible that distinct coactivators provide AF1 activity in the context of the PEPCK GRU; thus, HNF4 and E1A may each interact with different coactivators. COUP-TF also serves as accessory factor 1 for the PEPCK glucocorticoid response through both the AF1 and AF3 elements (6, 11). COUP-TF functions as both a positive and negative regulator of gene transcription (39), and it is not known whether COUP-TF uses the same mechanism as HNF4 to provide AF1 activity. We are currently identifying the domain(s) that provide AF1 activity in COUP-TF, and this analysis should clarify the issue of whether unique or common coactivators are involved. AF2 activity is provided by the C-terminal transactivation domain of HNF3b, which contains two regions that are conserved in the various members of the HNF3 family of transcription factors (20). Region III (a.a. 445–458) contributes most of the AF2 activity, although region II (a.a. 369–387) is required for complete AF2 activity (Fig. 4). These regions do not have amino acid sequence motifs common to known transactivation domains (20). However, region III is a potent transactivator when fused to the GAL 4 DBD (Fig. 5). No coactivator has been identified to date that specif-

ically interacts with the C-terminal transactivation domain of HNF3b. The CR3 domain of E1A provides substantial AF2 activity (Fig. 11), but VP16, in contrast to the case with AF1, is inactive. Future experiments should clarify whether this distinction is important. Furthermore, we have recently found that HNF3b and GR interact in vitro (17). However, the C-terminal transactivation domain of HNF3b does not interact with GR in glutathione-S-transferase pull-down experiments (J.-C. Wang and D. K. Granner, unpublished observation). More studies will be required to determine whether the previously noted interaction between HNF3b and GR is physiologically important. The identification of the domains of HNF4 and HNF3b necessary for accessory factor activity brings us a step closer to understanding how the GRU works. In a previous paper we suggested that AF1 might stabilize the binding of GR to GR1, and that AF2 could be required for achieving the maximal transactivation potential of the GRU (9). This hypothesis is based on the observation that the AF1 element is no longer required for the PEPCK gene glucocorticoid response when GR1, a low-affinity GR-binding site, is replaced by a strong GR-binding site (9). In contrast, the AF2 element is still required for a complete glucocorticoid response in this situation. The observation that AF1 and AF2 cannot substitute for one another, and that

MOL ENDO · 1999 614

Vol 13 No. 4

Fig. 11. Domain Specificity of AF2 Activity A, H4IIE cells were transfected with pPL32, the wild-type PEPCK promoter reporter construct, or with pGAL4AF2 wherein the AF2 element is replaced with a GAL4-binding site. All cells were cotransfected with the GR expression vector. Cells were treated with or without 500 nM dexamethasone (DEX) for 18–24 h and CAT activity was measured. Results are presented relative to the wild-type glucocorticoid response (pPL32) and represent the average 6 SE of the number of experiments indicated. B, An expression plasmid, encoding one of the various GAL4 DBD and transactivation domain fusion proteins, and the GR expression vector were cotransfected with pGAL4AF2. Other details are as described in panel A.

these elements must be oriented in a certain way with respect to each other and with the GR-binding sites, coupled with the identification of the transactivation domains of HNF4 and HNF3b, should allow us to test the hypothesis that the assembly of a stereospecific nucleoprotein complex results in the stabilization of GR binding to the promoter and allows for efficient activation of the basal transcription machinery. GR may act as a signal transducer that triggers the assembly of this nucleoprotein complex rather than as a transactivator, since neither GR1 nor GR2 can mediate a glucocorticoid response by themselves. Alternatively, the transactivation domain of GR may contribute to the overall transcriptional capacity of the PEPCK GRU, but only in the presence of the interaction and/or transactivation domains of the accessory factors. The PEPCK gene GRU is conceptually similar to the interferon b (IFNb) enhanceosome. Viral induction of the IFNb gene requires the functional interaction of several regulatory elements, designated PRD I, II, III, and IV. PRD II, III, and IV bind the transcription factors NFkB, IRF1, and an ATF/c-Jun heterodimer, respectively. Substitution of PRD IV with PRD II markedly reduces the viral induction (40) just as substitution of the AF1 and AF2 elements reduces the glucocorticoid response of the PEPCK gene. Interestingly, when the

