The Sarcomeric Actin CArG-Binding Factor Is ... - Europe PMC

MOLECULAR AND CELLULAR BIOLOGY, Feb. 1989, p. 515-522

Vol. 9, No. 2

0270-7306/89/020515-08$02.00/0 Copyright © 1989, American Society for Microbiology

The Sarcomeric Actin CArG-Binding Factor Is Indistinguishable from the c-fos Serum Response Factor LINDA M. BOXER,1 RON PRYWES,2 ROBERT G. ROEDER,2 AND LARRY KEDESlt* The MEDIGEN Project, Department of Medicine, Stanford University School of Medicine and Veterans Administration Medical Center, Palo Alto, California 94304,1 and Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, New York 100212 Received 6 September 1988/Accepted 9 November 1988 The c-fos serum response element (SRE) and a sarcomeric actin promoter element (CArG box) are similar in sequence and are recognized, respectively, by the serum response factor (SRF) and the CArG-binding factor (CBF). Although the transcriptional controls for the c-fos and sarcomeric actin genes are rather different, SRF and CBF have been found to be indisuishable by all criteria tested. They exhibited similar chromatographic properties, sedimentation rates, and temperature stabilities. In mobility shift assays, the SRE competed more strongly than the actin CArG box for formation of either the SRF-SRE or the CBF-CArG complex. The symmetric inverted repeat of the left side of the Xenopus cytoskeletal actin SRE also competed, even more strongly, for each complex. The site-specific binding of each protein was inhibited both by orthophenanthroline, whose effects were reversed by zinc addition, and by treatment with potato acid phosphatase. Furthermore, immune serum raised against the c-fos SRF also recognized the actin CBF. We discuss how transcriptional control of these diverse genes might be obtained with a single similar factor.

The transcriptional activity of eucaryotic genes is regulated in a temporal or tissue-specific manner. It may also be subject to extracellular inducing signals (reviewed in reference 21). This transcriptional control involves the sequencespecific binding of trans-acting transcription factors to specific DNA sequences of promoter regions. The majority of these factors do not appear to be tissue specific, and a number of factors can interact with a single promoter region (6, 9, 13, 21, 32). Different factors that recognize the same DNA sequence have also been identified (5, 8, 10, 37). Recent advances in the techniques of DNA-affinity chromatography (18, 36) have allowed the identification and purification of several transcription factors. The expression of the c-fos proto-oncogene is rapidly induced by a number of mitogenic agents (4, 14, 15, 19, 20, 28, 29). The sequences that are necessary for serum induction have been defined (the serum response element [SRE]), and the cognate recognition protein, the serum response factor (SRF), has also been identified and purified (35, 38, 41). This protein has a molecular size of 62 (35) or 67 (41) kilodaltons (kDa). The sarcomeric a-actin genes are expressed in a tissuespecific and temporally regulated manner during muscle development (16, 22, 42). A DNA sequence element, the CArG (for CC(A/T rich)6GG box, is repeated at positions -225, -190, -140, and -100 in the upstream region of the cardiac a-actin promoter. We have shown previously that the DNA segments containing the first (at -100) and second (at -140) CArG boxes are the major determinants of highlevel muscle-specific expression of the cardiac a-actin gene (27). In vivo competition experiments with C2 cells, a mouse myogenic cell line, revealed that these two regions which are responsible for transcriptional activation are the only detectable sites that interact with rate-limiting factors (26). Like-

wise, 5' deletion analysis (31) and in vivo competition experiments (30) with the skeletal a-actin promoter have shown that a cis-acting transcriptional element located between -153 and -87 is both sufficient and necessary for its muscle-specific expression and developmental regulation during myogenesis in C2 and L8 cells. This domain also contains a CArG box at -98. Both the cardiac and skeletal a-actin promoters show no or very low transcriptional activity when they are transfected into nonmuscle cells (25, 31), and they also show no induction by serum when they are transfected into either C2 or L8 myoblasts (T. Miwa, K. Webster, and L. Kedes, unpublished data). The CArG box is recognized by a transcription factor, the CArG-binding factor (CBF). This factor is present in myogenic and nonmyogenic cells and has a molecular size of 67 kDa (L. M. Boxer, T. Miwa, T. A. Gustafson, and L. Kedes, J. Biol. Chem., in press). The CArG box is found in the promoter region of a number of other genes, some muscle specific and some not (reviewed in reference 39a). The c-fos SRE also contains a CArG box at the center of its dyad symmetry element. Due to the similarity of the DNA-binding sequences, the similar nuclease protection footprints of the binding sites (17, 40), and the identical molecular weights of SRF and CBF, we wished to determine whether the two proteins were identical. In this study we report that the two proteins are indistinguishable by chromatographic profiles, glycerol gradient sedimentation, temperature stability, and DNA-binding properties. The order of competitive binding of the two proteins by different CArG box oligonucleotides is identical. Each protein requires phosphorylation to bind to the specific DNA sequence, since binding can be inhibited by treatment with potato acid phosphatase. The DNA-binding activity of each protein is also abolished by treatment with orthophenanthroline, a Zn2+ chelator. Finally, we show that mouse immune serum raised against SRF also recognizes CBF.

* Corresponding author. t Present address: Program in Molecular Biology and Genetics, University of Southem California School of Medicine, 2011 Zonal Ave., Los Angeles, CA 90033.

515

516

BOXER ET AL.

