IlLudwig Institute for Cancer Research, Uppsala Branch, Biomedical Centre, S-75122 Uppsala, .... tech, Palo Alto, CA. ...... 90-123, Academic Press, Orlando, FL.
T H EJOURNAL OF BIOLOGICAL CHEMISTRY Q 1993 by The American Society for Biochemistry and Molecular Biology, Inc.
Vol. 268,No. 27,Issue of September 25,pp. 20540-20546,1993 Printed in U.S.A.
The Retinal Pigment EpithelialMembrane Receptor for Plasma Retinol-binding Protein ISOLATION ANDcDNA
CLONING OF THE 63-kDa PROTEIN* (Received for publication, January 4,1993,and in revised form, May 20,
1993)
Claes-Olof BAvikSQ, Frederic LevySlI, Ulf Hellman11 ,Christer Wernstedt 11, and Ulf ErikssonS** From the $Ludwig Institute/or Cancer Research, Stockholm Branch, PostOffice Box 240, S-17177 Stockholm, Sweden and the IlLudwig Institute for Cancer Research, Uppsala Branch, Biomedical Centre, S-75122 Uppsala, Sweden
Retinol, a metabolic precursor of retinal and retinoic acid, is transported in plasma by the plasma retinolbinding protein (RBP). The cellular uptake of retinol from RBP is believed to involve a specific membrane receptor for RBP. In retinal pigment epithelium the RBP receptor appears to be an oligomeric protein complex, and we have previously identified a 63-kDa membrane protein as part of this receptor. The 63-kDa protein (p63) has now been isolated, and wehave cloned the corresponding cDNA. In a data base search no sequences similar to p63 were identified. Hydropathy analysesof the 533 amino acids deduced from the cDNA sequence did not indicate an N-terminal signal sequence or obvious transmembrane regions. In vitro translation of synthetic mRNA encoding p63, in the presence of heterologous microsomes, verified that p63 does not becomecotranslationally membrane-inserted. Transcripts for p63 are abundantly expressed in retinal pigment epithelium with no detectable expression in several other tissues. Southern blotting analysis of bovine and human genomic DNA revealed several hybridizing fragments suggesting a complex organization of the corresponding genes.
During recent years it has become evident that retinoids (vitamin A derivatives) have a variety of biological functions. Most of the interest concerning retinoids has been focused on the role of retinoic acid during embryogenesis and in particular in its role in pattern formation (for review see Tabin, 1991), although it is also established that retinoids play important roles in other physiological functions including vision (Wald, 1968; Wolbach and Howe, 1925). For example, retinoids are important for normal differentiation and growth of several epithelia (for epidermis see Fuchs, 1990). The recent identification of nuclear retinoic acid receptors (Benbrook et al., 1988; Brand et al., 1988; Giguere et al., 1987;
Krust et al., 1989; Mangelsdorf et al., 1990, 1992; Petkovich et al., 1987; Zelent et al., 1989) has demonstrated that the nonvisual function of retinoids, i.e. retinoic acid, is to control transcription of specific genes. A number of such genes have been identified (for example, de The et al., 1990; Duester et al., 1991; La Rosa and Gudas, 1988a, 1988b; Nicholson et al., 1990; Vasioset al., 1989). Under normal physiological conditions most cells obtain retinoids as retinol. The extracellular transport of retinol is carried out by the plasma retinol-bindingprotein(RBP)’ (Goodman, 1984). This 21-kDa protein is well characterized, andboth the primary andtertiarystructuresare known (Cowan et al. 1990; Newcomer et al., 1984; Rask et al., 1980). RBP is structurallyrelated to a number of extracellular proteins involved in the transport of small hydrophobic compounds, the lipocalins (Pervaiz and Brew, 1987). Well known members of the lipocalin group of proteins include @-lactoglobulin (Godovac-Zimmermanet al., 1985), apolipoprotein D (Drayna et al., 1986), protein HC (Lopez et al., 1981) and proteins involved in tasteand olfaction (Lee et al., 1987; Schmale et al., 1990). The mechanisms involved in the transfer of retinol from RBP tocells is unknown, but several lines of evidence suggest a receptor-mediated mechanism (for a discussion see Bivik et al., 1992). The presence of RBP receptors has been identified on several cell types (Heller, 1975; Rask and Peterson, 1976; Sivaprasadarao and Findlay, 1988). However, little is known regarding the biochemical characteristics of RBP receptors. Recently we were able to develop a membrane binding assay through which some of the characteristics of an RBPreceptor expressed in the retinal pigment epithelium (RPE) of the bovine eye were identified (Bivik et al., 1991). RBP binds to the receptor with a Kd of 31-75 nM, and receptor binding sites are particularly abundant in the RPE. Biochemical characterization by two different chemical cross-linking techniques showed that a RBP-bindingpart of the membrane receptor is an M , 63,000 protein (p63) in SDS-PAGE analysis. The intact RBP receptor might be composed of several subunits as RBP cross-linked to p63 is part of a high molecular weight complex, but it has not been established whether the RBP receptor is a homo- or heterooligomeric complex (Bivik et al. 1991,1992). In this report we have extended the characterization of p63 by isolation of the protein and cloning of the corresponding cDNA. Our analyses show that the p63 protein of the RBP receptor in RPE is a 533-amino acid polypeptide with no significant similarities to previously sequenced proteins. This
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adoertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reportedin this paper hos been submitted to theGenBankTM/EMBLDataBankwith accession numbeds) X66277. 5 Present address: INSERM Unit6 de Biologie Moliculaire et de Ginie Genetique, CNRS Laboratoire de Genetique Moliculaire des Eucaryotes, Institut de Chimie Biologique, Faculti de Midecine, 11 Rue Human, 647085 Strasbourg Cedex, France. The abbreviations used are: RBP, plasma retinol-binding protein; 7 Present address: Division of Biology, 147-75Caltech, Pasadena, bp, base pair(s); CHAPS, 3-[(3-cholamidopropyl)dirnethylammonio] CA 91125. ** To whom correspondence should be addressed. Tel.: 46-8-728- -1-propane sulfonate; PBS, phosphate-buffered saline, RPE, retinal pigment epithelium; PAGE, polyacrylamide gel electrophoresis. 7100;Fax: 46-8-332-812.