transactivation domains of either NFkB or IRF1 are replaced by the transactivation domain of VP16, viral induction of IFNb enhanceosome is markedly decreased even though these constructs provide much stronger basal transcription activity (41). Furthermore, replacement of the transactivation domain of p65 by IRF1 reduces viral induction of IFNb enhanceosome activity (41), a result also similar to those described in this paper. The assembly of a high-order nucleoprotein complex is required for the highly specific activation of IFNb enhanceosome, and CBP/p300 serves as an integrator in this complex (41–43). It is conceivable that the activation of PEPCK gene transcription by glucocorticoids may use a similar mechanism. The next challenge will be the identification of coactivators that interact with the functional domains of HNF3b and HNF4 and mediate AF1 and AF2 activities. The multicomponent GRU may have evolved to provide both tissue-specific expression and versatile hormonal regulation of hepatic PEPCK gene transcription in response to a wide variety of environmental cues. For example, PEPCK gene transcription is positively regulated by glucocorticoids in liver and negatively regulated in adipose tissue (1, 44). The liver-enriched transcription factors, HNF3 and HNF4, serve as AF2 and AF1, respectively, but these factors are not present in adipose tissue. Thus, tissue-specific acces-


sory factors may allow for differential regulation of PEPCK gene transcription by the same effector in different tissues. A simple GRE represents either an “all or none” or “on and off” switch, whereas the GRU allows for a graded response, and the multiple GR-binding sites and accessory factors provide inherent intraunit redundancy. Interestingly, the PEPCK GRU is part of a much more complex assembly of elements and factors, which we have termed a metabolic control domain (MCD) (45). The MCD consists of the response units for several hormones and metabolites, and it provides an integrated response to the demands of the organism for tightly regulated gluconeogenesis. In addition to their role in the glucocorticoid response, the AF1 and AF3 elements also function as retinoic acid response elements (RARE 1 and 2) by binding a heterodimeric complex that consists of the retinoic acid receptor and 9-cis-retinoic acid receptor (RAR/ RXR) (5, 46, 47). RARE1 and RARE2 collectively constitute an RARU and mediate the retinoic acid response that is necessary for gluconeogenesis (48). The CRE is an accessory element in the glucocorticoid response, and is part of a cAMP response unit that mediates the stimulatory effect of glucagon (15, 49, 50), which is the primary hormonal stimulator of gluconeogenesis. Finally, the AF2 element, as part of a multicomponent IRU, also mediates the repressive effect of insulin by binding an, as yet unidentified, protein (51) and thus participates in the down-regulation of gluconeogenesis. Thus, the different sets of pro-

615

teins that bind to the PEPCK MCD, of which the GRU is an integral part, determine the direction and magnitude of PEPCK gene transcription and provide for additivity, synergism, intra- and inter-unit redundancy, and the dominance of one effect over another. This complex system has presumably evolved to provide the array of responses necessary to maintain a rate of gluconeogenesis compatible with the adaptive needs of the organism.

MATERIALS AND METHODS Plasmid Constructions Oligonucleotides used in plasmid constructions (listed in Table 1) were synthesized by an Expedite 8909 oligonucleotide synthesizer (Perceptive Biosystems, Framingham, MA). The plasmids pGAL4AF1, pGAL4AF2, pAF1–1, and pAF2–2 were derived from pPL32 by PCR-based mutagenesis using the corresponding oligonucleotides and a 39-chloramphenicol acetyltransferase (CAT) primer. pPL32 is a fusion gene construct that contains the PEPCK gene promoter sequence from nucleotides 2467 to 169 (relative to the transcription start site) ligated to the CAT reporter gene (52). pPL32 was cleaved with HindIII and BglII, and the wild-type PEPCK sequence was replaced with the various PCR-derived sequences. The entire sequence of the subcloned DNA fragment was confirmed by sequencing. The plasmid pAF2–1 was generated by the same method, using the pAF1–1 reporter plasmid as a template and oligonucleotide AF2–2 as a primer. The reporter plasmid (GAL4)5E1bCAT has been previously described (53).