MATERIALS AND METHODS Probes and competitor fragments for gel mobility shift assays. The plasmid containing the upstream region of the cardiac ot-actin gene has been described previously (26). The 142-base-pair cardiac actin promoter fragment was prepared by subcloning the fragment from -177 to -48 after the addition of EcoRI and BglII linker DNA to the 5' and 3' ends, respectively, into the EcoRI and BamHI sites of pUC19. The fragment was obtained by digestion of this plasmid with EcoRI and HindIII. The 138-base-pair c-fos SRE probe was derived from plasmid pF9 (35) by digestion with XhoI and BglII. The fragments were labeled with T4 polynucleotide kinase (New England BioLabs, Inc.) and [y-32P]ATP (5,000 Ci/mmol; Amersham Corp.). Oligonucleotides used as competitor DNA fragments were synthesized by Jean Reid on an Applied Biosystems 380A DNA synthesizer and purified by polyacrylamide gel electrophoresis. The cardiac a-actin first CArG oligomer contains the sequence from -117 to -92 of the cardiac a-actin upstream region with EcoRI and BglII cohesive ends. The c-fos SRE oligomer contains the sequence from -320 to -295 of the c-fos upstream region. The ACTL oligomer (41) is a symmetric inverted repeat of the left side of the Xenopus cytoskeletal actin SRE. Cell culture and preparation of nuclear extracts. C2 myogenic cells (44) were grown in Dulbecco modified Eagle medium supplemented with 20% fetal calf serum. C2 myoblasts were harvested when confluent. HeLa cells were grown in Dulbecco modified Eagle medium supplemented with 10% calf serum and harvested when confluent. Nuclear extracts were prepared by the method of Dignam et al. (7) except that 2 ,ug each of leupeptin and aprotinin per ml, 1 ,ug each of pepstatin, antipain, and chymostatin per ml, and 1 mM phenylmethylsulfonyl fluoride were added to all solutions. Nuclear proteins were extracted with 0.4 M NaCl. Protein concentration was measured by the method of Bradford (3). Gel mobility shift assay. Nuclear extracts were tested in a modified gel mobility shift assay described in previously published protocols (12, 39). Each binding mixture (25 ,ul) contained 0.5 ng of 32P-labeled DNA fragment, 5 to 8 ,ug of crude nuclear extract protein, 2 ,ug of HpaII-Sau3AI-digested pUC18 DNA in 10 mM Tris hydrochloride (pH 7.5), 80 mM NaCl, 1 mM dithiothreitol, 0.2 mM EDTA, 1.5 mM MgCl2, and 10% glycerol. When indicated, a competitor fragment was also included in the incubation; crude nuclear extract was added last. The assays were incubated at room temperature for 15 min and electrophoresed through 5% polyacrylamide gels in 0.089 M Tris base-0.089 M boric acid-2 mM sodium EDTA. After the gel was dried, radioactivity was detected by autoradiography at -80°C. Chromatography. The method described by Treisman (41) was used. C2 myoblast or HeLa nuclear extract (15 mg of total protein) was dialyzed against buffer D (20 mM HEPES [N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; pH 7.9], 0.2 mM EDTA, 1 mM dithiothreitol, 20% glycerol with the protease inhibitors listed above) containing 0.1 M KCl. It was then applied to a 9-ml BioRex 70 column in buffer D containing 0.1 M KCI. It was washed with 20 ml of the same buffer and eluted with linear gradient of KCl (0.1 to 0.6 M; 45 ml) in buffer D. Fractions containing CBF or SRF were pooled and dialyzed against buffer D with 0.1 M KCl. This pool was loaded onto a 3-ml calf thymus DNA-cellulose (Sigma Chemical Co.) column in the same buffer and washed with 8 ml of the buffer. It was eluted with a linear gradient of

MOL. CELL. BIOL.

KCl (0.1 to 0.4 M; 15 ml) in buffer D. Fractions containing CBF or SRF were pooled and brought to 0.25 M KCI and 0.05% Nonidet P-40. The DNA affinity column was prepared by coupling concatenated annealed ACTL oligomers to CNBr-activated Sepharose 4B (Pharmacia) as described previously (18). The pooled fractions were loaded onto this column (0.5-ml bed volume) in buffer D containing 0.25 M KCI. The column was washed with 1-ml samples of buffer D containing 0.25, 0.5, 0.75, and 1.5 M KCl and containing 3 mM n-octyl glucoside. Glycerol gradient sedimentation. An 80-,ug portion of either C2 myoblast or HeLa nuclear extract was applied to a 5-ml 15 to 40% glycerol gradient in 20 mM Tris hydrochloride (pH 7.5)-i mM EDTA-1 mM dithiothreitol-0.3 M KCl. A parallel glycerol gradient was loaded with the following mixture of protein standards (20 ,ug each): myosin heavy chain (205 kDa), P-galactosidase (116 kDa), bovine serum albumin (67 kDa), ovalbumin (45 kDa), and chymotrypsinogen A (25.7 kDa). The gradients were centrifuged in an SW50.1 rotor at 4°C at 46,000 rpm for 24 h. Fractions (200 pu) were collected and assayed by gel mobility shift. The markers on the parallel gradient were electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel and visualized by Coomassie blue staining. Temperature stability determination. An 8-,ug portion of either C2 myoblast or HeLa nuclear extract was incubated at either 0, 53, 55, 57, or 59°C for 5 min. The samples were then placed on ice for 5 min, and the standard DNA-binding assay was performed. Protease treatment. The standard DNA-binding assay was performed with either C2 myoblast or HeLa nuclear extract. After a 15-min incubation at room temperature, 500 ng of proteinase K was added. The incubation was continued for 10 min at room temperature, and the reaction mixtures were then loaded onto a 5% polyacrylamide gel. Treatment with orthophenanthroline. Orthophenanthroline (Sigma) was dissolved in a small volume of hot water, and the pH was adjusted to 7.2. The solution was diluted to 20 mM. The indicated concentrations of orthophenanthroline or ZnCl2 or both were added to the DNA-binding mixture before addition of nuclear extract, and the standard DNAbinding assay was then performed. Treatment with potato acid phosphatase. Potato acid phosphatase (Boehringer-Mannheim Biochemicals) was obtained as an ammonium sulfate precipitate. A sample was centrifuged for 10 min in a Microfuge (Beckman Instruments, Inc.) in the coldroom. The supernatant was removed, and an equal volume of 10 mM PIPES [piperazine-N,N'-bis(2ethanesulfonic acid); pH 6.0]-50 mM KCl-5% glycerol was added to give a concentration of 1 ,ug/pI. A 1-pug portion of potato acid phosphatase was added to S pig of either C2 myoblast or HeLa nuclear extract, and the mixture was incubated at 37°C for 20 min. Where indicated, 10 mM Na2MoO4 was added before addition of potato acid phosphatase. Gel shift buffer with 10 mM Na2MoO4 and 32plabeled DNA fragment were added, and the incubation was continued at room temperature for 15 min. Preparation of mouse anti-SRF serum. Approximately 0.5 ,ug of DNA-affinity purified SRF (35) was filtered onto a 13-mm nitrocellulose disk. The disk was dissolved in 100 pu1 of dimethyl sulfoxide and injected into a BALB/c mouse subcutaneously. After 4 weeks, the mouse was boosted with antigen in a similar manner and reboosted every 2 weeks for a total of four injections of antigen. Serum was obtained 2 weeks after each boost, and the titer against SRF (as

