the transcriptional program in the response of ... - The FASEB Journal

The FASEB Journal express article 10.1096/fj.01-0172fje. Published online September 17, 2001.

Rays and arrays: the transcriptional program in the response of human epidermal keratinocytes to UVB illumination Deling Li*, Thomas G. Turi†, Alyssa Schuck*, Irwin M. Freedberg*,‡, Gregory Khitrov*, and Miroslav Blumenberg*,§,R *The R. O. Perelman Department of Dermatology, New York University School of Medicine, 550 First Avenue, New York, †Central Research Division, Pfizer Inc., Eastern Point Road, Box 1125, Groton, Connecticut, and ‡Departments of Cell Biology, and § Biochemistry, and RThe Kaplan Cancer Research Center, New York University School of Medicine, 550 First Avenue, New York Corresponding author: M. Blumenberg, Department of Dermatology, New York University School of Medicine, 550 First Ave., New York, NY 10016. E-mail: [email protected] ABSTRACT The epidermis, our first line of defense from ultraviolet (UV) light, bears the majority of photodamage, which results in skin thinning, wrinkling, keratosis, and malignancy. Hypothesizing that skin has specific mechanisms to protect itself and the organism from UV damage, we used DNA arrays to follow UV-caused gene expression changes in epidermal keratinocytes. Of the 6,800 genes examined, UV regulates the expression of at least 198. Three waves of changes in gene expression can be distinguished, 0.5–2, 4–8, and 16–24 h after illumination. The first contains transcription factors, signal transducing, and cytoskeletal proteins that change cell phenotype from a normal, fast-growing cell to an activated, paused cell. The second contains secreted growth factors, cytokines, and chemokines; keratinocytes, having changed their own physiology, alert the surrounding tissues to the UV damage. The third wave contains components of the cornified envelope, as keratinocytes enhance the epidermal protective covering and, simultaneously, terminally differentiate and die, removing a carcinogenic threat. UV also induces the expression of mitochondrial proteins that provide additional energy, and the enzymes that synthesize raw materials for DNA repair. Using a novel skin organ culture model, we demonstrated that the UV-induced changes detected in keratinocyte cultures also occur in human epidermis in vivo. Key words: aging • cornified envelope • DNA repair • IL-8 • skin

U

ltraviolet light (UV) is a major environmental damaging agent that causes photoaging and cutaneous malignancies. Clinical features of photoaging include wrinkles, pigmentation changes, skin laxity, and coarseness (1). The clinical and histological manifestations of UV damage have been well known for some time, but the molecular mechanisms that cause them have only recently become a focus of concerted studies. We hypothesize that, although UV is clearly damaging to skin, the cellular responses to UV are

predominantly beneficial and protective, akin to the responses to DNA damage. If so, photoaging would occur when these responses to UV are ineffective or overwhelmed. Detailed molecular identification and characterization of the responses to UV should provide targets for the prevention or therapy of cutaneous manifestations of sun damage. Such treatments would be highly significant to the aging population, especially in the areas where photoaging is severe. We hypothesize further that epidermal keratinocytes, unlike other cell types in our body, not only protect themselves from UV, but they also protect the underlying organism. If this hypothesis were correct, then UV would not be just one more cause of stress to keratinocytes but a specific injury with a specific set of responses. In epidermal keratinocytes, therefore, UV should elicit not only the immediate-early responses demonstrated in other cell types, but also activate additional skin-specific protective mechanisms. Molecular effects of UV include DNA damage, apoptosis, and transcriptional changes. However, epidermal keratinocytes, the main target of environmental UV, have seldom been used as the model system for studies of the effects of UV. When illuminated by UV, keratinocytes initiate DNA repair (2), signal to the surrounding tissue by releasing proinflammatory cytokines (3, 4), and activate UV-specific signal transduction cascades that result in activation of transcription factors and regulation of gene expression (5, 6). A major impetus for studies of the molecular response to UV came with the identification of c-Jun amino-terminal kinases (JNK), the protein kinase that, in response to UV, binds to and activates transcription factors c-Jun, Elk1, ATF2, and others (7–9). In addition to responding to UV, JNK responds to extracellular stress signals such as osmotic shock, arsenate, and proinflammatory cytokines (10, 11). JNK is itself activated by a small number of relatively specific kinases, JNKKs, which, in turn, are activated by JNKKKs, which are kinases that respond to a variety of stimuli (12). The UV-responsive JNKKK has not been identified yet. Another clear molecular effect of UV is the activation of the NF-κB transcription factor (13). The activation of NF-κB by UV is not associated with DNA damage and occurs even in cytoplasts devoid of nuclear DNA (13, 14). A complex containing IKK kinases activates NFκB in response to proinflammatory cytokines (15), however, a different—so far unidentified—kinase activates NF-κB in response to UV (16). An exciting, new technology developed from the genome sequencing projects is gene array hybridization, which permits a global view into changes of expression for a large set of genes. The technology has been used recently to identify differences in gene expression between tumors and healthy tissues, aged and young cells, and other systems (17, 18). Perhaps one of the most exciting, and for us relevant, recent studies was the analysis of the response of dermal fibroblasts to the addition of serum (19). The unexpected finding was that fibroblasts initiated the expression of wound-healing response proteins, in addition to the expected, cell cycle regulating proteins. Inspired by these studies, we used gene arrays to identify the UV-regulated genes in human epidermal keratinocytes to gain new insights into the inherent response of keratinocytes to UV. We used primary cultures of human epidermal keratinocytes as the most appropriate