’
20540
20541
Membrane Receptor for RBP membrane receptor protein is the first, to our knowledge, to be identified and isolated for a member of the lipocalin group of lipid-transporting proteins. EXPERIMENTALPROCEDURES
Materials-RPE cell membrane fractions were preparedas described (BHvik et al., 1991). Freund's complete and incomplete adjuvants were obtained from Life Technologies, Inc. Endoprotease GluC isolated from Staphylococcus aureus V8,T4 polynucleotide kinase, and T3 RNA polymerase were from Boehringer Mannheim. NaI2"I, [Y-~'P]~ATP [a-"PIdCTP, , a-thio-"S-dATP,[35S]methionine,Hybond-N filters, and Multiprime DNA labeling kit were from Amersham International. TheSequenase dideoxy sequencing kit was from U. S. Biochemical Corp. Genomic DNAs were obtained from Clontech, Palo Alto, CA. Genescreen Plus filters were from Du Pont-New England Nuclear. Polyvinylidene difluoride filters (Immobilon) were from Millipore. Isolation of p63 Using Immunoaffinity Chromatography and Generation of Polyclonal Rabbit Antibodies-The generation and characterization of the monoclonal antibody A52 and the preparationof the A52 immunoaffinity column have been described (BHvik et al., 1992). RPE microsomes were solubilized in 1% (w/v) CHAPS in PBS (20 mM sodium phosphate, pH 7.2, containing 150 mM NaCl) (1 mg of total protein/5 ml of solubilization buffer) for 30 min on ice, and debris was removed by centrifugation a t 100,000 X g for 1 h a t 4 "C. The solubilized proteins were slowly passed overthe A52 column, and the column was finally rinsed with 10 columnvolumes of 1% CHAPS in PBS. Bound proteins were eluted by washing the column with 50 mM triethanoleamine buffer, pH 11.5, containing 1% CHAPS. The pH of the eluate was adjusted to 8 by the addition of a 1 M Tris-HC1 buffer, pH 8. Eluted proteins were dialyzed against 1% CHAPS in PBS overnight, concentrated in a Centricon 30 cell (Amicon), and stored at -70"C. The various protein fractions were analyzed by SDS-PAGE using 10% linear gels or 10-15% gradient gels as described earlier (Blobel and Dobberstein, 1975) and visualized by staining with Coomassie Brilliant Blue. The protein concentrations in crude fractions were estimated as described using bovine serum albumin as the standard (Bradford, 1976). Highly purified p63 was estimated by spectroscopy assuming an extinction coefficient a t A280 of 1.5 for a 1 mg/ml solution. The generation of polyclonal rabbitantiseratop63has been described (BHvik et al., 1992). For the expressioncloning of p63, affinity-purified IgG was isolated from the rabbit antisera using a column of p63 coupled to CNBr-activated Sepharose 4. The conditions used for the isolation of affinity-purified rabbit Ig to p63 were essentially as described above for the affinity isolation of p63 using the A52 Ig column. Generation of Peptides Derived from p63 by Partial Proteolysis Using Endoprotease Glu-C and Amino Acid Sequence Determinatiom-Fifty pg of highly purified p63 was dissolved and denaturedby boiling for 2 min in 10 pl of2% SDS in 100 mM ammoniumbicarbonate buffer, pH 7.5. The SDS concentrationwas adjusted to 0.2% by the addition of the buffer, and endoprotease Glu-C was added to yield a p63:protease molar ratio of 501. Thedigestion was allowed to proceed for 2 h a t 37 "C. Aliquots of the digest were subjected to SDS-PAGE using Phast high density gels and transferred onto polyvinylidene difluoride filters by thePhast electroblotting device (Pharmacia, Uppsala, Sweden). Transferred peptides were visualized by staining the filters with 1.25% Coomassie Brilliant Blue in 10% acetic acid and 50% methanol. Peptides migrating as distinct bands were cut out of the filters and subjected to amino acidsequence determination. The details of this procedure have been published (Hellman and Wernstedt, 1989). Amino acid sequences were determined by an Applied Biosystems 470A protein/peptide sequenator equipped with an on-line detection system,Applied Biosystems model 120A phenylthiohydantoin analyzer. The equipment was operated according to the manufacturer. Expressing Cloning of a cDNA Corresponding to p63 and Isolation of 5"Extended cDNA Clones-A custom-made bovine RPE cellspecific cDNA library constructed in the XZAP I1 vector using mRNA from isolated RPE cells was used for expression cloning of a cDNA corresponding to p63 (Stratagene Inc., La Jolla,CA). The library was handled according to the supplier, and expression of the hybrid proteins was induced by isopropyl-1-thio-p-D-galactopyranoside using Escherichia coli Sure bacteria (Stratagene). In the first screen approximately 300,000 plaques were screened using 12sI-labeledaffinitypurified Ig to p63 as described (Young and Davies, 1983). The Ig
fraction was radiolabeled using chloramine T and Na"'1 to a specific activity of 6.5 pCi/pg of Ig (Hunter and Greenwood, 1962). After two rounds of rescreening, the clone R2A gave the most intensive signal under the conditions used, and the plasmid pRBP-R2A was created from this X clone following in vivo excision by use of the helper phage R408 according to the instructions supplied (Stratagene). The nucleotide sequence of the insert of pRBP-RPA was determined by the dideoxy termination technique, and both strands were sequenced (Sanger etal., 1977). The sense strand was determined by sequencing of a series of partially overlapping deletions generatedby the ExoIII/ mung bean nuclease technique using a kit from Stratagene. The T3, T7, and M13 universal primers were used. The nonsense strand was determined by sequencing with a series of internal anti-sense oligonucleotides as primersspaced approximately 200 bp apart. To isolate cDNA cloneswith longer 5'-termini 30,000 plaques of the RPEspecific cDNA library were rescreened with a 30-mer oligonucleotide complimentary to the 5"region of the sense strand of pRBP-R2A (nucleotide position 27-57). The oligonucleotide was radiolabeled by use of T4 polynucleotide kinase. The cDNA inserts were subcloned and sequenced as above. Only the 5"parts of the clones were sequenced. In Vitro Transcription of pRBP-R2A and Translation of p63Synthetic mRNA encoding p63 was obtained by transcription of HindIII-linearized pRBP-R2A plasmid using T 3 RNA polymerase. Proteins were synthesized in vitro using a rabbit reticulocyte lysate system in the presence of ["S]methionine with or without human microsomes. In each translation reaction 50-100 ng of mRNA was used. The details of thetranscriptionandtranslation reactions, including the preparation of microsomes from the lymphoid cell line Raji, were as described earlier (L6vy et al., 1991). As acontrol, synthetic mRNA encoding HLA-B27 heavy chain was translated underidenticalconditions in the presence of human microsomal membranes. Toseparate membrane-associatedproteins from unbound, the microsomes were pelleted by centrifugation at 14,000 X g for 10min, thesupernatant collected, andthe microsomes were resuspended in PBS, washed, recentrifuged, and solubilized in 1% Triton X-100 in PBS. Aliquots were analyzed by SDS-PAGE. For the immunoprecipitationanalyses, the radiolabeled proteins were subjected to indirect immunoprecipitation using 5pg of A52 Ig and 5pg of control Ig and analyzed by 10-15% SDS-PAGE as described
-
46
-
30
FIG.1. Immunoaffinity purification of p63 from RPE membranes. Detergent-solubilized RPE membrane proteins were passed over a column of A52 Ig coupled to Sepharose 4B. The figure shows an SDS-PAGE stainedwith Coomassie Brilliant Blue of the fraction applied to the column (lane a, 50pg of total protein) and the eluted fraction containing highly purified p63 (lane b, 3pg of protein). The migration of standard marker proteinsis indicated to the right.