VOL. 9, 1989

CBF IS INDISTINGUISHABLE FROM SRF

load 0.25

0.50

0.75

1.5

M KCI

2.0

TABLE 1. Comparison of elution positions of CBF and SRF

a

Column

BioRex 70 DNA-cellulose Oligo affinity

1

2

3

4

5

6

7

8 9

10

11

12

Fraction Number FIG. 1. ACTL affinity chromatography of C2 myoblast CBF. The gel mobility shift assay was performed in the standard manner with 5 ,ul of each column fraction with the labeled cardiac a-actin promoter fragment. The positions of steps in the elution are shown at the top.

measured by immunoblotting to purified SRF) was maximal after the second boost. Reaction of anti-SRF with C2 or HeLa nuclear extract. A 1-,u portion of the mouse anti-SRF serum was incubated with S p.g of either C2 myoblast or HeLa nuclear extract in buffer D with 0.1 M KCI for 20 min at room temperature. The gel shift buffer and 32P-labeled DNA fragment were added, and the incubation was continued at room temperature for 15 min before electrophoresis on a 5% polyacrylamide gel. A 1-,uJ sample of preimmune mouse serum was added to nuclear extract in a similar manner. RESULTS Chromatographic proffles of CBF. The c-fos SRF has been purified by three different procedures (35, 38, 41). We wished to determine whether one of these procedures could be used to purify the sarcomeric actin CBF and also whether the chromatographic profiles were similar to those of SRF. The gel shift electrophoretic assay with the labeled cardiac a-actin promoter fragment was used to follow the purification of CBF. C2 myoblast nuclear extract was first chromatographed on the cation-exchange resin BioRex 70. CBF eluted between 0.30 and 0.45 M KCl. The pooled fractions were dialyzed and applied to a calf thymus DNA-cellulose column at 0.1 M KCl. CBF eluted at 0.15 to 0.25 M KCl. The pooled fractions were adjusted to 0.25 M KCl and loaded onto an ACTL oligonucleotide affinity column as described in Materials and Methods. The column was washed with 0.5 and 0.75 M KCI and then eluted with 1.5 M KCI. A small amount of CBF eluted in the loading volume and the 0.25 M KCl wash, but the majority eluted with the 1.5 M KCI step (Fig. 1). An affinity column containing the cardiac a-actin first CArG oligonucleotide has also been used to purify CBF. As predicted from the fact that this sequence is a weaker competitor against the CBF-DNA complex (see next section), CBF eluted from this affinity column at a lower salt concentration (0.5 M KCI; data not shown). The CBF chromatography results are summarized and compared with the chromatographic behavior of SRF from HeLa nuclear extract in our laboratory in Table 1. The labeled c-fos SRE fragment was used to assay this binding

517

Elution position (M KCI) of: CBF (C2 SRF (HeLa nuclear extract) nuclear extract)