Table 1. Oligonucleotides Used in This Study Name

39-CAT primer GAL4AF2 GAL4AF1 AF2-2 AF1-1 H3/N/257 H3/C/458/X H3/N/1 H3/C/157 H3/C/360 H3/N/361 H3/C/458/K H3/C/442 H3/N/388 H4/N/1 H4/C/45 H4/C/455 H4/C/374 H4/C/360 H4/C/374/M366 H4/N/128

Sequence

CTCCATTTTAGCTTCCTTAGCTCC GGGAGTGACACCTCACACGGAGGACTGTCCTCC GACCAGCAGCCACTGGCAC GACAGCTGAATTCCCTTCCGGAGGACTGTCC TCCGGGGAGTGACACCTCACAG CTGAATTCCCTTCTCATGTGGTGTTTTGGTGG GAGTGACACCTCA TGACACCTCACAGCTGACCTTTGGCCACAAC CAGCAGCCACTG GCGCGGATCCGTAAGCAACTGGCGTTGAAGG TGCTCTAGATCAGGACGAGTTCATAATAGGC GCGCGGATCCTGCTGGGAGCCGTGAAG TGCTCTAGATCAGTGAGTGTAGCTGCGCC CGGGGTACCCTCATGGTGGCAGGCCAGGAT GCGCGGATCCGTGAGGCCCACCTGAAGCC CGGGGTACCCTCAGGACGAGTTCATAATAGGC CGGGGTACCCTCAGTCTGCAGCCAGGGGC GCGCGGATCCGTCATCATCACAGCCACCAC GCGCGGATCCTGGACATGGCTGACTAC TGCTCTAGATCACAGGCTGTTGGATGAG CGGGGTACCCTCAGATGGCTTCCTGCTTGG CGGGGTACCCTCAGGGCGCGTCACTGGCA CGGGGTACCTCACAGGTTGTCAATCTTGGC CGGGGTACCTCAGGGCGCGTCACTGGCAGACC TCCCTCCAGCATCTCCTGCAGC GCGCGGATCCTGATCAGCACGCGGAGGTC