Membrane RBPReceptor for
20542
TABLE I Partial amino acid sequences of endoprotease Glu-C generated peptides from purified p63 Peptides of p63 were generated and subjected to amino acid sequence analyses as outlined under "Experimental Procedures." Both peptides were found in the deduced amino acid sequence of pRBP-R2A. Differences between the determined peptide sequences and the predicted amino acid sequences of the cDNA clone are underlined, and thecorresponding amino acids in the cDNA are outlined below. Residues within parentheses indicate the most prominent identified amino acid in positions where more than one amino acid was clearly identified. The numbers within the parentheses, on the left, denote the positions of the peptides in the complete protein. Peptide Amino Acid Sequence
A (407-423)
X-(L)-(F)-(S)-(G)-(P)-E-Q-A-F-E-X-P-Q-I-N-Y V R F
B (365-383)
V-G-G-Y-V-L-P-L-N-I-D-K-A-D-T-X-K-N R R G "
1
GAGAAA
Met Ser Ser G l n Val G l u His Pro Ala Gly Gly Tyr LyS LyS Leu Phe Glu TCC AGC CAA GTT GAA CAT CCA GCT GGT GGT TAC AAG AAA CTG TTT GAA
7 ATG Thr 58 ACT Pro 109 ccc CCC Val 160 GTT LYS 211 AAG 262 Thr ACT
Val GTG Leu CTC Gly GGA Phe
G1u GAG TTD Trp TG'G TGG Ser TCG ASP m GAC A&T m Ala
Glu Leu GAA CTA Leu Thr CTA ACC Glu PTO GAA CCA Phe LyS
Ser TCA Sex Sex ~AGT Tyr TTT TAC GlU Gly TIT AAA GAA GGA Tvr Val Ara Ala cTA cffi
ccn
Gly Thr Cy9 Ala Phe Pro GGC ACC TGT GCT TTC CCA Ser Tyr Phe Arg Gly Val TCT TACTIC CGA GGA GTG Pro Val Gly Glu Asp Tyr CCA GTG GGG GAA GAT TAC Val Asn Pro Glu Thr Leu GTT AAT CCT GAG ACC TTG Val Ser Val As" Gly Ala G K TCA GTC M T GGA GCC Val Tyr Asn Ile Gly Asn GTT TAC AAC ATT GGT AAT Asn Ile Val Lys Ile Pro Pro AAT ATT GTA AAG ATC CCA C U Lys Ser Glu Ile Val Val Gln AAG TCA GAG A T GTT GTA CAA Tyr Val H i s Ser Phe Gly Leu TIC GTC CAT AGT TTT GGT TTG Pro Val Lys Ile Asn Leu Phe C U GTC AM ATI AAT CTG TIC Ala Asn Tyr e t Asp Cy9 Phe GCC AAT TAC ATG GAT TGT TTT Hi9 Ile Ala Asp LyS LyS k g U T ATT GCT GAC AAA AAA AGA Ser Pro Phe Asn Leu Phe H i s TCT CCT TTT AAC CTC TTT CAT Leu lle Val Asp Leu Cy?, Cys CTG ATP GTG GAT CTC TGT TGC Leu Tyr Leu Ala Asn Leu lug TTA TAT TTA GCC M T TTA CGT Arg LYS Ala pro G l n pro Glu AGA AAG GCT CCT CAG CCT GM ASP LYS Ala ASP Thr Glv Lvs GAC AAG GCT GAC ACA GGC M G Thr Ala xle Leu Cys Ser Asp ACT GCA ATT CTG TGC AGT GAC Phe ser Gly Pro Arq Gln Ala TIT TVL GGG CCT CGC CAA GCA Tyr Gly Gly LyS Pro Tyr Thr TAT GGT GGG AAA CCT TAC ACA Val Pro hsp Leu Cys Lys GTT CCA GAC AGG CTC TGT AAG Gln Pro CAA CCT Ala G1u GCC GAG Gln Ala
Phe 313 TIT Phe 364 TIT Tyr 415 TAC Lys 466 AAG Tyr 517 TAT Thr 568 ACT 619 670 721 772 823 874 925 976 1027 1078 1179 1180 1231 1282 1333 1384 1435 1486 1531
1588 1648 1715 1783 1849 1916 1983 2050 2117 2184 2251 2318 2385 2452 2519 2586
Ser TCC Glv Gly GGC G G Phe
Leu CTC Leu C CTT S Leu CTG Val GTC Het Thr ATG Acr
Thr Ala ACA GCC Aro A r g CYS Cy9 C CGA G TbT TGT Phe Asp m GAT Thr Tyr ACA TAC Glu & Lvs GRG
PIO CCC Val GTP Ala GCC Thr GAA ACA Thr Ala ACT GCT Cys Phe TGC TlT Leu G l n CTA CAA Phe Pro TIC CCC Thr Pro ACT CCC Lys Phe
Cys TGC Thr ACT Cy9 TGC Ile ATT His CAC Gly