target for UV illumination. We treated cells with UVB, the most important part of the solar spectrum, which penetrates the ozone layer and causes photodamage in humans. We have found that the effects of UV on gene regulation in keratinocytes, although highly specific, are catholic in their breadth, affecting transcription factors and other signaltransducing proteins, cytoskeletal, cell surface, mitochondrial, and RNA-binding proteins as well as the enzymes that provide the raw materials for DNA synthesis. There are three waves of changes in gene expression within the first 24 h after illumination, each with a characteristic set of responses. Significantly, we have identified several categories of UVinduced genes that protect the organism, in addition to the immediate-early genes that protect, presumably, the keratinocytes themselves. These categories include secreted signaling polypeptides, in particular the chemokines of the IL-8 family, and cornified envelope proteins that enhance the protective stratum corneum. MATERIALS AND METHODS Keratinocyte culture and UVB irradiation Cultures of normal epidermal keratinocytes from human foreskin, a generous gift from M. Simon, were initiated by using 3T3 feeder layers as described (20) and were then frozen in liquid N2 until used. Once thawed, the keratinocytes were grown without feeder cells in defined serum-free keratinocyte growth medium, supplemented with 0.05 mg/ml bovine pituitary extract, 5 ng/ml epidermal growth factor, and 1% penicillin/streptomycin (GibcoBRL, Gaithersburg, MD). The keratinocytes were maintained at 37Û& LQ  &22. The medium was replaced every 2 days. The cells were expanded through three passages for the experiments. They were trypsinized with 0.025% trypsin, which was neutralized with 0.5 mg/ml of trypsin inhibitor. We avoided using serum because it can promote keratinocyte differentiation. For all experiments, third-passage keratinocytes were used one day after reaching confluence. For UVB irradiation, we used a Stratagene 2000 illuminator specially equipped with FG15T8 bulbs, which produce maximal output in the UVB range. The medium was removed from the cell cultures, and keratinocytes were irradiated in open dishes with 8 mJ/cm2. Immediately after the UVB treatment, the same medium was replaced on the cultures. Control cells were subjected to the identical procedure but were not irradiated. Isolation of total RNA We harvested cells by scraping, and we used RNeasy kits from Qiagen (Valencia, CA) to prepare the RNA according to the manufacturer’s protocols. Qiashredders were used to homogenize cell extracts with centrifugation at 1,800 g for 2 min. DNA was removed with on-column DNAse digestion by using a Qiagen RNAses-free DNAse Set. Total RNA J  was reverse-transcribed, amplified, and labeled as described (21). Labeled cRNA was hybridized to the HU6800 array from Affymetrix (Santa Clara, CA). Arrays were washed, stained with anti-biotin streptavidin-phycoerythrin labeled antibody, and scanned with the

GeneChip system (Hewlett-Packard, Palo Alto, CA) and GeneChip 3.0 software (Affymetrix) to determine the expression of each gene. Array data analysis Intensity values were scaled by calculating the overall signal for each array type. To eliminate genes that could exhibit false-positive differential expression, we selected only those that possessed a relative signal intensity greater than one standard deviation above average for all genes scored as “absent” in the samples. Differential expression was determined by calculating the ratio between signal intensity values from UV-exposed cells and control cells. Concerned with the reliability and reproducibility of array data, we decided on highly restrictive selection conditions: only genes showing both a 2.5-fold or greater induction or suppression in the UV-treated samples relative to the cognate controls and a twofold or greater regulation in at least two consecutive time points were chosen for further studies. For our data interpretation we used Cluster and Tree View software available at http://rana.stanford.edu/software (22). First, the data were imported into the Cluster and TreeView software in a tab-delimited format. A data set containing the expression patterns of the regulated genes was clustered in two ways, based on the similarity of gene expression over the time course of 24 h and based on the similarity between different time points. The clusters were observed using the TreeView program. Northern blot analyses For Northern blotting, 10 µg RNA was loaded on a 1.0% agarose-formaldehyde gel and run at 100 V for 3–4 h. The RNA was transferred overnight to a nylon membrane (Amersham, Piscataway, NJ) and cross-linked with a standard, UVC Stratalinker. We synthesized the probes for c-fos and IL-6 by using RT-PCR from keratinocyte RNA and a kit from Ambion (Austin, TX). cDNA probes for cytochrome c, elafin, and Cox-2 were amplified with a RTPCR kit (Promega, Madison, WI) by using the following oligonucleotides: ACCATACCCCAACAGTGAGG and TTGTGCCGCTTTATGGTGTA for cytochrome c; AGCAGCTTCTTGATCGTGGT and TCACTGGGGAACGAAACAG for elafin; and GAATGGGGTGATGAGCAGTT and GGTCAATGGAAGCCTGTGAT for Cox-2 (Sigma, St. Louis, MO). We analyzed the amplification products on a 1.2% agarose gel and purified them with a gel extraction kit (Qiagen). We derived additional probes from cDNA clones obtained from American Type Culture Collection (ATCC). Each clone was sequenced from both 5' and 3' ends to confirm its identity. We used EcoRI or NotI and EcoRI to excise the cDNA from the clones with junB (ATCC No. 63025), GRO-α genes (65448), and sprII (3620056). The c-Myc oligonucleotide was from Calbiochem (San Diego, CA), and the GAPDH probe was a gift from T. T. Sun. The 32P labeled probes were generated from these inserts by using [32P]-dCTP (3000 Ci/mmol Dupont NEN, Boston, MA) and the Multiprime DNA labeling system (Amersham) and was purified by using D-Salt Excellulose Plastic Desalting Columns (Pierce, Rockford, IL).