0.30-0.45 0.15-0.25 1.5 M step

0.35-0.50 0.20-0.30 1.5 M step

activity by gel mobility shift. The chromatographic profiles of the two proteins are essentially the same. We were concerned that C2 myogenic cells might contain both SRF and another factor that had a higher affinity for the cardiac a-actin promoter CArG box. C2 nuclear extract has been fractionated over several different chromatographic resins and assayed with different nonspecific competitor DNAs [poly(dI-dC), sonicated Escherichia coli, and salmon sperm DNA], and no other factor that recognizes this CArG box has been identified (L. M. Boxer and L. Kedes, unpublished data). Cross competition by the binding sites of CBF and SRF. The similarity in the binding sites for CBF and SRF prompted us to determine whether CBF would recognize the SRF site and vice versa. There is a protein in HeLa crude nuclear extract that forms a complex with the cardiac a-actin promoter fragment (Fig. 2A, lane 3), and this complex has the same mobility as the complex formed by CBF in C2 myoblast nuclear extract with this fragment (Fig. 2A, lane 1). There is also a protein in C2 myoblast nuclear extract that binds to the c-fos SRE fragment (Fig. 2A, lane 2), and again the complex has a mobility identical to that formed by SRF with the SRE fragment (Fig. 2A, lane 4). The two labeled fragments do not differ appreciably in size (142 base pairs for the cardiac a-actin and 138 base pairs for the c-fos SRE fragment). Thus, a protein present in C2 or HeLa nuclear extracts forms a complex that comigrates when either the cardiac a-actin promoter or the c-fos SRE probe is used. Competition experiments were performed to determine whether the factors binding to the cardiac a-actin promoter fragment and the c-fos SRE fragment were the same and whether the relative affinities were also similar. The complex formed by CBF with the cardiac a-actin promoter fragment was competed against by an oligonucleotide containing the cardiac a-actin first CArG sequence as expected (Fig. 2B, lanes 2 and 3). An oligonucleotide containing the c-fos SRE sequence is a stronger competitor than the oligonucleotide containing the cardiac a-actin first CArG sequence (Fig. 2B, lanes 4 and 5). An oligonucleotide (ACTL) containing the symmetic inverted repeat of the left side of the Xenopus cytoskeletal actin SRE was shown to have a higher SRF affinity than the natural c-fos SRE (41). This oligonucleotide is also a stronger competitor for the complex formed by CBF and the cardiac a-actin promoter fragment than either the cardiac a-actin first CArG sequence or the c-fos SRE (Fig. 2B, lanes 6 and 7). The order of binding affinities for SRF appears to be the same as that of CBF, with ACTL being the strongest competitor sequence, followed by the c-fos SRE and then the cardiac a-actin first CArG sequence (Fig. 2C). Thus, the same factor binds to the cardiac a-actin promoter fragment and the c-fos SRE fragment. One or more bands of greater mobility are often seen in both C2 and HeLa nuclear extracts; they are nonspecific and cannot be consistently competed against by specific competitor DNA. Glycerol gradient sedimentation of CBF and SRF. To

518

BOXER ET AL.

MOL. CELL. BIOL.

A

B

C

1 234

1 2 34 567 to

1 2 34 5 6 7

gA

FIG. 2. (A) CBF binding to the SRE. DNA binding mixtures were prepared as described in Materials and Methods. Lanes: 1, 5 1Lg of C2 myoblast nuclear extract with the labeled cardiac a-actin promoter fragment; 2, 5 ,ug of C2 nuclear extract with the labeled c-fos SRE fragment; 3, 5 ,ug of HeLa nuclear extract with the labeled cardiac a-actin promoter fragment; 4, 5 jig of HeLa nuclear extract with the labeled c-fos SRE fragment. (B) Competition of the CBF-cardiac a-actin promoter complex. All incubations contained 2 ,ug of pUC18 DNA and 0.5 ng of labeled cardiac a-actin promoter fragment. Lanes: 1, 5 ,ug of C2 nuclear extract with the labeled cardiac a-actin promoter fragment and no competitor DNA added; 2 and 3, 2.5- and 50-fold molar excesses, respectively, of the cardiac a-actin first CArG oligomer (AATTCGAAGGGGACLAAAIAAjjCAAGGTGGA); 4 and 5, 2.5- and 50-fold molar excesses, respectively, of the c-fos SRE oligomer (AATTCCAGGATGTCCATATTAGGACATCTGCA); 6 and 7, 2.5- and 50-fold molar excesses, respectively, of the symmetric inverted repeat of the left side of the Xenopus cytoskeletal actin SRE (ACTL) oligomer (AATTCCCAGATG!CCCATATATGGGCATCTAAA). (C) Competition of the SRF-SRE complex. All incubations were done with 5 pg of HeLa nuclear extract with the labeled c-fos SRE fragment. Lanes (competitor DNA) are the same as in panel B.

shapes are similar to that of bovine serum albumin, the native molecular sizes can be estimated as 67 kDa, consistent with the estimates of the monomeric forms of SRF (35, 41) and CBF (Boxer et al., in press) by sodium dodecyl sulfate gel electrophoresis. There was no change in the sedimentation profile of either CBF or SRF in buffer containing no KCl (data not shown). Temperature stability of CBF and SRF. To test the temperature stability of CBF and SRF, small portions of either C2 myoblast nuclear extract or HeLa nuclear extract were

estimate the relative native sizes of CBF and SRF, nuclear extracts from C2 myoblasts and from HeLa cells were subjected to sedimentation through 15 to 40% glycerol gradients containing 0.3 M KCI. The gradients were fractionated and assayed by gel mobility shift. The C2 myoblast fractions were assayed with the cardiac a-actin promoter fragment to monitor CBF, and the HeLa fractions were assayed with the c-fos SRE to monitor SRF. The sedimentation profiles of CBF and SRF were equivalent and similar to that of bovine serum albumin (Fig. 3A and B). If the

A

chym

I..

vA

v

gal

my

g.

*.* .I

lowipwv,w

3 4

5

6

7

8

9

10 11

1,-

r

12 13

14

15

16 17 18

19 20

21 22 23 24

Fraction Number FIG. 3. (A) Glycerol gradient sedimentation of CBF. C2 myoblast nuclear extract (80 ,g) was sedimented as described in Materials and Methods. Fractions (200 pl) were collected, and 8 ,ul of each was assayed by gel mobility shift with the labeled cardiac a-actin promoter fragment. Only the portion of the gel containing the complex of altered mobility is shown. (B) Glycerol gradient sedimentation of SRF. HeLa nuclear extract was sedimented as described for C2 nuclear extract in a parallel gradient. The assay was performed as for panel A with the labeled c-fos SRE fragment. The positions of the marker proteins in a parallel gradient are indicated (chym, chymotrypsinogen A; ov, ovalbumin; BSA, bovine serum albumin; gal, 0-galactosidase; my, myosin heavy chain). The left side of the figure corresponds to the top of the gradient.