MOL ENDO · 1999 616

The expression plasmids for GAL4zHNF4 chimeras were generated in two steps. First, the nucleotide sequences of rat HNF4 corresponding to a.a. 1–45, 1–455, 1–374, 1–360, and 128–374 were generated by PCR using primers H4/N/1 and H4/C/45, H4/N/1 and H4/C/455, H4/N/1 and H4/C/374, H4/ N/1 and H4/C/360, and H4/N/128 and H4/C/374, respectively. A single point mutation of amino acid 366 (L366E) in the nucleotide sequence corresponding to a.a. 1–374 was generated by PCR using primers H4/N/1 and H4/C/374/ M366. These PCR fragments were then digested with BamHI and KpnI, or BamHI and XbaI for the 1–45 fragment, and subcloned into the simian virus 40 (SV40) enhancer-driven GAL4 expression plasmid pSG424 (54). The expression plasmids for GAL4zHNF3b were generated by the same method. The nucleotide sequences of rat HNF3b that correspond to a.a. 1–157, 257–458, 257–360, 361–458, 361–442, and 388– 458 were generated by PCR using primers H3/N/1 and H3/ C/157, H3/N/257 and H3/C/458/X, H3/N/257 and H3/C/360, H3/N/361 and H3/C/458, H3/N/361 and H3/C/442, and H3/ N/388 and H3/C/458/K, respectively. These PCR fragments were then digested with BamHI and KpnI, or BamHI and XbaI for the 1–157 and 257–458 fragments, and subcloned into pSG424. The sequence of all subcloned DNA fragments was verified by DNA sequencing. The expression plasmids, GAL4zVP16, GAL4zE1A, GAL4zSP1, and GAL4zCTF/NF1, have been described previously (53, 55, 56). pSV2GR, which expresses the rat GR under control of the SV40 promoter, was provided by K. R. Yamamoto (University of California at San Francisco). RSV (Rous sarcoma virus)-b-galactosidase was provided by M. A. Magnuson (Vanderbilt University, Nashville, TN). Cell Culture, Transient Transfection, and CAT Assays The methods of transfection and maintenance of H4IIE and HepG2 hepatoma cells have been described previously (7, 13). In the experiments performed with H4IIE cells, the dexamethasone response varied from 7- to 20-fold (with dexamethasone/without dexamethasone). The variation was passage and batch dependent. For this reason, we expressed the data as a percentage of the wild-type dexamethasone response, which gave much more consistent results. For experiments that map the accessory domains of HNF3b and HNF4, 10 mg of the reporter construct (pGAL4AF2 or pGAL4AF1) were cotransfected with 5 mg of GR expression vector, and 1, 2.5, 5, or 10 mg of expression plasmid encoding the various GAL4zHNF3b or GAL4zHNF4 fusion proteins. The optimal hormonal responses from each titration experiment were pooled. The optimal concentration for the expression plasmids encoding the GAL4zHNF4 fusion proteins was consistently 1 mg. However, the concentration required for an optimal glucocorticoid response using the GAL4zHNF3b expression plasmids encoding the various GAL4DBD and transactivation domain fusion proteins ranged from 5 to 10 mg. In the experiments using HepG2 cells, CAT activity was normalized to b-galactosidase activity. b-Galactosidase activity was measured by adding 25 ml cell extract to 175 ml assay of buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, and 50 mM b-mercaptoethanol), and 80 ml o-nitrophenol-b-D-galactopyranoside (ONPG) solution (4 mg/ml ONPG, 72 mM Na2HPO4, 200 mM NaH2PO4). b-Galactosidase activity was monitored by absorbance at 420 nm. COS-1 cells were grown in DMEM containing 10% FCS (GIBCO/BRL, Gaithersburg, MD). The calcium phosphate method was used to transfect COS cells. Briefly, the calcium chloride-plasmid DNA precipitate was added to 1–1.5 3 106 cells. After incubation at 37 C for 18–20 h, cells were washed with PBS and then placed in fresh culture medium and incubated for an additional 24 h. Whole-cell extracts of COS cells were prepared as described previously (57). Briefly, the cells were washed with PBS, collected by centrifugation, and resuspended in 50–60 ml of lysis buffer [20 mM HEPES (pH 7.9), 0.4 M NaCl, glycerol 25%, 1 mM EDTA, 2.5 mM dithiothreitol,

Vol 13 No. 4

and 1 mM phenylmethylsulfonylfluoride]. Cells were kept on ice for 15–20 min, frozen at 270 C, and thawed on ice. The cell suspension was then centifuged for 10 min in a microfuge at 4 C. The supernatant was used in the gel mobility shift experiments. Gel Mobility Shift Assays The gel mobility shift assays were performed as described previously (58) with certain modifications. Briefly, whole-cell extracts (5 mg) were incubated in the presence or absence of a GAL4 DBD antibody (Santa Cruz Biotechnology, Santa Cruz, CA) in a 10-ml reaction for 10–15 min and then mixed with 10 ml of a reaction buffer containing 30,000 cpm 32Plabeled DNA probe (59-CACACGGAGGACTGTCCTCCGACCA-39), 20 mM HEPES, pH 7.7, 100 mM NaCl, 5 mM MgCl2, 10 mM ZnCl2, 6% glycerol, 0.6 mg poly(dIzdC) (Pharmacia, Piscataway, NJ), and 2 mg salmon sperm DNA, for another 10–15 min at room temperature. The reaction mixtures were then loaded onto a 4.8% polyacrylamide gel in 0.53 Tris-borate/EDTA electrophoresis buffer (TBE). After electrophoresis at 20 mA for 150 min at room temperature, the gels were dried and exposed to an x-ray film (Eastman Kodak, Rochester, NY).

Acknowledgments We thank Drs. Frances Sladek and Rob Costa for providing HNF4 and HNF3b cDNA, respectively. We thank Dr. James Manley for providing GAL4zCTF expression plasmid and Dr. Yoel Sadovsky for providing GAL4zSP1 expression plasmid. We also thank Drs. Roland Stein, Mina Peshavaria, and Rob Hall for providing reagents and helpful discussions; Drs. Calum Sutherland and Don Scott, for a critical reading of this manuscript; Cathy Caldwell for her excellent technical assistance; and Deborah C. Brown for helping to prepare this manuscript.