Pro CCG Leu cTc CTC His U C His U T
Asp GAT Glu GAG Tyr TAT Glu
Lys AAG Asp GAC Thr ACA Lys M G Pro CCC Lys
GGG AAA
Ala Asp GCA GAC Cys Ser TGC AGT Asn Tyr AAC TAT
His Val CAT GTT Glv Gly Pro GGG CCA & CCA Gly C l n
GGG CAA His Arg U C AGA Ara ATC Ile
A-e Asn AAT A m AAT Glu GAG Gln
Ile ATA Ala GCC
Leu Ser AAG TIT CTT TCT TCA Glu Ser As" G1u Thr
34
102
Phe Ser Arg Phe
119
ATA
TTT TCC AGG lTT Ile CTI GTT ART ATC
51 68 05
Leu Val Asn
136
Thr Asn Phe Ile Thr
153
ACC AAC TTC ATT ACA Val Asp Leu Cys Asn
110
CAG GTT GAC CTT TGC AAC His Ile G1U As" Asp Gly CAC ATT GM AAT GAT GGG
Asn AAT Lys AAC Asp GAC Ile ATT Ser
17
Thr Cly Arg Ile ACA GGC AGG ATC Glv Gly Leu Phe G1u GGA CTC GGA CTC TlT m GAG Ala Leu Leu H i S GCC CTC CTA CAC Arg Phe Ile Arg AGG TTC ATC CGC Val Thr & Glu GTC I l e nCA
Phe Ser TTT TCA G1u Asp GAA GAT Arg Phe CGA TTC Val Phe GTT TIT Trp Ser TGG AGT Het Gly ATG tCt ASn Lys AAT A M Glu Asp GAA GAC Phe Val TlT GTT Val Lys GTG AAA ~ e pro u CTI CCT Pro A m CCC AAC Glu Pro GAA CCT lle Asn ATC AAT Gly Leu GGC TTG Lys Glu
Ile ATT Pro CCA Lys AAG Val GTG
Ala GCC fle ATA Pro CCA Glu GAG Leu Trp CTT TGG Val Trp GTT TGG Tyr Arg TAC AGG H i s Glu CAT GAG Tyr A m TAT AAT Lys Asn AAA AAT leu ~ s TK; M T Thr Thr ACA ACT G1u V GAG G T I Tyr G l n TAC CAG Asn His AAT CAC Thr Trp ACC TGG ser TCT Val
Tyr
TAC Ser AGC Ser TCT
Thr ACA Gly
107 204 221 238 255 272
GGA
209 CTT LyS Ly?) Tyr Ile AS" Thr 306 AAA AAG TAT ATC AAT ACC 323 His I1c As" ThrTyr Phe CAC ATC AAT ACC TAT TTT 340 Trp Lys Gly Phe Glu Tyr TGG W GGA TIT GAA TAT Ala 351 Glu Asn Trp Glu Glu GCC GAG AAC TGG GAA GAG 374 val wq ~ r wr va1 Ile n q G" AGG AGA TAC GTA ATT 391 Ala Asn Leu Val Thr Leu AAT TTA GTC ACA CTC GCC 408 Glu Thr Ile Trp Leu u CTC GAG ACC ATC TGG CTG Lys 425 Phe Glu Phe Pro Gln TTT GAG TTT CCT CAA AAG 442 Phe Tyr Ala Tyr Gly Leu TIT TAT tuI TAT GGA CTT 459 Leu As" Val Lys Thr Val CTG AAC GTC AAA ACT AAA GAA GTA 416 Ser Glu Pro Ile Phe Val PI0 TCA GAA CCT ATC lTT GTT CCA 493 Val Val Le" ser Val Val PI0 GTA GTT CTG AGT GTG GTG GTG CCT Le" Le" Ile Le" As" Ala Leu 510 GCA CAA CTT CTG A T T CTI: AAT rcr Tpc Ser G 1 U Val Ala Arg Ala Glu Val Glu I l e Asn Ile Pro Val Thr Phe His 527 AGT GAA GTT GCC AGG GCT GAA GTG GM. A" AAC ATC CCC GTC ACC TTT CAT G l y Leu Phe LysLys Ser Stop 533 GGA CTG TTC AAA AAA TCC lyjA GCACATTCTAGCAlyjACATGTlTCTGGTGACSAMCACA GA~CGTAGTTAGGTC-TCMRTTCTGTTTAGCTlTAGCC~TGTCTATAAGGG~AA C T I G U I G A T G C A U C C G m G T A ~ A ~ G C A C A ~ G T T G A G T A A ~ ~ C C ~ A ~GTGCTTATTTAGATAATCGTACTTCG~U~UTUTAACT~CT~~ATAT
Arg
GM X C AAT GM ACC
Leu
2:
FIG. 2. Nucleotide sequence of pRBP-R2A and predicted amino acid sequence of p63. Nucleotides are numbered on the left and amino acid residues on the right. Amino acid residue 1 is the initiator methionine. The identified peptide sequences are underlined (see Table I). above and exposed to Kodak XAR film. General Molecular Biology Techniques-Standard molecular biology techniques were used (Sambrook et al., 1989). DNA probes were labeled using the random priming method (Feinberg and Vogelstein, 1984) to a specific activity of 5 X 10'-1 X lo9 cpm/pg of DNA.