VOL. 9, 1989


1 2 3 4 5 6 7 8 910 0

53

55

57 59

0

53

55

519

1 2 3 4 56

57 59

-

0

FIG. 4. Temperature stability of CBF and SRF. An 8-,ug portion of either C2 myoblast or HeLa nuclear extract was heated to the temperature indicated below the lane number (in degrees Celsius) for 5 min. Lanes 1 through 5, C2 myoblast nuclear extract with the labeled cardiac a-actin promoter fragment; lanes 6 through 10, HeLa nuclear extract with the labeled c-fos SRE fragment.

heated to the indicated temperature for 5 min and then used in the standard DNA-binding assay. Both CBF and SRF DNA-binding activities persisted to 57°C (Fig. 4). At temperatures above 57°C, the DNA-binding activity of each protein was reproducibly lost. Protease treatment of CBF and SRF. We have shown previously that treatment of CBF with proteinase K yields a more rapidly migrating complex on gel shift assay (Boxer et al., in press). This complex was specifically competed with by the cardiac a-actin first CArG box sequence, and the proteolytic fragment had a molecular size of approximately 30 kDa. We interpret these results as defining a distinct DNA-binding domain of CBF. To determine whether SRF also has a protease-resistant core, 500 ng of proteinase K was added to the binding mixture of HeLa nuclear extract and the c-fos SRE fragment. A more rapidly migrating band was seen with proteinase K treatment (Fig. 5, lane 5). This band had the same mobility as that seen after proteinase K treatment of the CBF-cardiac a-actin promoter complex (Fig. 5, lane 2). Both of the protease-resistant core complexes were competed with by an excess of unlabeled specific DNA fragment (Fig. 5, lanes 3 and 6). Binding of CBF and SRF to DNA requires Zn2+. Many proteins that interact with nucleic acids require metal ions for activity (reviewed in reference 1). MgCl2 at a concentration of 0.5 to 1.5 mM increased the binding of CBF to the cardiac a-actin promoter fragment approximately threefold (data not shown). The addition of ZnC12 up to 1 mM above the trace concentrations present in the nuclear extracts had little effect on the binding of CBF to DNA; however, concentrations of ZnC12 greater than this caused a decrease in the binding of CBF to the cardiac a-actin promoter fragment (data not shown). A similar effect on the binding of SRF to the c-fos SRE was seen with the addition of ZnCI2 (data not shown). To test whether Zn2+ could be required for the binding of these proteins to DNA in the trace amounts that are present in the binding buffer or in nuclear extracts (43), we added increasing concentrations of orthophenanthroline to the standard binding mixture. Orthophenanthro-

FIG. 5. Protease treatment of CBF and SRF. The DNA-binding incubation was performed as described in Materials and Methods. After a 15-min incubation, 500 ng of proteinase K was added and the incubation was continued for 10 min. Lanes: 1 through 3, 5 ,ug of C2 myoblast nuclear extract with the labeled cardiac a-actin promoter fragment; 4 through 6, 5 Fg of HeLa nuclear extract with the labeled c-fos SRE fragment. Lanes 1 and 4 contain no proteinase K; lanes 2, 3, 5, and 6 contain 500 ng of proteinase K. Lanes 3 and 6 also contain a 100-fold molar excess of the cardiac a-actin first CArG oligomer and the c-fos SRE oligomer, respectively.

line did inhibit the binding of CBF to DNA at concentrations of 4 and 2 mM (Fig. 6A, lanes 2 and 3). This effect was first observed at concentrations greater than 1 mM (data not shown). The addition of increasing concentrations of ZnCl2 in the presence of 4 mM orthophenanthroline restored DNA

B

A 1 2 34 56

1 2 34 5 6

S

FIG. 6. Orthophenanthroline inhibition of DNA binding. (A) C2 myoblast nuclear extract (5 p.g) was incubated with the labeled cardiac a-actin promoter fragment. Lane 1 contains no addition to the standard DNA-binding mixture. Lanes 2 and 3 contain 4 and 2 mM orthophenanthroline, respectively. Lanes 4, 5, and 6 contain 4 mM orthophenanthroline and 100, 200, and 500 F±M ZnC12, respectively. (B) HeLa nuclear extract (5 pLg) was incubated with the labeled c-fos SRE fragment. Lane 1 contains no addition to the standard DNA-binding mixture. Lanes 2 and 3 contain 2 and 4 mM orthophenanthroline, respectively. Lanes 4 through 6 contain 4 mM orthophenanthroline and 100, 200, and 500 ,uM ZnC12, respectively.

520

BOXER ET AL.

MOL. CELL. BIOL.