We performed hybridizations by using ExpressHyb solution (Clontech, Palo Alto, CA) at 68Û& IRU  K 0HPEUDQHV ZHUH ZDVKHG ZLWK D × standard sodium citrate (SSC), 0.05% sodium dodecyl sulfate (SDS) solution, with continuous shaking, three times for 30 min at room temperature and with 0.1× SSC, 0.1% SDS at 50Û& IRU  PLQ 7KH PHPEUDQH was exposed to BIOMAX MS film (Kodak, Rochester, NY) at –80Û& 7KH 51$ OHYHOV LQ Northern blots were normalized to GAPDH mRNA. Western blot analyses For preparation of the whole cell lysates, cells were washed with cold phosphate buffered saline (PBS) and lysed in buffer containing 50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 2 mM EDTA; 1% NP-6'6P01D)P0306)JPODSURWLQLQDQGJPO leupeptin. The lysates were centrifuged at 15,000 g, 10 min at 4Û&7KHSURWHLQFRQFHQWUDWLRQ of each sample was determined with Bio-Rad Protein assay reagent. Protein (50 µg) was loaded on 10% or 20% SDS-polyacrylamide gels or Tris-tricine ready-Gel from BioRad (Hercules, CA), transferred to polyvinylidene difluoride membrane (Millipore, Bedford, MA) by using a semidry transfer cell (Bio-Rad), and blocked in 5% bovine serum albumin (BSA) in 50 mM Tris, pH 7.5; 150 mM NaCl; 0.05% Tween 20 (TBST). The membrane was incubated with primary antibody overnight at 4Û&LQ%6$LQ7%67DQGWKHQZDVKHG extensively with TBST, incubated with 1:5,000 dilution of anti-rabbit or anti-mouse HRPconjugated secondary antibodies, and visualized with the ECL detection kit (Amersham). We ascertained the equivalent loading of proteins in each well by using Ponceau staining of the membrane. The primary antibody specific for Cox-2 was purchased from Transduction Labs, for JNK1 from Santa Cruz Biotechnology (Santa Cruz, CA), for GRO-IURP/HLQFR7HFKQRORJLHV6W Louis, MO), for Jun-D from Abcam (Cambridge, U.K.), for c-Myc from Research Diagnostics (Flanders, NJ). The primary antibodies specific for HDJ-2 and involucrin were purchased from NeoMarkers (Fremont, CA). Organ culture explants of normal human skin Pieces of normal human skin were obtained immediately after surgery. They were cut into pieces ~3–5 mm3 and incubated in keratinocyte basal medium (KBM; Gibco-BRL) in a humidified incubator at 37ÛC for 24 h. KBM is a defined medium that does not contain bovine pituitary extract, epidermal growth factor (EGF), insulin, hydrocortisone, or thyroid hormone. Generally, we use 24-well culture dishes with up to five pieces in the same well and just enough medium to cover the explants (24, 25). The explants were mounted in tissue Tec OCT compound (Sakura Finetek, Torrance, CA) and were immediately frozen in liquid nitrogen. Sections, 4- to 6-P-thick, were obtained with a cryostat (Meyer Instruments, Houston, TX), fixed with methanol/acetone for 10 min, and incubated with primary antibody at 4ÛC overnight. The sections were washed with PBS three times and treated with peroxidase-conjugated anti-mouse IgG secondary antibody (Vecstatin ABC-mouse IgG kit from Vector Laboratories, Burlingame, CA), at room temperature for 1 h. The samples were washed again with PBS and incubated with ABC complex (Vector Laboratories) at room temperature for 1 h and treated with 3,3'-diaminobenzidine-tetrahydrochloride (Molecular