Northern Blotting Analyses-Total cellular RNA wasisolated from tissues by the guanidine thiocyanate/CsCl centrifugation procedure (Chirgwin et al., 1979). Total RNA (2Opg/lane) was electrophoresed under denaturing conditions on 1%agarose gels and transferred to Hybond-N filters. The blots were prehybridized and subsequently hybridized using 1 X lo6 cpm of radiolabeled and denatured probe/ ml of hybridization solution. The hybridization conditions, including prehybridization, were 50% formamide, 5 X SSPE (where 1 X SSPE is 10 mM sodium phosphate buffer, pH 7.4, containing 150 mM NaCl and 1 mM EDTA), 5 X Denhardt's solution, 0.5% SDS, 100Fg/ml tRNA (from bakers' yeast) at 42 "C overnight. The filters were washed a t 55 "C in 2 X SSPE and 0.1% SDS and exposed to Kodak XAR film at -70 "C using intensifying screens. Southern Blotting Analyses of GenomicDNA-High molecular weight genomic bovine or human DNAs were digested to completion with EcoRI or BamHl and subjected to electrophoresis on a 0.8% agarose gel and transferred onto Genescreen Plus filters. The filters were prehybridized in 6 X SSC (where 1 X SSC is 20 mM sodium citrate buffer, pH 7.0, containing 150 mM NaCl), 0.5% SDS, 5 X Denhardt's solution and 100pg/ml salmon sperm DNA at 68 "C. The hybridizations were done under identical conditions using 1 X lo6 cpm of labeled probe/ml of solution. The entire insert of pRBP-R2A was used as probe. Following overnight hybridization, the filters were washed in 2 X SSC in 0.1% SDS at 68 "C for 15 min and finally at 0.1 X SSC in 0.1% SDS for an additional 15 min. The filters were exposed to Kodak XAR film using intensifying screens at -70 "C. RESULTS
Isolation of p63 by Immunoaffinity Chromatography and Partial Amino Acid Sequence Determination-p63 was isolated by immunoaffinity chromatography from RPE membranes solubilized in 1%CHAPS. A52, a monoclonal antibody to p63, was used (Biiviket al.,1992). SDS-PAGE analysis and staining with Coomassieshowed that p63was selectively retained and eluted from this column (Fig. 1).Under reducing conditions p63 appeared as a distinct band (lane b ) , whereas under nonreducing conditions the protein migrated as abroad band with an M , of 57,000-65,000, and some protein appeared on the top of the gel (data not shown). The abundantexpression of the M , 63,000 protein in RPE has been observed previously (Blvik et al., 1992; Sugara and Hirosawa, 1991). No other abundant protein associated with p63 under the conditions used during this isolation procedure. Attempts to determine the N-terminal amino acid sequence of highly purified p63 were unsuccessful, suggesting that the protein has a blocked N terminus. Thus, to obtain the amino acid sequence of the protein, highly purified p63 was partially digested with endoprotease Glu-C in the presence of 0.2% SDS, and the resulting peptides were separated by SDSPAGE, blotted onto polyvinylidene difluoride filters, and visualized by Coomassiestaining. Stripsof the filter, corresponding to discrete peptides, were cut out and subjected to amino acid sequencing. The amino acid sequences obtained from two different peptides are shown in Table I. Isolation of a cDNA Clone Corresponding to p63"To determine the complete primary structure of p63 we have cloned
Receptor Membrane
for RBP
20543
TABLEI1 Nucleotide sequences of the 5'-untranslated regions of seueral cDNA clones hybridizing to an oligonucleotide specificfor the 5"region of PRBP-R~A The RPE cell-specific cDNA library was screened with a 30-mer oligonucleotide corresponding to the 5"region of pRBP-RZA, and the sequences of the 5"ends of three isolated clones were determined. The in-frame stop codon (position -9 to -7) and the initiation codon are underlined. ~
~~
~~~
nucleotide 5"Untranslated cDNA clone
pRBP-RLA B432 B511 B721 Protein sequence
sequence GCACCA ACTGTG CA ATC CTC TAC ATC CTC TAC TC
GAG GAC E A GAG GAG GAG
TGA
AAA
AAA
E
AAA AAA
M
TCC TCC TCC TCC
.. .
...
... ... s ...
consensus polyadenylation signal, which indicates that the clone is not full-length. The deduced 533 amino acids of pRBP-R2A have a calculated molecular weight of 60,975, and in vitro translation of synthetic mRNA transcribed from pRBP-RPA yielded an M , 63,000 protein in SDS-PAGE (see below). p63 is an acidic protein with a calculated isoelectric point of 6.41. Hydropathy analyses of the deduced amino acid sequence U I I I I I 1 I 1 I h revealed no obvious hydrophobic transmembranedomains z 5 0 100 1 5 0 2 0 0 2 5 0 3 0 0 3 5 0 4 0 0 4 5 0 5 0 0 and no N-terminal signal sequence (Fig. 3). However, residues around amino acid positions 250,330,380,and theC-terminal Amino acid number FIG. 3. Hydropathy analysis of p63. The predicted amino acid region (residues 480-533) displayed significant hydrophobic sequence of p63 was analyzed according to Kyte and Doolittle (1982) features. In the C-terminal half of the protein, the hydrophobic regions are interrupted by highly hydrophilic regions, using a window of 9 residues. whereas the N-terminal half does not display these features. the corresponding cDNA. Approximately 300,000 clones of an This raises the possibility that p63 exhibits at least two RPE-specific XZAP I1 cDNA library were screened by expres- structural domains. A search through the EMBL database (release 30.0) using sion cloningwith '251-labeledaffinity-purified polyclonal rabbit Ig to p63. After three rounds of rescreening one clone was the FastA algorithm (Devereux et al., 1984) failed to reveal selected for further characterization. Following subcloning, any closely related sequences. Thus, we have not been able to the plasmid pRBP-R2A was created. Sequence analysis of draw any conclusions regarding functionalcharacteristics pRBP-R2A showed that the totallength of the cDNA insert based on homologies with other proteins. was 2,625 bp (excluding the EcoRI linkers used to prepare the Expression of p63 by in Vitro Translation-To ensure that cDNA library) with a 6-bp 5"noncoding region followed by a clone pRBP-R2A encoded the 63-kDa protein recognized by 1,599-bp coding region and a 3"noncoding region of 1,020 bp mAbA52, synthetic mRNA was produced from linearized (Fig. 2). The open reading frame encoded a protein of 533 pRBP-R2A using T3 RNA polymerase. Aliquots of the tranamino acids, and both of the two generated peptidesequences scribed mRNA were translated in vitro in a rabbitreticulocyte could be found in the deduced amino acid sequence (under- lysate system in the presence of ["S]methionine and human and lined in Fig. 2; see Table I). The minor differences between microsomal membranes.Indirectimmunoprecipitation SDS-PAGE analyses of the in vitro synthesized p63 with A52 the deduced sequence and the peptide sequences are most likely attributable to ambiguities in the sequence determina- Ig and