1 2 34 5 6

B

A

1 2 3

1 2 3

'o so

to w

..-.:3I

*

a

~~....

ft~

FIG. 7. Dephosphorylation inhibition of DNA binding. (A) C2 myoblast nuclear extract (5 pLg) was incubated with the labeled cardiac a-actin promoter fragment. (B) HeLa nuclear extract (5 jig) was incubated with the labeled c-fos SRE fragment. Lanes 1, No potato acid phosphatase; lanes 2, 1 jig of potato acid phosphatase; lanes 3, 10 mM NaMoO4 and 1 ,ug of potato acid phosphatase.

binding (Fig. 6A, lanes 4 through 6). Orthophenanthroline also inhibited the binding of SRF to the c-fos SRE fragment (Fig. 6B, lanes 2 and 3), and addition of ZnCl2 restored the binding activity (Fig. 6B, lanes 4 through 6). CBF and SRF must be phosphorylated to bind to DNA. One possible explanation for the diverse functions of CBF and SRF is that the protein is posttranslationally modified in some manner to change its mode of action on one of these promoters. The requirement of phosphorylation for each of the proteins was investigated. SRF was shown recently to be a phosphoprotein and to require phosphorylation to bind to DNA (34). These experiments were performed on purified SRF. The effect of dephosphorylation of CBF was investigated in C2 nuclear extract and compared with that of SRF in HeLa nuclear extract. C2 nuclear extract was treated with potato acid phosphatase for 20 min, and then the standard DNA binding assay was performed. Dephosphorylation inhibited the DNA-binding activity of CBF (Fig. 7A, lane 2). The addition of 10 mM Na2MoO4 (a phosphatase inhibitor) prevented the decrease in DNA binding activity (Fig. 7A, lane 3). The effect of dephosphorylation of SRF in HeLa nuclear extract was similar. DNA-binding activity was greatly diminished, and Na2MoO4 prevented this loss of DNA-binding activity (Fig. 7B, lanes 2 and 3). Antibody against SRF reacts with CBF. Mouse immune serum raised against purified SRF bound to the SRF protein and caused the SRF-c-fos SRE fragment complex to migrate more slowly (Fig. 8, lane 6). Preimmune mouse serum had no effect on the mobility of the complex when it was added to the DNA-binding mixture (Fig. 8, lane 5). To determine whether the immune serum would also recognize CBF, the serum was added to the DNA-binding mixture with C2 myoblast nuclear extract and the cardiac a-actin promoter fragment. The CBF-cardiac a-actin promoter fragment complex was also shifted to a lesser mobility (Fig. 8, lane 3). Preimmune serum again had no effect on the mobility of the complex. These results demonstrate that CBF and SRF contain common antigenic determinants and thus are closely related proteins.

FIG. 8. Anti-SRF reaction with CBF. Lanes 1 through 3 contain 5 ,g of C2 myoblast nuclear extract with the labeled cardiac a-actin promoter fragment; lanes 4 through 6 contain 5 ,ug of HeLa nuclear extract with the labeled c-fos SRE fragment. Lanes 1 and 4 contain no antiserum; lanes 2 and 5 contain 1 RI of preimmune mouse serum; lanes 3 and 6 contain 1 ,ul of anti-SRF serum.

DISCUSSION The similarity or virtual identity of a number of characteristics of both the sarcomeric actin CBF and the c-fos SRF suggests that the two proteins are indistinguishable. CBF chromatographed similarly to SRF over a BioRex 70 column and a DNA-cellulose column. It bound to the ACTL oligonucleotide affinity column and was eluted with 1.5 M KCl, as is SRF. Both proteins sedimented with bovine serum albumin in glycerol gradient ultracentrifugation. The molecular size of 67 kDa estimated from this sedimentation is the same as that obtained by UV-crosslinking sodium dodecyl sulfate gel analysis for both CBF (Boxer et al., in press) and SRF (35, 41). The sedimentation profile of neither factor changed in low salt, so there is no evidence for dimer or multimer formation under these conditions. Both proteins were stable to heat inactivation until temperatures greater than 57°C are reached. CBF bound to the c-fos SRE in a gel mobility shift assay, and likewise, SRF bound to the cardiac a-actin promoter fragment, as shown by the cross-competition experiments. The complexes all have the same mobility. The relative affinities of the three CArG box fragments are the same for each factor. The cardiac a-actin first CArG box sequence is the weakest competitor, and the c-fos SRE competes at an intermediate level. The symmetric inverted repeat of the left side of the Xenopus cytoskeletal actin gene is the strongest competitor. A number of other CArG sequences have been tested as competitors, and no difference has been found in the order of competition for the complexes formed by CBF or SRF (L. M. Boxer, T. Miwa, and L. Kedes, manuscript in

preparation). The binding of both CBF and SRF to their target sequences was inhibited by orthophenanthroline at concentrations greater than 1 mM. Orthophenanthroline is an efficient chelator of Zn2+, Fe2 , Mn2 , and Cu2 . It is frequently used at millimolar concentrations to demonstrate the presence of Zn2+ in the catalytic center of zinc metalloenzymes (33). SRF-CBF may be a Zn2+ finger protein, as is the case for transcription factor TFIIIA (2, 23), or it may require Zn2+ for dimer formation, as the TAT protein does (11). Alternatively, the presence of Zn2+ may be required for some other kind of interaction of the protein with DNA. The


VOL. 9, 1989

addition of either Fe2 , Mn2 , Cu2 , or Ca2+ was not able to restore DNA binding activity in the presence of 4 mM orthophenanthroline (data not shown). Both CBF and SRF are phosphoproteins and require phosphorylation to bind to the specific DNA sequences, as evidenced by the fact that treatment with potato acid phosphatase inhibited the DNA-binding activity. This inhibition was not due to a contaminating protease in the phosphatase preparation, because the addition of Na2MoO4 inhibited the phosphatase, and under these conditions no effect on the DNA-binding activity of CBF or SRF was seen. The strongest evidence for the identity of these two proteins is that mouse antiserum raised against purified SRF cross-reacted with CBF. This was demonstrated by a shift of the CBF-CArG gel retardation complex to a lesser mobility. Preimmune mouse serum had no effect on the mobility of the CBF- or SRF-DNA complex. This does not prove exact identity of the two proteins, but given the similar results of the other protein characterizations we have performed, we feel that CBF and SRF are likely to be the same protein. We cannot rule out minor amino acid differences; this determination will have to await purification of a quantity of CBF sufficient for peptide sequencing or isolation of its cDNA. The possibility that the same protein is posttranslationally modified to give different functional activities still exists. Both proteins require phosphorylation to bind to DNA, but phosphorylation of another domain of one of these proteins could affect its functional activity. The binding sites of each factor as defined by methylation interference are very similar (13, 17, 40):