Technologies, Gaithersburg, MD) and 0.01% H2O2 as a substrate in Tris, pH 7.6, for 2 min. The samples were observed and photographed under the light microscope (Microphot-FXA, Nikon, Tokyo, Japan). Antibodies used are described above. RESULTS The model We treated primary cultures of human epidermal keratinocytes, the actual target for UV in vivo, with UVB, the part of the UV spectrum that penetrates the ozone layer and causes the most damage in humans. Cultured keratinocytes were grown to confluence and were then incubated in the medium for another 24 h. We chose this protocol for two reasons. First, confluent keratinocytes more closely resemble skin than subconfluent ones; second, we could reliably and reproducibly achieve nearly identical culture conditions from experiment to experiment. We optimized the dose of UV by treating keratinocyte cultures with increasing amounts of radiation, replacing the medium and determining the cell viability 24 h after the treatment. Aiming for the level of irradiation that strongly affects keratinocytes without killing them, we chose a dose of UV that kills at least 10%, but less than 20% of cells (data not shown). Specifically, we used 8 mJ/cm2. We irradiated keratinocyte cultures with a single 8 mJ/cm2 dose of UV and harvested the cells 0.5, 1, 2, 4, 8, 16, and 24 h later. The irradiated cultures were compared with mockirradiated cells harvested 1, 4, 8, 16, and 24 h after the treatment. The 1 h unirradiated culture was used as a control for the 0.5-, 1-, and 2-h time points, while all the later time points had cognate controls. Of the 6,800 genes represented on the chips, some 3,000 were scored as present in keratinocytes in at least one time point, and ~1,400 were present at all time points. Among the entries, 198 were regulated differentially not only at least 2.5-fold in one or more time point, but also at least 2-fold in two or more consecutive time points. Of these, 22 are both induced and suppressed at different time points, the remainder divides approximately equally (83 vs. 93) between the induced and suppressed ones. We focused our attention on the 198 UV regulated genes. The controls The experiments described are very well controlled. To avoid individual variability among different strains of keratinocytes, cells from a single donor were used. To eliminate the variations between batches of media or growth conditions, we grew one distinct, large batch of cells for the array experiments. Furthermore, having noticed that a simple change of medium effects transcriptional changes, we replaced the same medium on the cells after illumination. This way we ensured that the UV illumination is the only relevant difference between the treated and control samples. Concerned with reliability of the array hybridizations, we choose a 7-point postillumination time course, so that the comparisons among the time points serve, inter alia, as a control for reproducibility. The expression of several genes (e.g., keratin K10) changed in both the treated and the control cultures, presumably because keratinocytes tend toward

differentiation when kept confluent in culture. These changes will be described elsewhere. However, because of such changes, we decided to compare the time points with cognate controls and to eliminate the effects of differentiation in culture. With the exception of the first three time points served by the 1 h control, each subsequent time point had its own control sample. When we performed a repeat hybridization of the same sample, the 4-h control, to duplicate chips, not one of the differences fell above the 2.5-fold cut-off. In contrast, the comparison with the 4-h UV-illuminated sample with the control chips identified 55 genes regulated by UV 2.5-fold or more (data not shown). Specific attention was paid to genes represented by multiple probes on the array, such as jun-B, c-Myc, and Cox-2. Although the actual values of “fold regulation” varied, we found very similar patterns of regulation for these multiple probe sets, which gave us further confidence in the fidelity of our hybridizations. Before the RNAs were used for array hybridization, we tested them in Northern blots with the probe corresponding to c-fos, arguably the best-studied immediate-early gene. Because cfos is induced by UV, we used it as a benchmark for UV response. As expected, the appropriate induction of expression of c-fos gene was observed (Fig. 1A). This gave us the confidence to use the RNA samples in array hybridizations. Subsequently, to confirm independently the results from the arrays, we used Northern blots and followed the expression of seven additional regulated genes (Fig. 1B). We found excellent correlation between the array data and the blots for the genes shown. In addition, we established very stringent criteria for considering a gene to be regulated: a minimum of 2.5-fold difference between the treated and control value and, to avoid a spurious positive result, a difference in two consecutive time points of 2-fold or more. The latter criterion ensures that only consistent changes in gene expression are considered, perhaps overlooking the genes that are very briefly regulated or affected at 24 h and later. Three waves of time points Using a clustering algorithm (22), we grouped the seven time points after illumination (Fig. 2). The most closely related were the 0.5-, 1-, and 2-h time points, forming the early “wave” of regulated genes. Also very similar were the 16- and 24-h time points, forming the late wave. The 4- and 8-h time points were more similar to each other than to the other time points. Thus, the modification in the gene expression in the first 24 h after UV illumination can conveniently be grouped into three waves of changes: early, 0.5 to 2 h; intermediate, 4 to 8 h; and late, 16 to 24 h. Regulated genes: proteins involved in DNA protection and repair Most of the regulated genes can be grouped by their function into several distinct and clearly demarcated functional categories (Table 1). One of the most serious effects of UV is the mutagenesis caused by the damage to DNA. In mammalian cells, different DNA damaging agents activate different repair processes