an unrelated Ig verified that pRBP-R2A encoded the 63-kDa protein specifically recognized by A52 Ig (Fig. 4, lanes tions of the peptide or occurred because the sequenced pepa and 6). tides were slightly contaminated with other peptides generThe lack of a typical N-terminal signal sequence in the ated from p63. In particular, the arginine residues in the deduced amino acid sequence of pRBP-R2A warranted an peptides have been difficult to determine. Out of the 35 analysis of the mechanism underlying the membrane associresidues available for a comparison, 29 residues were identical, ation of p63. To investigate whether p63 could be inserted 3 residues were unidentified during the peptide sequencing, into heterologous membranes by use of an internal signal and 3 arginine residues were underestimated. Thesedata sequence, mRNA transcribed from pRBP-R2A was translated demonstrate that the isolated cDNA clone corresponds to p63. as described above in the presence of human microsomes. The first ATG in the sequence encodes the initiator methi- Upon completion of the translation reaction, the microsomes onine. It lies ina good context for translationinitiation were removed by centrifugation, washed once, and solubilized according the Kozak's rules(Kozak, 1986), and sequence in 1% Triton X-100. Aliquots of thesupernatantand of determination of several cDNA clones, isolated by use of a solubilized membrane-associated proteins were analyzed by 5"specific oligonucleotide, showed a stop codon (TGA) in- SDS-PAGE. Only a small fraction of the synthesized p63 frame with the initiation codon at position -9 to -7 (Table associated with the microsomal membranes (Fig. 4, lane c), 11). In the cDNA clones used to verify the 5"untranslated whereas a majority of the protein remained inthe lysate (Fig. region, the sequences of the different cDNA clones are diver- 4, lane d). Similarly, p63 synthesized as above using total gent (position -12 and upstream). Downstream of this posi- mRNA from isolated RPE cells failed to become membranetion, however, the clones displayed identical sequences. The inserted (data notshown). significance of the heterogeneous 5"untranslated region reAs a control for membrane insertion and translocation in mains to be investigated, but cloning artifacts could not be the microsomes, mRNA of the class I major histocompatibility excluded. pRBP-R2A did not contain a poly(A) tract or a antigen heavy chain, HLA-B27, was translated under identi-
r I
20544
Membrane Receptor for R B P
97
-28
s
-18
s
69
46 FIG. 5. Tissue distribution of transcripts encoding p63. Total RNA (20pgllane) from bovine RPE, liver, kidney, testis, adrenal gland, lung, and brain was subjected to electrophoresis in 1%agarose gels containing formaldehyde, and generated filters were hybridized under stringent conditions using the entire insert of pRBP-R2A as probe. The filters were exposed for ( A ) 1 day or for (€3) 5 days. The migration of the 18 and 28 S ribosomal RNAs is indicated.
30
-
14
Tissue-restricted Expression of Transcripts Corresponding to p63"Total RNA from RPE wasanalyzed by Northern blotting. The most abundant transcript 3.5-3.6 is kilobases in size (Fig. 5A), but several sizes of hybridizing transcripts could be visualized in longer exposures (Fig. 5B). Identical analyses using total RNA isolated from liver, kidney, testis, adrenal gland, lung, and brain showed low or undetectable levels of hybridizing transcripts in all of these tissues even after long exposures (Fig. 5B). We conclude that abundant expression of p63 is confined to the RPE. Southern Blot Analyses of Genomic DNA-EcoRI- and BamHI-digested genomic bovineand human DNAswere analyzed by Southern blotting. In bovine and human genomic DNAs threeor four easily identifiablebands of various intensity and length, ranging from 1.5 kilobases to more than 8.0 kilobases in length, were obtained (Fig. 6). These data show that thebovine and humangenes for p63 display a high degree of similarity. Furthermore, the number of hybridizing fragments suggests a complex organization of the genes. DISCUSSION
Retinoids are under physiological conditions transportedin extracellular and in intracellular compartments complexed to FIG. 4. SDS-PAGE analysis of in vitro translated p63. specific retinoid-binding proteins. In plasma, retinol is transmRNA, transcribed from pRBP-R2A, was translated in vitro in a rabbit reticulocyte lysate inthe presence of human microsomes, ported by RBP, a member of the lipocalin family of lipidtransporting proteins. Intracellular transport of retinoids is detergent solubilized, and subjected to immunoprecipitationusing A52 Ig ( l a n e a ) and an unrelated monoclonal Ig ( l a n e b). The ability carried outby another group of proteins, thecellular retinoidof p63 to associate with the microsomal membranes was analyzed bindingproteins(Chytiland Ong,1984),members of the under identical conditions,the microsomes washed once, and aliquots superfamily of intracellular fatty acid-binding proteins (Sunof the microsome (lane c ) and thereticulocyte lysate( l a n e cl) subjected delin et al., 1985a). It is likely that transmembrane transfer to SDS-PAGE. As a control of the translocation competence, mRNA for HLA-B27 was translated andanalyzed under identical conditions. of retinol from RBP to the intracellular binding proteins is Membrane-bound HLA-B27 (lanes e ) and unbound HLA-B27 (lane mediated byspecific receptors for RBP. However, little is f ) were analyzed as above. The migration of standard marker proteins known about themolecular characteristics of RBP receptors is indicated to the right. and their mode of actions. We have previously identified an abundant protein in membrane fractions derived from bovine cal conditions. HLA-B27 efficiently associated with the mem- RPE, p63, which binds RBP with high affinity (BBvik et al., branes, the signal sequence was cleaved, and the translated 1991, 1992). We have now isolated and characterizeda cDNA protein became core-glycosylated (Fig. 4, lanes e and f ) . clone encoding this protein. The highfrequency of cDNA These data show that p63 is not integrated into heterolo- clones encoding p63 in the RPE-specific cDNAlibrary is gous membranes, suggesting that it lacks an internal signal consistent with the abundant expression of the protein. sequence inadditiontothe lack of anN-terminalsignal Previous analyses have indicated that p63possesses some sequence. Thus, we conclude that p63 is likely to become unusual biochemical properties (BBvik et al., 1992). It is a membrane-associated and translocated by a posttranslational membrane protein present in at least two structurally and mechanism. functionally differentforms. Epitopes of p63 areexpressed on
Membrane Recseptor for RBP
-
- 8.0 -
W
4.0
m w 0
- 2.0
0 .
- 1.0 ?
.'
