IJC International Journal of Cancer
The reversible P2Y12 inhibitor ticagrelor inhibits metastasis and improves survival in mouse models of cancer Simon Gebremeskel1, Terry LeVatte1, Robert S. Liwski1,2*, Brent Johnston1,2,3* and Michael Bezuhly1,4* 1
Department of Microbiology and Immunology, Dalhousie University, Halifax, NS, Canada Department of Pathology, Dalhousie University, Halifax, NS, Canada 3 Department of Pediatrics, Dalhousie University, Halifax, NS, Canada 4 Department of Surgery, Dalhousie University, Halifax, NS, Canada 2
Tumor cells use activated platelets to promote their proliferation and metastatic potential. Because platelet activation is largely mediated through ADP engagement of purinergic P2Y12 receptors on platelets, we investigated the potential of the reversible P2Y12 inhibitor ticagrelor, a clinical agent used in the prevention of cardiovascular and cerebrovascular events, to inhibit tumor adhesion and metastasis. In B16-F10 melanoma intravenous and intrasplenic metastasis models, mice treated with a clinical dose of ticagrelor (10 mg/kg) exhibited marked reductions in lung (84%) and liver (86%) metastases. Furthermore, ticagrelor treatment improved survival compared to saline-treated animals. A similar effect was observed in a 4T1 breast cancer model, with reductions in lung (55%) and bone marrow (87%) metastases following ticagrelor treatment. In vitro, B16-F10 cells exhibited decreased interaction with platelets from ticagrelor-treated mice compared to saline-treated mice, an effect similar to that observed with blockade of glycoprotein IIbIIIa. Similarly, B16-F10 cells co-incubated with platelets from ticagrelor-treated mice exhibited reduced adhesion to endothelial monolayers compared to those co-incubated with platelets from saline-treated animals, an effect also observed in vivo. Interestingly, pretreatment of endothelial monolayers with ticagrelor did not result in reduced tumor cell adhesion. These findings support a role for P2Y12-mediated platelet activation in promoting metastases, and provide proof-of-concept for the clinical use of ticagrelor in the prevention of tumor metastasis.
Short Report
It is now well established that normal platelet function is required for cancer progression.1 Mice with pharmacologically or genetically induced thrombocytopenia have dramatically fewer metastases, an effect reversed by transfusing platelet-rich plasma (PRP).2,3 Cancer cells that more effectively activate platelets have been shown to produce more metastases.4 Activated platelets are thought to promote metastasis by shielding tumor cells from natural killer cells,4,5 enhancing adhesion to and transmigration across endothelium6,7 and promoting angiogenesis and proliferation through
Key words: ticagrelor, P2Y12, ADP receptor, platelet, metastasis, endothelium, melanoma, breast cancer Conflict of interest: Nothing to report *R.S.L., B.J. and M.B. are senior authors Grant sponsors: Canadian Institutes of Health Research, Capital Health Research Fund, Dalhousie University Department of Surgery, Cancer Care Nova Scotia/Terry Fox-CIHR Strategic Health Research Training Program in Cancer Research (Beatrice Hunter Cancer Research Institute Studentship) DOI: 10.1002/ijc.28947 History: Received 12 Dec 2013; Accepted 17 Apr 2014; Online 5 May 2014 Correspondence to: Michael Bezuhly, Department of Surgery, Dalhousie University, IWK Health Centre, 5850/5980 University Avenue, PO Box 9700, Halifax, NS, Canada B3K 6R8, Tel.: 11-902470-8168, Fax: 11-902-470-7939, E-mail:
[email protected]
C 2014 UICC Int. J. Cancer: 136, 234–240 (2015) V
release of small molecules such as ATP and ADP.6,8,9 The clinical observation that aspirin use leads to reduced metastasis risk further supports a role for platelets in promoting tumor spread.10 Schumacher et al.6 demonstrated that ATP released by platelets interacts with purinergic P2Y2 receptors on endothelial cells, rendering them more susceptible to tumor cell extravasation; P2Y2-deficient mice, in turn, exhibited decreased tumor metastasis. As platelet activation is largely mediated through ADP engagement of the purinergic receptor P2Y12 on platelets, P2Y12 represents an attractive target for inhibiting tumor metastasis. Recently, Wang et al. demonstrated that tumor metastases are reduced in P2Y12deficient mice.11 In our report, we investigated the potential of a clinical agent, the reversible and specific P2Y12 inhibitor ticagrelor, to inhibit B16-F10 melanoma and 4T1 breast cancer metastasis in mice. Furthermore, we assessed the ability of melanoma cells to interact with both platelets and endothelial monolayers after treatment with ticagrelor.