'V human c-fos SRE CCATATTAGGA GGTATAATCCT AA

human cardiac a-actin CCAAATAAGGC GGTTTATTCCG AA A The CArG box of the human cardiac a-actin promoter is not at the center of a region of dyad symmetry, as is the c-fos SRE CArG box. However, the importance of the region of dyad symmetry for the binding of the factor is not clear, and it may not be required at all. Such a region may contribute to the higher affinity of this site for SRF-CBF, or the different bases in the A+T-rich region of the CArG box may be the determining factor. The SRE sequences can substitute for the cardiac ot-actin first CArG box in the cardiac a-actin promoter in transfection experiments with C2 cells (Boxer et al., in preparation). How can a single protein control the transcriptional activation of such diverse genes as the sarcomeric actin and c-fos genes? One possibility is that gene activation is a function of the accessibility of the promoter regions to these factors. However, this cannot be the sole determinant of gene activity, because in L8 myogenic cells, up-modulation of the transfected cardiac a-actin gene occurs during differentiation (24). Furthermore, the cardiac a-actin promoter is not expressed after transfection into nonmuscle cells that contain SRF and express genes containing the SRE. A second possibility is that CBF and SRF are very closely related, but not identical, proteins. There could be a family of related factors, as is the case for the octamer-binding proteins (10, 37) and the CAAT binding proteins (5, 8). As is the case with the octamer-binding proteins, there could be

521

selective function of heterogeneous forms of CBF-SRF without selective DNA binding. Posttranslational modification has already been mentioned as a possible distinguishing factor. Alternative splicing of a single gene could also yield related but distinct products. Finally, it may be that an auxiliary factor that binds to CBF or SRF and modifies its interaction with the promoter is required. This could be a muscle-specific factor that thus confers on the cardiac a-actin promoter the property of muscle-specific expression. We are currently investigating which of these possibilities explains the muscle-specific expression of the sarcomeric actin genes. ACKNOWLEDGMENTS We are grateful to Leticia Lopez and Peter Evans for expert assistance and to Jean Reid for synthesis of the oligonucleotides. This work was supported by a grant from the Veterans Administration and a Public Health Service grant from the National Institutes of Health to L.K., by Public Health Service research grant CA 42567 from the National Cancer Institute to R.G.R., and by general support from the Pew Trusts to the The Rockefeller University. L.M.B. is a Research Associate in the Veterans Administration Career Development Program. R.P. is a Fellow of the Jane Coffin Childs Memorial Fund for Cancer Research. LITERATURE CITED 1. Berg, J. M. 1986. Potential metal-binding domains in nucleic acid binding proteins. Science 232:485-487. 2. Berg, J. M. 1988. Proposed structure for the zinc-binding domains from transcription factor IIIA and related proteins. Proc. Natl. Acad. Sci. USA 85:99-102. 3. Bradford, M. M. 1976. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 4. Bravo, R., J. Burckhardt, T. Curran, and R. Muller. 1985. Stimulation and inhibition of growth by EGF in different A431 cell clones is accompanied by the rapid induction of c-fos and c-myc proto-oncogenes. EMBO J. 4:1193-1198. 5. Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp. 1988. Human CCAAT-binding proteins have heterologous subunits. Cell 53:11-24. 6. Chodosh, L. A., R. W. Carthew, and P. A. Sharp. 1986. A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor. Mol. Cell. Biol. 6:4723-4733. 7. Dignam, J. D., R. M. Lebowitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489. 8. Dorn, A., J. BoUekens, A. Staub, C. Benoist, and D. Mathis. 1987. A multiplicity of CCAAT box-binding proteins. Cell 50:863-872. 9. Dynan, W. S., and R. Tjian. 1985. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA-binding proteins. Nature (London) 316:774-778. 10. Fletcher, C., N. Heintz, and R. G. Roeder. 1987. Purification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human histone H2b gene. Cell 51:773-781. 11. Frankel, A. D., D. S. Bredt, and C. 0. Pabo. 1988. Tat protein from human immunodeficiency virus forms a metal-linked dimer. Science 240:70-73. 12. Fried, M. G., and D. M. Crothers. 1981. Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res. 9:6505-6525. 13. Gilman, M. Z., R. N. Wilson, and R. A. Weinberg. 1986. Multiple protein-binding site in the 5' flanking region regulate c-fos expression. Mol. Cell. Biol. 6:4305-4316. 14. Greenberg, M. E., L. A. Greene, and E. B. Ziff. 1985. Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC12 cells. J. Biol. Chem. 260:14101-14110.

522

BOXER ET AL.