Received August 24, 1998. Revision received December 22, 1998. Accepted January 8, 1999. Address requests for reprints to: Dr. Daryl K. Granner, Molecular Physiology and Biophysics, Vanderbilt School of Medicine, 707 Light Hall, Nashville, Tennessee 37232-0615. E-mail: [email protected] This work was supported by NIH Grant DK-35107 and by the Vanderbilt Diabetes Research and Training Center (Grant DK-20593). * Present address: Astra Draco AB, Cell and Molecular Biology, 221 00 Lund, Sweden.

REFERENCES 1. Hanson RW, Patel YM 1994 PEPCK: the gene and the enzyme. Adv Enzymol 69:203–281 2. Hanson RW, Reshef L 1997 Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Biochem 66:581–611 3. Lamers WH, Hanson RW, Meisner HM 1982 Cyclic AMP stimulates transcription of the gene for cytosolic phosphoenolpyruvate carboxykinase gene in rat liver nuclei. Proc Natl Acad Sci USA 79:5137–5141 4. Sasaki K, Cripe TP, Koch SR, Andreone TD, Petersen DD, Beale EG, Granner DK 1984 Multihormonal regulation of phosphoenolpyruvate carboxykinase gene transcription. The dominant role of insulin. J Biol Chem 259:15242–15251


5. Lucas PC, O’Brien RM, Mitchell JA, Davis CM, Imai E, Forman BM, Samuels HH, Granner DK 1991 A retinoic acid response element is part of a pleiotropic domain in the phosphoenolpyruvate carboxykinase gene. Proc Natl Acad Sci USA 88:2184–2188 6. Scott DK, Mitchell JA, Granner DK 1996 The orphan receptor COUP-TF binds to a third glucocorticoid accessory factor element within the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:31909– 31914 7. Imai E, Stromstedt PE, Quinn PG, Carlstedt-Duke J, Gustafsson JA, Granner DK 1990 Characterization of a complex glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 10:4712–4719 8. Imai E, Miner JN, Mitchell JA, Yamamoto KR, Granner DK 1993 Glucocorticoid receptor-cAMP response elementbinding protein interaction and the response of the phosphoenolpyruvate carboxykinase gene to glucocorticoids. J Biol Chem 268:5353–5356 9. Scott DK, Stromstedt P-E, Wang J-C, Granner DK 1998 Further characterization of he glucocorticoid response unit in the phosphoenolpyruvate carboxykinase gene. The role of the glucocorticoid receptor-binding sites. Mol Endocrinol 12:482–491 10. Mitchell JA, Noisin E, Hall RK, O’Brien R, Imai E, Granner DK 1994 Integration of multiple signals through a complex hormone response unit in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 8:585– 594 11. Hall RK, Sladek FM, Granner DK 1995 The orphan receptors COUP-TF and HNF-4 serve as accessory factors required for induction of phosphoenolpyruvate carboxykinase gene transcription by glucocortricoids. Proc Natl Acad Sci USA 92:412–416 12. O’Brien RM, Lucas PC, Yamasaki T, Noisin EL, Granner DK 1994 Potential convergence of insulin and cAMP signal transduction systems at the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter through CCAAT/ enhancer binding protein (C/EBP). J Biol Chem 269: 30419–30428 13. O’Brien RM, Noisin EL, Suwanicul A, Yamasaki T, Lucas PC, Wang J-C, Powell DR, Granner DK 1995 Hepatic nuclear factor 3- and hormone-regulated expression of the phosphoenolpyruvate carboxykinase and insulin-like growth factor-binding protein 1 genes. Mol Cell Biol 15:1747–1758 14. Wang J-C, Stromstedt P-E, O’Brien RM, Granner DK 1996 Hepatic nuclear factor 3 is an accessory factor required for the stimulation of phosphoenolpyruvate carboxykinase gene transcription by glucocorticoids. Mol Endocrinol 10:794–800 15. Liu J, Park EA, Gurney AL, Roesler WJ, Hanson RW 1991 cAMP induction of PEPCK gene transcription is mediated by multiple promoter elements. J Biol Chem 266:19095–19102 16a.Yamada K, Duong DT, Scott DK, Wang J-C, Granner DK 1999 CCAAT/Enhancer-binding protein is an accessory factor for the glucocorticoid response from the cAMP response element in the rat phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 274:5880–5887 16. Park EA, Gurney AL, Nizielski SE, Hakimi P, Cao Z, Moorman A, Hanson RW 1993 Relative roles of CCAAT/ enhancer-binding protein beta and cAMP regulatory element-binding protein in controlling transcription of the gene for phosphoenolpyruvate carboxykinase (GTP). J Biol Chem 268:613–619 17. Sugiyama T, Scott DK, Wang J-C, Granner DK 1998 Structural requirements of the glucocorticoid and retinoic acid response units in the phosphoenolpyruvate carboxykinase gene promoter. Mol Endocrinol 12;1487– 1498 18. Li XY, Green MR 1996 Intramolecular inhibition of acti-