(reviewed in ref 23). UV-caused DNA lesions are restored primarily by NER, the nucleotide excision repair system (24). UV induced the expression of ERCC4, the DNA binding component of the endonuclease that incises 5' from thymidine dimers (24). Several other repair enzymes are present in keratinocytes but are not induced further by UV. These enzymes include ERCC1 and hmlh1, as well as xeroderma pigmentosum proteins XP-C, XPG, XP-E, and XRCC1. UV does induce the expression of several enzymes that produce building blocks for DNA synthesis, namely, nucleoside-diphosphate kinase and Spermidine/spermine N1-acetyltransferase (Table 1, 1–24). Similarly, UV induced the expression of histones H2A.2, H2B.1, H2A.X, H1x, and H2A.Z, which may play a role in protecting nascent repaired DNA from damage. It appears that most of the DNA repair proteins are present in sufficient amounts in keratinocytes even before the UV treatment, but that the cells, apparently sensing the need for extensive repair, produce more of the dNTPs and histones to build and protect the newly repaired DNA. The machinery for DNA repair is already in place, but the nuts-and-bolts need to be supplemented. UV damage is partly indirect, through generation of reactive oxygen species (25); consequently, UV induced several antioxidant defense proteins as well. Specifically, metallothionein, a copper transport protein and a thiol-specific antioxidant proteins are induced (26). UV regulated the expression of DNA-damage-inducible proteins gadd45, cyclin G1, and BTG2. These proteins play a role in the cell cycle arrest that allows keratinocytes to repair their DNA, as do several growth-controlling oncogenes (27–29). As expected, the regulation of these proteins is often complex. For example, cyclin G1 expression is suppressed at 4 h and 8 h but is induced at 24 h after illumination. Presumably, these proteins coordinate DNA repair with the cell cycle. Signal transducers and transcription factors In keratinocytes, signal transducers and transcription factors have complex patterns of regulation by UV, reflecting the variety of processes affected by UV illumination (Table 1, 25–97). UV categorically belongs to the extracellular influences that activate the immediate early genes, which, presumably, repair and protect the cells from the harmful effects of UV. Among these are several transcription factors, such as junB, junD, c-fos, ETR101, EGR1, HRY, and XBP-1. Their induction is short-lived, and by 4 h most and by 16 h all are either expressed at background levels—or even suppressed. It will be interesting to determine their individual roles in UV-mediated changes of gene expression. In addition, UV at early time points prominently induces tafII30, a TATA-box binding protein associated factor, and later a component of RNA pol II, RPB10, perhaps priming the cells for enhanced transcription. Most intracellular signaling processes involve protein phosphorylation, and therefore it is not surprising that kinases and phosphatases are well represented among the regulated genes. UV induces three RING3 family proteins; while suppressing kinases A-Raf, casein kinases CKI.DQG&.,,-.DQG(5.$OVRVXSSUHVVHGDUHWKHSKRVSKDWDVHV33$-&.DQG3389DOVR regulates a dozen of the small GTP binding proteins and their associated factors.

The major signal-transducing mechanism conveying directly the effects of UV illumination to the nucleus uses JNK and JNK-phosphorylated transcription factors, members of the AP1 family (6, 7, 30). Paradoxically, UV induces CL100, a dual specificity phosphatase that attenuates the JNK pathway (31). The AP1 proteins, activated and induced by UV, in turn induce the matrix metalloproteases thought to be partly responsible for the sun damage in humans (32, 33). UV causes strong and persistent suppression of c-Myc. This finding is consistent with the role of c-Myc in deregulating cell growth, promoting genomic instability, sensitizing to apoptosis, and inhibiting expression of DNA damage-induced growth-arrest proteins (34– 36). Epidermis-targeted overexpression of c-Myc causes extensive and benign but premalignant epidermal proliferation, which could be very dangerous in the context of UVinduced DNA damage (37–39). Several cell surface receptors and their associated proteins are suppressed by UV. UV also suppresses immunophilins, a rapamycin-sensitive pathway protein, and heat shock protein hsp40. These results are concordant with the hypothesis that the illuminated cells make an effort to shut out additional extracellular signals until the UV-caused problems are dealt with. In contrast, ligands to various receptors, growth factors, and cytokines are induced 4 h and 8 h after illumination (see below). UV suppresses many transcription factors, including ets-2, BTEB2, SRF, TGIF, HLH-1R21, AREB6, AP2, and others. It is unclear at present what role these transcription factors play in healthy, unirradiated keratinocytes, but apparently, they may be unnecessary or even harmful in irradiated ones. Secreted signaling proteins, chemokines, cytokines, and growth factors In the intermediate wave, the most prominently induced genes are the secreted proteins chemokines, cytokines, and growth factors (Table 1, 98–111). The secreted peptides serve to alert the surrounding tissue that damage has occurred. The effects are paracrine, activating melanocytes, endothelial cells, neutrophils, and fibroblasts, as well as autocrine, activating neighboring keratinocytes. In particular, five members of the IL-8 family are induced: IL-8, Gro-. *UR- 0'&1) DQG 0,3-    7KHVH FKHPRNLQHV DUH FKHPRWDFWLc and activating for neutrophils, basophils, and macrophages, and presumably they play a role inviting inflammatory cells into UV-damaged tissue (40–42). Also, they activate melanocytes, which may initiate tanning in response to UV (43). Thus, we believe that keratinocytes serve as specific sentinels for UV and that the induction of these secreted proteins alerts the organism that UV has been detected. This response seems to be a specific function of UV-illuminated keratinocytes. Several of the UV induced genes, including IL-8, have been shown previously to be inducible by interferon- 7KHLQWHUIHURQ-UHVSRQVLYHJHQHVDUHLQGXFHGDWODWHUWLPH points after illumination and include p27, 17-kDa/15-kDa protein, IRF 7A, 1-8D gene, hPA28-DQGLQWHUIeron-UHFHSWRUDFFHVVRU\IDFWRU-1 (Table 1, 176–180). All are induced at