FIG. 6. Southern blot analyses of EcoRI- and BamHI-digested bovine and humangenomic DNA. High molecular weight genomic DNA was digested to completion using EcoRI ( E )or BamHI ( B ) and subjected t o electrophoresis using a 0.8% agarose gel. The DNA was blotted onto GeneScreen Plus filters and hybridized under stringent conditions using the entire insert of pRBP-R2A as probe. The migration of a size marker DNA is indicated to the right.
the cell surface of newly isolated bovine R P E cells, but a majorfraction of theproteinisconfinedtointracellular membranes. Alkaline extractionof RPE membranes detaches a major portion of p63 from the membranes, suggesting that it is a peripheral membrane protein. However, a minor fraction, including p63 competent to bind RBP, is resistant to alkaline treatment and is assembled into oligomeric an protein complex. Both forms of p63 can be extracted into the detergent phaseof Triton X-114, suggestingthe presenceof extensive hydrophobic regionsin the protein,a property characteristic of integral membrane proteins (Bordier,1981). Interestingly, however, the primary structureof p63 does not display typical transmembrane regions as determined by hydropathy analysis, nor does it display an N-terminal signal sequence. It should be kept in mind that the predictionsof transmembrane regions may not be accurate, especially for membranespanning proteins forming @-strands within the lipid bilayer, instead of the more frequent membrane-spanning a-helices of most membrane proteins (Fasman and Gilbert,1990). For
20545
example, porinof the E. coli outer membrane anda membrane protein of the mitochondria protein import system (IPS 42) lack obvious hydrophobic transmembrane segments despite the fact that these proteins are integral membrane proteins (Baker et al., 1990; Kleffel et al., 1985). The structural basis for the membrane integrationof porin was highlighted in the recentdetermination of itsthree-dimensionalstructure (Cowan et al., 1992). The membrane-spanningregions of porin consist of @-sheets,largely with alternating hydrophobic and hydrophilic amino acidresidues facing the lipid bilayer or oriented toward the aqueous central channel, respectively. With respect to p63, the three-dimensional folding of the protein might create hydrophobic regions that can interact with the lipid bilayer in a similar fashion. In addition, it is not unlikely that the overall hydrophobic character of p63, revealed by itspartitioninTriton X-114, might also be attributed in part by a putative hydrophobic retinol binding site. This possibility is attractive in lightof the potential role of RBP receptors in transmembrane transferof retinol across the plasma membrane. Themechanismsunderlyingmembranetargetingand translocation of p63 are unknown. The lack of obvious signals for membrane targeting suggests a posttranslational mechanism and the involvement of other factors,presumably other of p63 to become membrane proteins. Inline with the inability membrane-associatedin heterologous systems, overexpression of p63 in HeLa cells has also failed to reconstitute RBP receptor bindingsites.' Posttranslational membrane insertion and translocation of membrane proteins and secretory proteinsare relatively rareeventsin highereucaryotes.For example, membrane proteins imported into some organelles and several secretory proteins are targeted to membranes and translocated by mechanisms not involving classical N-terminal or internal signal sequences (for discussion see Glick et al., 1991; Meyer, 1991; Muesch et al., 1990). Recently, a novel class of membraneproteinswith a C-terminalmembrane anchor was identified and reviewed (Kutay et al., 1993). Based on the characteristics of p63, i.e. the lack of an N-terminal signal sequence and a hydrophobic C-terminal region, it is possible that p63 belongs to thatgroup of unusual membrane proteins. Further biochemical characterization of the intact RBPreceptor, p63, andotherputativereceptorsubunits, including the membrane topology of the involved proteins, might unravel interesting details underlying membrane targeting and translocationof p63 and theassembly of the RBP receptor. Immunoblotting analyses, using the monoclonal antibody A52, have shown that expression of p63 is restricted to RPE among several tissues investigated (BAvik et al., 1992), despite the fact that RBP receptor binding sites are also presentin et al., 1991). membrane preparation from other tissues (Blvik These data among others, arguefor the expression of tissue specific variants of RBP receptors. The Northern blot analyses are consistent with thispossibility, and under stringent hybridizing conditions, abundant transcripts for p63are found only in RPE. However, it is possible that additionalp63-like transcripts can be detected in other tissues. This hypothesis is supported by the observation that a polyclonal antiserum top63detects expression of p63-like antigens inseveral locations.' The primary structure of p63 is unique in that no related sequences are present in the GenBank and EMBLbases, data and the gene for p63 appears to be highly conserved during evolution since the bovine cDNA cross-hybridizewith human sequences under stringent conditions. The evolutionary con-
* C.-0. BBvik and U. Eriksson, unpublished observation.
20546
Membrane Receptor for RBP