15. Greenberg, M. E., and E. B. Ziff. 1984. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature (London) 311:433-438. 16. Gunning, P., P. Ponte, H. Blau, and L. Kedes. 1983. a-Skeletal and a-cardiac actin genes are coexpressed in adult human skeletal muscle and heart. Mol. Cell. Biol. 3:1985-1995. 17. Gustafson, T. A., T. Miwa, L. M. Boxer, and L. Kedes. 1988. Interaction of protein factors with muscle-specific regulatory sequences of the human cardiac a-actin promoter. Mol. Cell. Biol. 8:4110-4119. 18. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification of sequence-specific DNA binding proteins. Proc. Natl. Acad. Sci. USA 83:5889-5893. 19. Kruijer, W., J. A. Cooper, T. Hunter, and I. M. Verma. 1984. Platelet-derived growth factor induces rapid but transient expression of the c-fos gene and protein. Nature (London) 312:711-716. 20. Kruijer, W., D. Schubert, and I. M. Verma. 1985. Induction of the proto-oncogene fos by nerve growth factor. Proc. Natl. Acad. Sci. USA 82:7330-7334. 21. Maniatis, T., S. Goodbourn, and J. A. Fischer. 1987. Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1244. 22. Mayer, Y., H. Czosnek, P. Zeelon, D. Yaffe, and U. Nudel. 1984. Expression of the genes coding for the skeletal and cardiac actins in the heart. Nucleic Acids Res. 12:1087-1100. 23. Miller, J., A. D. McLachlan, and A. Klug. 1985. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 4:1609-1614. 24. Minty, A., H. Blau, and L. Kedes. 1986. Two-level regulation of cardiac actin gene transcription: muscle-specific modulating factors can accumulate before gene activation. Mol. Cell. Biol. 6:2137-2148. 25. Minty, A., and L. Kedes. 1986. Upstream regions of the human cardiac actin gene that modulate its transcription in muscle cells: presence of an evolutionarily conserved repeated motif. Mol. Cell. Biol. 6:2125-2136. 26. Miwa, T., L. M. Boxer, and L. Kedes. 1987. CArG boxes in the human a-cardiac actin gene are core binding sites for positive trans-acting regulatory factors. Proc. Natl. Acad. Sci. USA 84:6702-6706. 27. Miwa, T., and L. Kedes. 1987. Duplicated CArG box domains have positive and mutually dependent regulatory roles in expression of the human a-cardiac actin gene. Mol. Cell. Biol. 7:2803-2813. 28. Moore, J. P., J. A. Todd, T. R. Hesketh, and J. C. Metcalfe. 1986. c-fos and c-myc gene activation, ionic signals, and DNA synthesis in thymocytes. J. Biol. Chem. 261:8158-8162. 29. Muller, R., R. Bravo, J. Burckhardt, and T. Curran. 1984. Induction of c-fos gene and protein by growth factors precedes activation of c-myc. Nature (London) 312:716-720. 30. Muscat, G. E. O., T. A. Gustafson, and L. Kedes. 1988. The

MOL. CELL. BIOL.

human skeletal and cardiac a-actin genes interact with common trans-acting factors. Mol. Cell. Biol. 8:41204133. 31. Muscat, G. E. O., and L. Kedes. 1987. Multiple 5'-flanking regions of the human a-skeletal actin gene synergistically modulate muscle-specific expression. Mol. Cell. Biol. 7:4089-4099. 32. Peterson, C. L., and K. L. Calame. 1987. Complex protein binding within the mouse immunoglobulin heavy-chain enhancer. Mol. Cell. Biol. 7:4194-4203. 33. Poroscke, L. H., M. Cohn, N. Vanagisawa, and D. S. Auld. 1979. Methionyl-tRNA synthetase of Escherichia coli. A zinc metalloprotein. Biochim. Biophys. Acta 576:128-133. 34. Prywes, R., A. Dutta, J. A. Cromlish, and R. G. Roeder. 1988. Phosphorylate of serum response factor, a factor that binds to the serum response element of the c-fos enhancer. Proc. Natl. Acad. Sci. USA 85:7206-7210. 35. Prywes, R., and R. G. Roeder. 1987. Purification of the c-fos enhancer-binding protein. Mol. Cell. Biol. 7:3482-3489. 36. Rosenfeld, P. J., and T. J. Kelly. 1986. Purification of nuclear factor I by DNA recognition site affinity chromatography. J. Biol. Chem. 261:1398-1408. 37. Scheidereit, C., A. Heguy, and R. G. Roeder. 1987. Identification and purification of a human lymphoid-specific octamer-binding protein (OTF-2) that activates transcription of an immunoglobulin promoter in vitro. Cell 51:783-793. 38. Schroter, H., P. E. Shaw, and A. Nordheim. 1987. Purification of intercalator-released p67, a polypeptide that interacts specifically with the c-fos serum response element. Nucleic Acids. Res. 15:10145-10158. 39. Singh, H., R. Sen, D. Baltimore, and P. A. Sharp. 1986. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature (London) 319:154-158. 39a.Taylor, M. A., H. P. Erba, G. E. 0. Muscat, and L. Kedes. 1988. Nucleotide sequence and expression of the human skeletal a-actin gene: evolutionary comparison of functional regulatory domains. Genomics 3:323-336. 40. Treisman, R. 1986. Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46:567-574. 41. Treisman, R. 1987. Identification and purification of a polypeptide that binds to the c-fos serum response element. EMBO J. 6:2711-2717. 42. Vandekerckhove, J., G. Bugiasky, and M. Buckingham. 1982. Simultaneous expression of skeletal muscle and heart actin protein in various striated muscle tissues and cells. J. Biol. Chem. 261:1838-1843. 43. Westin, G., and W. Schaffner. 1988. Heavy metal ions in transcription factors from HeLa cells: Spl, but not octamer transcription factor, requires zinc for DNA binding and for activator function. Nucleic Acids Res. 16:5771-5781. 44. Yaffe, D., and 0. Saxel. 1977. Serial passing and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature (London) 270:725-727.