fairly high levels. It is unknown at present whether their induction is a direct effect of UV, or an indirect, autocrine effect of a UV-induced, secreted molecule. Keratinocytes do not produce interferon- EXW WKH\ GR UHVSRQG WR LW LQGXFLQJ inter alia expression of K17, the keratin found in contractile epithelia (45). These results point to a hitherto undescribed nexus between UV and interferon- VLJQDOLQJ3HUKDSVWKHQ89SDUWO\Whrough this pathway that overlaps the interferon-DFWLYDWHGRQHDOVRPDNHVNHUDWLQRF\WHVPRUHFRQWUDFWLOH 7KLV conclusion is consistent with the changes in expression of cytoskeletal proteins described below. Cornified envelope proteins The genes most strongly induced by UV are keratinocyte differentiation markers, components of the cornified envelope (Table 1, 112-119). These include calgranulin, elafin, involucrin, S100 calcium-binding protein A13, and four of the small proline-rich proteins. Only the small proline-rich proteins have been shown previously to be inducible by UV (47). Among the epidermal differentiation markers, only the cornified envelope components are induced, keratins and filaggrin are not. The induced cornified envelope proteins are all encoded in the epidermal marker locus on human chromosome 1. They are induced at later time points, 16 and 24 h after illumination. Apparently, one of the epidermal responses to UV is enhancement of stratum corneum production; that is, augmentation of the cornified, dead, protective layer of skin. Structural proteins Among the structural proteins regulated by UV desmosomal components and cytoskeletal proteins, such as actin-binding proteins (ABPs) are prominent (Table 1, 120–142). Particularly interesting is the suppression of the desmosomal proteins. Because the function of desmosomes is to keep cells firmly attached to one another, the reduction in desmosomal proteins may facilitate the movement of keratinocytes, assembly of the cornified envelope proteins, and formation of the stratum corneum. Actin affects the shape of the plasma membrane, allows cellular motility, and maintains cell shape and polarity. To accomplish these tasks, actin interacts with ~60 different ABPs. Though their functions may seem redundant, the various ABPs work cooperatively or competitively with one another to effect cytoskeletal changes (48). Troponin, an ABP induced early by UVB illumination, is one of the proteins that causes the shortening of muscle fibers in muscle cells (49). In contrast, UV suppresses early the gene encoding VSHFWULQ -spectrin provides rigidity and stability to the cell membrane by controlling the distribution of integral membrane proteins and binding actin filaments to hold them in place (50). ABP genes induced at the later time points include MacMARCKS, myosin light chain, Arp 2/3, tropomyosin, and thymosin. These proteins enhance actin polymerization, cross-link actin filaments to other proteins, or both, thus stabilizing and strengthening the microfilament cytoskeleton (48). For example, tropomyosin binds along the length of actin filaments, increasing their strength and changing their affinity for other proteins, whereas thymosin binds to actin monomers, inhibits actin polymerization, and may play a role in preventing apoptosis (51).