Material and Methods Animals and cell lines
Wild-type C57BL/6 and BALB/C mice were purchased from Charles River Laboratories (St-Constant, QC, Canada). Experiments were performed in accordance with Canadian Council on Animal Care guidelines. B16-F10 mouse melanoma, 4T1 mouse breast cancer and bEnd.3 mouse brain microvascular endothelial lines were purchased from ATCC (Manassas, VA).
235
Gebremeskel et al.
What’s new? A link between platelets and cancer metastasis has long been recognized. In this paper, the authors provide first evidence that an antiplatelet agent currently in clinical use improves cancer survival in mice. Using ticagrelor, a reversible inhibitor of purinergic P2Y12 receptors critical for platelet activation, they demonstrate that treatment inhibits tumor spread and improves survival in murine B16-F10 melanoma and 4T1 breast cancer metastasis models. Ticagrelor specifically inhibited tumor cellplatelet interactions and decreased tumor cell adhesion by acting primarily on platelets, underscoring a potential clinical use of this and similar agents in cancer therapy in the future.
C57BL/6 mice received intrasplenic or tail vein injections of B16-F10 cells (2.5 3 105) in 50 mL phosphate-buffered saline (PBS) as previously described.12,13 Three days before tumor cell inoculation and daily thereafter, mice received intraperitoneal injections of PBS, the reversible cyclo-pentyl-triazolopyrimidine P2Y12 inhibitor ticagrelor (10 mg/kg; AstraZeneca, Mississauga, ON, Canada) or the irreversible thienopyridine P2Y12 inhibitor clopidogrel (10 mg/kg; BristolMyers Squibb, Montreal, QC, Canada). Dosing was determined based on clinical cardiovascular guidelines and a doubling of bleeding time following a standard tail cut.14 Two weeks later, or sooner if moribund, mice were euthanized. Livers, spleens and lungs were weighed and photographed. Liver or lung surface area covered by tumor was calculated. For survival experiments, animals were maintained for up to 30 days. Female BALB/c mice were inoculated subcutaneously in the fourth mammary pad with 4T1 breast cancer cells (2 3 105). Once a tumor was palpable, mice received daily injections of PBS or ticagrelor (10 mg/kg). One week later, mice underwent primary tumor resection. At 28 days mice were sacrificed and lungs, femurs and tibiae harvested. Dissociated cells from lung and bone marrow were plated in medium containing 60 lM 6-thioguanine. After 14 days, culture plates were fixed with methanol and stained with 0.03% methylene blue to enumerate metastatic 4T1 colonies.