617

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

vating transcription factor-2 function by its DNA-binding domain. Genes Dev 10:517–527 Williams SC, Baer M, Dillner AJ, Johnson PF 1995 CRP2 (C/EBP beta) contains a bipartite regulatory domain that controls transcriptional activation, DNA binding and cell specificity. EMBO J 14:3170–3183 Pani L, Overdier JG, Porcella A, Qian X, Lai E, Costa RH 1992 Hepatic nuclear factor 3b contains two transcriptional activation domains, one of which is novel and conserved with Drosophila forkhead protein. Mol Cell Biol 12:3723–3732 Hadzopoulou-Cladaras M, Kistanova E, Evagelopoulou C, Zeng S, Cladaras C, Ladias JAA 1997 Functional domains of the nuclear receptor hepatocyte nuclear factor 4. J Biol Chem 272:539–550 Lucas PC, Granner DK 1992 Hormone response domains in gene transcription. Annu Rev Biochem 61:1131– 1173 Malik S, Karathanasis SK 1996 TFIIB-directed transcriptional activation by the orphan nuclear receptor hepatocyte nuclear factor 4. Mol Cell Biol 16:1824–1831 Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354– 1357 Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H, Montminy M, Evans RM 1996 Role of CBP/P300 in nuclear receptor signalling. Nature 383:99–103 Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S-C, Heyman RA, Rose DW, Glass CK, Rosenfeld MG 1996 A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85:403–414 Hanstein B, Eckner R, DiRenzo J, Halachmi S, Liu H, Searcy B, Kurokawa R, Brown M 1996 p300 Is a component of an estrogen receptor coactivator complex. Proc Natl Acad Sci USA 93:11540–11545 Voegel JJ, Heine MJ, Zechel C, Chambon P, Gronemeyer H 1996 TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J 15:3667–3675 Hong H, Kohli K, Trivedi A, Johnson DL, Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. Proc Natl Acad Sci USA 93:4948–4952 Hong H, Kohli K, Garabedian MJ, Stallcup MR 1997 GRIP1, a transcriptional coactivator for the AF-2 transactivation domain of steroid, thyroid, retinoid, and vitamin D receptors. Mol Cell Biol 17:2735–2744 Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580 Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG 1997 The transcriptional coactivator p/CIP binds CBP and mediates nuclear-receptor function. Nature 387:677–684 Li H, Gomes PJ, Chen JD 1997 RAC3, a steroid/nuclear receptor-associated coactivator that is related to SRC-1 and TIF2. Proc Natl Acad Sci USA 94:8479–8484 Wang J-C, Stafford JM, Granner DK 1998 SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 273:30847–30850 Yoshida E, Aratani S, Itou H, Miyagishi M, Takiguchi M, Osumu T, Murakami K, Fukamizu A 1997 Functional association between CBP and HNF4 in Trans-activation. Biochem Biophys Res Commun 241:664–669 Mazzarelli JM, Mengus G, Davidson I, Ricciardi RP 1997

MOL ENDO · 1999 618

37.

38.

39.

40.

41.

42. 43. 44.

45.

46.

47.