The overall picture of the regulation of the cytoskeletal proteins by UV shows an initial depolymerization, relaxing of the actin cytoskeleton in the first 2 h, which is followed by a repolymerization of the actin filaments and reconstitution of the cytoskeletal network. Energy procurement Among the most strongly induced genes immediately after UV illumination are several mitochondrial proteins (Table 1, 143–165). Specifically, cytochrome c-1, cytochrome c oxidase subunit VIIb, and cytochrome b light chain are induced early after the illumination. Several other mitochondrial proteins are also strongly induced. These include mitochondrial NADH dehydrogenase, mitochondrial ATP synthase, a mitochondrial ribosomal protein, nucleoside-diphosphate kinase, and an electron transfer flavoprotein. We hypothesize that cells, on illumination, require additional energy and induce mitochondrial proteins to address this need. An additional indication that UV illumination leads to a requirement for additional energy comes from the fact WKDW89LQGXFHVVHYHUDORIWKHHQHUJ\SURGXFLQJHQ]\PHVLQFOXGLQJ.enolase. Conversely, many energy-requiring processes are shut down (Table 1, 150–165). For example, transporters as well as gluconeogenic and lipogenic enzymes, such as fructose1,6-biphosphatase, phosphoenolpyruvate carboxykinase, acyl-coenzyme A synthetase, and stearoyl-coenzyme-A desaturase, are all suppressed. Strong inhibition of lipid neogenesis seems inconsistent with the induction of the cornified envelope proteins because both the lipid and the proteinaceous components contribute to the formation of stratum corneum. However, this induction may be important for saving the energy of the UV-damaged cell. The response of keratinocyte mitochondrial genes to UV is quite different from the response of the mitochondrial genes in lymphoma cells to ionizing radiation (52). Comparing two cell lines that differ only in their responses to ionizing radiation, Voehringer et al. found that the resistant cell line expressed high levels of mitochondrial proteins fructose-1,6-biphosphatase, VDAC, fatty acid binding proteins, and uncoupling proteins. These findings are increased even further by the ionizing radiation treatment. Although these proteins seem to protect the resistant cells from apoptosis, the sensitive cells lacking them are not protected and they die. Our results show that most of these proteins do not change significantly in response to UV in keratinocytes. Based on the UV dose, the keratinocytes either survive or apoptose. Increasing these proteins would predispose them to survive, potentially a dangerous response in UVirradiated skin. The changes in mitochondrial proteins are very important in epidermal response to UV and probably have several functions. These include a burst of respiration proteins to provide additional energy needed to alleviate the UV-caused damage and an increase of enzymes that remove reactive oxygen species as a detoxifying process. In addition, given the mitochondrial role in controlling apoptosis, irradiated keratinocytes may prepare their mitochondria to initiate apoptosis.

RNA processing Control of mRNA stability is an important alternative to transcriptional regulation by UV (53). For example, UV can induce elastin, p21Waf, and TNF-.V\QWKHVLVE\VWDELOL]LQJWKHLU mRNA in adult skin (54, 55). The molecular mechanisms involved have not yet been defined. In this context, we note that UV regulates an unexpectedly high number of RNA processing proteins (Table 1, 166–175). Whether these play a role in mRNA stability remains to be explored. Genes not regulated transcriptionally Perhaps as interesting as the regulated genes are the genes we found not to be regulated by UV in our experiments. For example, p53, a DNA damage-sensitive regulator of the cell cycle (56), is not among the regulated genes; UV primarily effects its stabilization through phosphorylation, leaving the mRNA levels unchanged during the course of our experiments. Most cell cycle proteins, notably cyclin D1, are not regulated, and the exceptions are cyclin G1 and G0S. Similarly, most of the well-characterized members of the Bcl family, regulators of apoptosis, were also regulated. It is perhaps surprising that more dramatic changes in cell cycle and apoptosis proteins were not seen. We suspect that these changes may occur at later times, when the extent of the damage and the possibility of its repair are fully assessed. Similarly, extracellular matrix proteins, such as elastin, and the metalloproteases that degrade them were not induced in the time period we studied. Two mechanisms have been reported to increase their expression, initiation of transcription, and stabilization of mRNA (33, 57). The transcription factors necessary for their induction, and RNA processing proteins that might stabilize their mRNAs, are induced by UV treatment. However, their effects may not be fully manifested in the first 24 h. The changes in mRNA levels reflect the changes in protein levels, both in vitro and in vivo Although the array hybridizations measure changes mRNA levels, it is the changes in protein levels that are important to cells. We used two approaches to assess the changes in protein levels for a subset of regulated entries. In the first we used Western blots of protein extracts from UV-treated cells and found a very good correlation between the proteins and the mRNA levels. For example, c-Myc protein and mRNA levels are reduced in parallel (comparing Figs. 1 and 3). Similarly, Western blots show induction of, for example, involucrin, cyclooxygenase-2, and Gro-DVH[SHFWHGIURPWKHDUUD\GDWDFig. 3). The second approach used a new and elegant human skin organ culture model (58, 59). The major benefit of this system is the fact that it comprises the whole skin, in contrast to monocultures of keratinocytes, the source of array samples. The response of cultured keratinocytes to UV may be influenced, at least in part, by the culture conditions. In fact, cultured keratinocytes resemble more the activated, wound-healing phenotype than the healthy, differentiating phenotypes. However, organ culture of human skin, with keratinocytes in a multilayered structure atop a basement membrane and a fibroblast-