Tumor cell–platelet and tumor–endothelial adhesion assays
For tumor cell–platelet binding assays, confluent B16-F10 monolayers were grown on 24-well polystyrene plates (BD Biosciences, Mississauga, ON, Canada). Platelets isolated from PBS- or ticagrelor-treated mice were labeled with CFDA-SE (Invitrogen, Burlington, ON, Canada) and added to each well for 30 min. Isolated platelets were alternatively pretreated with 10 mg/mL anti-GPIIbIIIa blocking antibody or Armenian hamster IgG isotype control (Biolegend, San Diego, CA) as previously described.15 Wells were washed thrice with PBS at 37 C, velocity of 0.5–1 mL/min for 1 min with an estimated shear stress of 1.8 dyn/cm2. Adherent fluorescent cells were then counted in several fields. For tumor– endothelial adhesion assays, CFDA-SE-labeled B16-F10 cells (2 3 105) were co-incubated with PRP (5 3 107 platelets) C 2014 UICC Int. J. Cancer: 136, 234–240 (2015) V
from PBS- or ticagrelor-treated mice (10 mg/kg daily for 3 days) as previously described.16 The cell mixture was then added to confluent bEnd.3 monolayers. One hour later, wells were washed and adherent fluorescent cells counted. ADP and ATP detection assays
For ADP and ATP secretion experiments, cell mixtures were incubated as above for 6 hr and supernatants were analyzed using ADP (Sigma-Aldrich, St. Louis, MO) and ATP (Life Technologies, Burlington, ON, Canada) determination kits. Immunohistochemistry
To examine in vivo tumor cell–endothelial interactions, intravenous injections of CFDA-SE-labeled B16-F10 cells (2.5 3 105) were administered to mice. Six hours later, mice were perfused with PBS and lungs were isolated. Lungs were fixed with 4% paraformaldehyde for 48 hr, cryopreserved in 30% sucrose overnight, embedded and sectioned. Endothelial cells were stained with rabbit anti-mouse CD31 (Abcam, Toronto, ON, Canada) and Cy3-conjugated secondary antibody (BD Biosciences). Quantitative reverse transcription polymerase chain reaction
Total RNA was isolated from B16-F10 and bEnd.3 cells, platelets and mouse brain and cDNA prepared using Superscript III Reverse Transcriptase (Invitrogen). Quantitative RT-PCR was performed in triplicate with 1 mL of cDNA using Quantifast SYBR Green (Qiagen, Toronto, ON, Canada). Data were collected on RG-6000 Rotor-Gene (Corbett Research, Sydney, Australia) and analyzed using the 22DDCt relative quantification technique and expressed relative to internal normalizing standard mRNA level. High-stringency primer pairs for mouse P2Y12 (forward: CCGGAGACACTCATATCCTTC; reverse: GCCCAGATGACA ACAGA AAG), P2Y2 (forward: GGCAACAGCACGTACTTGAA; reverse: CAGGCCTGTGCATATGT GAG) with hypoxanthine-guanine phosphoribosyltransferase (HPRT) as internal standard (forward: TTGATTGTTGAAGATATAATTGACACT; reverse: TTCCAGTTTCACTAATGA CACA). Statistical analysis
Survival data were analyzed by log-rank (Mantel–Cox) analysis. All other data were analyzed by analysis of variance (ANOVA) with the Fisher post hoc test. All data reported as
Short Report
Metastasis models
Short Report
Figure 1. Ticagrelor administration protects mice from B16-F10 melanoma and 4T1 breast cancer metastases. (a) Calculated percentage of total lung surface area involved with tumor nodules following intravenous inoculation, and corresponding photographs of representative lung surfaces, for PBS-, clopidogrel- and ticagrelor-treated mice, ***p-value < 0.001, n 5 9 per group. For both drugs, dosing was 10 mg/kg daily. Images were visualized using a Leica S6D dissecting microscope equipped with a 103/0.32 Plan Apo lens (Leica, Richmond Hill, ON, Canada) and a Qimaging Micropublisher 3.3 RTV digital camera (QImaging, Surrey, BC, Canada). Images were captured with QCapture Pro 5.0 software (QImaging) and lung surface area covered by tumor nodules was calculated using Simple PCI digital image analysis (Compix, Sewickley, PA). (b) Survival curves comparing PBS-treated (solid line) and ticagrelor-treated (dashed line) mice over 30 days following intravenous injection of B16-F10 melanoma cells, p-value 5 0.02, n 5 10 per group. (c) Calculated percentage of total liver surface area involved with tumor nodules following intrasplenic inoculation, and corresponding photographs of representative liver surfaces, for PBS- and