The transactivation domain of adenovirus E1A interacts with the C terminus of human TAF(II)135. J Virol 71:7978– 7983 Geisberg JV, Chen JL, Ricciardi RP 1995 Subregions of the adenovirus E1A transactivation domain target multiple components of the TFIID complex. Mol Cell Biol 15:6283–6290 Liu F, Green MR 1994 Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains. Nature 368:520–525 Tsai SY, Tsai MJ 1997 Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age. Endocr Rev 18:229–240 Thanos D, Maniatis T 1995 Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 83:1091–1100 Merika M, Williams AJ, Chen G, Collins T, Thanos D 1998 Recruitment of CBP/p300 by the IFNb enhanceosome is required for synergistic activation of transcription. Mol Cell 1:277–287 Carey M 1998 The enhanceosome and transcription synergy. Cell 92:5–8 Tjian R, Maniatis T 1994 Transcriptional activation: a complex puzzle with few easy pieces. Cell 77:5–8 Franckhauser VS, Antras FJ, Robin D, Robin P, Forest C 1997 Transcriptional and posttranscriptional mechanisms of glucocorticoid-mediated repression of phosphoenolpyruvate carboxykinase gene expression in adipocytes. J Cell Biochem 66:386–393 Hall RK, Scott DK, O’Brien RM, Granner DK 1993 From metabolic pathways to metabolic control domains: multiple factors bind the PEPCK AF1/retinoic acid response element. In: Mornex R, Jaffiol C, Leclere J (eds) Progress in Endocrinology. The Proceedings of the Ninth International Congress of Endocrinology. The Parthenon Publishing Group, Nice, France, vol. 177:777–782 Hall RK, Scott DK, Noisin EL, Lucas PL, Granner DK 1992 Activation of the phosphoenolpyruvate carboxykinase gene retinoic response element is dependent on a retinoic acid receptor/coregulator complex. Mol Cell Biol 12:5527–5535 Scott DK, Mitchell JA, Granner DK 1996 Identification and charaterization of the second retinoic acid response

Vol 13 No. 4

48.

49.

50.

51.

52.

53. 54. 55. 56.

57. 58.

element in the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 271:6260–6264 Shin DJ, McGrane MM 1997 Vitamin A regulates genes involved in hepatic gluconeogenesis in mice: phosphoenolpyruvate carboxykinase, fructose-1,6-bisphosphatase and 6-phosphofructo-2-kinase/fructose-2,6bisphosphatase. J Nutr 127:1274–1278 Roesler WJ, Graham JG, Kolen K, Klemm DJ, McFie PJ 1995 The cAMP response element binding protein synergizes with other transcription factors to mediate cAMP responsiveness. J Biol Chem 270:8225–8232 Roesler WJ, Crosson SM, Vinson C, McFie PJ 1996 The alpha-isoform of the CCAAT/enhancer-binding protein is required for mediating cAMP responsiveness of the phosphoenolpyruvate carboxykinase promoter in hepatoma cells. J Biol Chem 271:8068–8074 O’Brien RM, Lucas PC, Forest CD, Magnuson MA, Granner DK 1990 Identification of a sequence in the PEPCK gene that mediates a negative effect of insulin on transcription. Science 249:533–537 Petersen DD, Magnuson MA, Granner DK 1988 Location and characterization of two widely separated glucocorticoid response elements in the phosphoenolpyruvate carboxykinase gene. Mol Cell Biol 8:96–104 Lillie JW, Green MR 1989 Transcription activation by the adenovirus E1a protein. Nature 338:39–44 Sadowski I, Ptashne M 1989 A vector for expressing GAL4(1–147) fusions in mammalian cells. Nucleic Acids Res 17:7539 Han K, Manley JL 1993 Transcriptional repression by the Drosophila even-skipped protein: definition of a minimal repression domain. Genes Dev 7:491–503 Sadovsky Y, Webb P, Lopez G, Baxter JD, Fitzpatrick PM, Gizang GE, Cavailles V, Parker MG, Kushner PJ 1995 Transcriptional activators differ in their responses to overexpression of TATA-box-binding protein. Mol Cell Biol 15:1554–1563 Pagano M, Draetta G, Jansen-Durr P 1992 Association of cdk2 kinase with the transcription factor E2F during S phase. Science 255:1144–1147 Yoshima T, Yura T, Yanagi H 1998 Function of the Cterminal transactivation domain of human heat shock factor 2 is modulated by the adjacent negative regulatory segment. Nucleic Acids Res 26:2580–2585