served nature of p63 is consistent with the similarly conserved structure of the RBPs (Sundelin et al., 198513). In this paper we have isolated and characterized a protein, p63, which appears to be involved in binding of RBP to RPE membranes based on an in vitro membrane binding assay. The precise role of this protein in the RBP receptor of RPE cells is unknown apart from its role in binding to RBP. Whether it is also involved in binding and transmembrane transfer of retinol, from bound RBP tointracellular acceptors, remains to be investigated. However, with the aid of the specific reagents available, such questions arenow possible to address. Acknowledgments-We thank Barbara Akerblom for expert technical assistance; Per A. Peterson for kindly providing the RPE cellspecific XZAP I1 cDNA library; Sune Kvist for providing rabbit reticulocyte lysate, human microsomes, mRNA for HLA-B27 and for valuable advice and comments throughout this work; and Ralf Petterson, Mark Donovan, and Andris Simon for valuable advice and comments on the manuscript. REFERENCES Baker, K. P., Schaniel, A., Vestweber, D., and Schatz, G. (1990) Nature 3 4 8 ,
"_
-__
6n.s-Rng
Bivik, C.-O., Eriksson, U., Allen, R., and Peterson, P. A. (1991) J. Biol. Chem. 2 6 6 , 14978-14985 BHvik, C.-O., Busch, C., and Eriksson, U. (1992) J. Biol. Chem. 2 6 7 , 2303523042 Benbrook, D., Lernhardt, E., and Pfahl, M. (1988) Nature 333,669-672 Blobel, G., and Dobberstein, B. (1975) J. Cell Biol. 67,835-851 Bordier, C. (1981) J. Biol. Chem. 2 6 6 , 1604-1607 Bradford, M. M. (1976) Anal. Biochem. 72,248-254 Brand, N., Petkovich, M., Krust, A,, Chambon, P., de The, H., Marchio, A., Tiollais, P., and Dejean, A. (1988) Nature 3 3 2 , 850-853 Chirgwin, J., Przybyla, A., MacDonald, R., and Rutter, W. (1979) Biochemistry 18,5294-5299 Cbytil, F., and Ong, D. E. (1984) in The Retinoids (Sporn, M. B., Roberts, A. B., and Goodman, D. S., e&) pp. 90-123, Academic Press, Orlando, FL Cowan, S. W., Newcomer, M. E., and Jones, T. A. (1990) Proteins 8,44-61 Cowan, S. W., Schirmer, T., Rummel, G., Steiert, M., Ghosh, R., Pauptit, R. A., Jansonius, J. N., and Rosenbusch, J. P. (1992) Nature 368,727-733 de The, H.,Vivanco-Ruiz, M.-M., Tiollais, P., Stunnenberg, H., and Dejean, A. (1990) Nature 3 4 3 , 177-180 Devereux, J., Haeberli, P., and Smithies,0. (1984) Nucleic Acids Res. 12,387395 Drayna, D., Fielding, C., McLean, J., Baer, B., Castro, G., Chen, E., Comstock, L., Henzel, W., Kohr, W., Rhee, L., Wion, K., and Lawn, R. (1986) J. Biol. Chem. 2 6 1 , 16535-16539 Duester, G., Shean, M., McBride, M., and Stewart, M. (1991) Mol. Cell. Biol. 11,1638-1646 Fasman, G., and Gilbert, W. (1990) Trends Biochem. Sei. 16,89-92 Feinberg, A., and Vogelstein, B. (1983) Anal. Biochem. 132,6-13 Fuchs, E. (1990) J. Cell Biol. 111,2807-2814
Giguere, V., Ong, E. S., Segui, P., and Evans, R. M. (1987) Nature 3 3 0 , 624629 Glick, B., Wachter, C., and Scbatz, G. (1991) Trends Cell Biol. 1 , 99-103 Godovac-Zimmerman, J., Conti, A,, Liberatori, J., and Braunitzer, G. (1985) Biol. Chem. Hoppe-Seyler 366,431-434 Goodman, D. S. (1984) in The Retinoids (Sporn, M.B., Roberts, A. B., and Goodman, D. S., eds) p 41 88, Academic Press, Orlando, FL Heller, J. (1975) J. Biol. 8&~~260,3613-3619 Hellman, U., and Wernstedt, C. (1989) in Electrophoresis Forum '89 (Radola, B. J., ed) pp. 89-93, Technical University, Munich, F. R. G. Hunter, W., and Greenwood, F. (1962) Nature 194,495-496 Kleffel, B., Garavito, R. M., Baumeister, W., and Rosenbusch, J. P. (1985) EMBO J. 4 , 1589-1592 Kozak, M. (1986) Cell 44,283-292 Krust, A., Kastner, P.,Petkovich, M., Zelent, A,, and Chambon, P. (1989)Proc. Natl. Acad. Sci. U. S. A. 86,5310-5314 Kutay, U., Hartmann, E., and Rapoport, T. A. (1993) Trends Cell Biol. 3 , 727.5
KG;, J., and Doolittle, R. F. (1982) J. Mol. Biol. 1 6 7 , 105-132 La Rosa, G., and Gudas, L. (1988a) Proc. Natl. Acad. Sci. U. S. A. 86,329-333 La Rosa, G., and Gudas, L. (1988b) Mol. Cell. Biol. 8,3906-3917 Lee, H., Wells, R., and Reed, B. (1987) Science 236,1053-1056 Gvy, F., Larsson, R., and Kvist, S. (1991) J. Cell Bid. 1 1 6 , 959-970 Lopez, C., Grubb, A,, Soriani, F., and Mendez, E. (1981) Biochem. Biophys. Res. Commun. 103,919-925 Mangelsdorf, D. J., Ong, E. S., Dyck, J. A,, and Evans, R. M. (1990) Nature 346,224-229 Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A,, Zhou, J. Y., Ong, E. S., and Evans, R. M. (1992) Genes & Den 6,329-344 Meyer, D. I. (1991) Trends Cell Bzol. 1,154-159 Muesch, A., Hartmann, E., Rohde, K., Rubartelli, A., Sitia, R., and Rapoport, T. A. (1990) Trends I3iochem.p. 16,86-88 Newcomer, M. E., Jones, T. A., qulst, J., Sundelin, J., Eriksson, U., Rask, L., and Peterson, P. A. (1984) EMBO J. 3 , 1451-1454 Nicholson, R., Mader, S., Sunil, N., Leid, M., Rochette-Egly, C., and Chambon, P. (1990) EMBO J. 9 , 4433-4454 Pervaiz, S., and Brew, K. (1987) FASEB J. 1,209-214 Petkovich, M., Brand, N., Krust, A,, and Chambon, P. (1987) Nature 3 3 0 , 444-450 Rask, L., and Peterson, P. A. (1976) J.Biol. Chem. 261,6360-6366 Rask, L., Anundi, H., and Peterson,,P. A. (1980) FEES Lett. 104,,55-58 Sambrook, J., Fntsch, E., and Manlatis, T. (1989) Moleculur Cloncng: A Laboratory Manual, Cold Sprin Harbor Laboratory, Cold Spring Harbor, NY Sanger, F., Nicklen, S., and toulson, A. (1977) Proc. Natl. Acad. Scz. U. S. A. 72,5463-5467 Schmale, H., Holtgreve-Grez, H., and Christiansen, H. (1990) Nature 3 4 3 , 366-369 Sivaprasadarao, A., and Findlay, J. B. C. (1988) Biochem. J. 266,561-569 Sugara, H., and Hirosawa, K. (1991) Ex Eye Res. 6 3 , 765-771 Sundelin, J., Eriksson, U., Melhus, H., fiilsson, M., Lundvall, J., B h i k , C,-O., L c. d s Hansson. E.. Laurent.. B... and Peterson. P. A. (1985a) Chem. Phrs. . 38,175-185' Sundelin, J.,Laurenk, B. C.,,Anundi, H., Tragirdh, L., Larhammar, D., Bjorck, L., Eriksson, U. kerstrom, B., Jones, A,, Newcomer,M., Peterson, P. A., and Rask. L. (19'85b) . ~~~~,J. Bid. Chem. 260.6472-6480 Tabin,C.~(i991)Cell 6 6 , 199-217 Vasios, G., Gold, J., Petkovich, M., Chambon, P., and Gudas, L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,9099-9103 Wald, G. (1968) Science 1 6 2 , 230-239 Wolbach, S., and Howe, P. (1925) J. Ex Med. 4 2 , 753-777 Young, R., and Davies, R. (1983) Proc. fiatl. Acad. Sci. U. S. A. 80,1194-1198 Zelent. A,. Krust. A,. Petkovich. M.. Kastner. P., and Chambon, P. (1989) Nature 3 3 9 , 714-717