ticagrelor-treated mice, ***p-value < 0.001 compared to PBS, n 5 10 per group. (d) Weights of livers isolated from uninoculated mice compared to intrasplenic tumor-inoculated PBS- and ticagrelortreated mice, **p-value < 0.01 compared to uninoculated control; #p-value < 0.01 compared to tumor-inoculated PBS-treated. A similar difference was observed if liver metastasis was assessed by measuring total nodule number (data not shown). For each group, n 5 12. (e) Survival curves comparing PBS-treated (solid line) and ticagrelor-treated (dashed line) mice over the month following intrasplenic injection of B16-F10 melanoma cells, p-value < 0.001, n 5 10 per group. (f) 4T1 colony-forming units (CFUs) isolated from lungs of PBS- and ticagrelor-treated mice, **p-value < 0.01. 4T1 mouse breast cancer cells (2 3 105) were inoculated into the fourth mammary pad. Once a tumor was palpable, mice received daily injections of PBS or ticagrelor (10 mg/kg). One week later, mice underwent primary tumor resection. At 28 days following tumor resection, dissociated cells from harvested lungs were plated in medium containing 60 lM 6-thioguanine. After 14 days, metastatic 4T1 CFUs were enumerated. (g) 4T1 CFUs isolated from bone marrow from PBS- and ticagrelor-treated mice, ***p-value < 0.001. At 28 days following primary 4T1 tumor resection, dissociated cells from harvested femoral and tibial bone marrow (BM) were plated in medium containing 60 lM 6-thioguanine. After 14 days, metastatic 4T1 CFUs were enumerated.
237
Gebremeskel et al.
Results To assess whether systemic P2Y12 inhibition can decrease metastasis, well-established mouse models of B16-F10 melanoma metastasis were used.12,13 Treatment with clinically relevant doses of ticagrelor or clopidogrel led to significant reductions in lung metastasis (Fig. 1a). Compared to clopidogrel, ticagrelor does not require in vivo metabolism for its antiplatelet activity,17 and has a greater perisurgical safety profile.18 Furthermore, there are concerns regarding potential toxicity of clopidogrel’s metabolites.19 To this end, subsequent experiments were undertaken with ticagrelor alone. Ticagrelor led to improved survival following intravenous tumor inoculation (Fig. 1b). Thirty percent of ticagrelortreated mice were euthanized owing to tachypnea, a surrogate of dyspnea, a documented side effect of ticagrelor observed in humans.18 Among the subset of animals euthanized owing to tachypnea, reduced metastasis were observed in ticagrelor animals (75.4% 6 2.5% in PBS vs. 33.3% 6 4.4% in ticagrelor; p-value < 0.05). Ticagrelor treatment following intrasplenic tumor cell injection led to reduced liver metastasis as assessed by both surface tumor coverage (Fig. 1c) and liver weight (Fig. 1d). Improved survival (Fig. 1e) was observed in ticagrelor-treated animals compared to PBS-treated animals. A decrease in lung metastases was similarly observed in BALB/C mice inoculated in the mammary fat pad with 4T1 breast cancer cells, demonstrating that the effects of ticagrelor were not restricted to specific tumor cells or mouse strains (Fig. 1f). Given the potential of metastases to remain “hidden” in this model,20 4T1 bone marrow metastases were also enumerated with a similar decrease observed in mice treated with ticagrelor (Fig. 1g). All intrasplenic B16-F10 inoculations led to the development of a primary splenic tumor; no significance difference was noted in mean splenic tumor weights between PBS (1.36 6 0.19 g) and ticagrelor (1.49 6 0.23 g) groups. Similarly, mean primary tumor weights in the 4T1 model (0.44 6 0.02 g in PBS vs. 0.45 6 0.02 g in ticagrelor) did not differ significantly between groups, indicating that the difference in metastasis was not due to inhibition of primary tumor growth. No bleeding complications were noted. As P2Y12 is predominantly expressed on platelets, we hypothesized that the observed protection from B16-F10 melanoma metastasis was due to ticagrelor’s action on platelets. In support of this, P2Y12 mRNA expression levels were virtually undetectable in tumor cells or endothelial cell lines (Fig. 2a). Furthermore, pretreatment of B16-F10 melanoma cells with serum from ticagrelor-treated mice or with peak drug concentrations observed in humans (