containing dermis with palisaded basal cells and a stratum corneum, closely approximates the in vivo setting. We were particularly intrigued by the induction of involucrin synthesis by UV because involucrin is one of the criterion markers of epidermal differentiation not hitherto associated with UV response (60, 61). To determine whether the changes in involucrin gene expression observed in the arrays also occur in human skin in vivo, we irradiated skin biopsies with 100 mJ/cm2 of UV and placed them in culture medium. After appropriate periods we removed the samples and sectioned and stained them with an antibody specific for involucrin. As shown in Figure 4, all skin samples contain involucrin in the suprabasal, differentiating layers. However, the UV illumination greatly increases the intensity of staining, thus demonstrating that the induction of involucrin by UV occurs in human skin in vivo as well (Fig. 4). Therefore, the data obtained by using UV treated cultures of human epidermal keratinocytes directly correlate with the behavior of human skin in vivo after exposure to sunlight. DISCUSSION The use of arrays to analyze the global changes of gene expression in epidermal keratinocytes in response to UVB irradiation allowed us to observe how the skin responds to this damaging agent. Some of the responses have been expected because some of the responding proteins were shown to be regulated by UV. Others were unexpected and provide fresh insights in the protective role of epidermis. Perhaps the most significant new finding of our work is the identification of a large number of UV-induced genes that protect the organism. These include the cornified envelope proteins and secreted signaling polypeptides, in particular the chemokines of the IL-8 family, as well as the stress-response immediateearly genes that protect, presumably, the keratinocytes themselves. The most dramatic changes immediately after UV are those inducing new signaling molecules, kinases, phosphatases, proteases, RNA processing enzymes, and transcription factors while shutting others down. The cell, when exposed to UV, changes its physiology: It stops doing many of the things it has been doing and turns its attention to responding to the stimulus. Subsequently, the cells, having “taken care” of their immediate needs, alert the surrounding tissue. At this time, the cells produce, and presumably secrete, chemokines, cytokines, and growth factors. These will activate melanocytes, which stimulate tanning, as well as the inflammatory response, which causes erythema. The secreted factors also have an autocrine effect on surrounding keratinocytes to cause their activation and an amplification of the epidermal response to UV. Still later, the cells induce expression of terminal differentiation markers, components of the cornified envelope. This function may have several beneficial effects. Enhanced cornification would provide additional protection to skin. It would eventually enhance the proliferation of keratinocytes in order to restore epidermal homeostasis. In addition, terminal differentiation has many biochemical parallels to apoptosis: cells that differentiate cannot proliferate. This

terminal differentiation may be a way to eliminate those keratinocytes that, having been damaged by UV, may have received an oncogenic mutation. The illuminated cells, requiring additional energy, induce expression of mitochondrial components, of glycolysis and lipid degradation. The role of mitochondria in the UV response is particularly intriguing because of the apoptotic signals that stem from the mitochondria. One of the effects of UV irradiation in epidermis is the appearance of “sunburn cells”, which have many features of apoptotic cells (62–64). In the time frame we studied and with the doses of UV we used, cell death is very limited and no apoptosis proteins are induced. We hypothesize that the cell is “assessing” the damage: it will try to recover by repairing the DNA, producing extra energy; but if this task proves impossible, the apoptotic program will begin. Transcription factors responsive to UV light include c-Jun (AP1), p53, and NF-κB. We find many of the known AP1 targets (e.g., SPRRs and involucrin), NF-κB targets (e.g., the IL-8 family), and p53 targets (e.g., GADD45) to be regulated by UV. However, some of the expected targets (e.g., matrix metalloproteases, TNF-.DQGS VHHPQRWWo be. The expression profiling results presented here integrate a large set of disparate findings into a congruent and comprehensive picture. For example, some of the cornified envelope proteins were known to be UV-induced, but others were not (47); here we show that it is a general phenomenon. Both interferon- DQG 89 FDQ DFWLYDWH VRPH RI WKH 67$7 SURWHLQV although by different mechanisms (65); here we show that interferon- DQG 89 DFWLYDWH D common set of genes. IL-8 was known to be induced by UV (66), and here we show five members of the IL-8 family that are induced by UV. Mitochondrial role in apoptosis in response to the genotoxic stress is well established; here we add energy production into the picture. In summary, when responding to UV, human epidermal keratinocytes commence DNA repair, change their transcription factors and other signal transducing proteins, alert the surrounding tissue to the damage, procure more energy, modify their cytoskeleton, and enhance the protective cornified layer of skin. ACKNOWLEDGMENTS We were supported by the funds from Anaderm Research Corp. Inc. We thank Marcia Simon for the generous gift of keratinocytes. We also thank T. T. Sun and M. Tomic-Canic and members of our group for comments, ideas, and encouragement. REFERENCES 1. Gilchrest, B. (1995) Photodamage. Blackwell Scientific: New York 2. Herrlich, P., Sachsenmaier, C., Radler-Pohl, A., Gebel, S., Blattner, C., and Rahmsdorf, H. J. (1994) The mammalian UV response: mechanism of DNA damage induced gene expression. Adv. Enzyme Reg. 34, 381–395

3. Ullrich, A., and Schlessinger, J. (1990) Signal transduction by receptors with tyrosine kinase activity. Cell 61, 203–212 4. Beissert, S., and Schwarz, T. (1999) Mechanisms involved in ultraviolet light-induced immunosuppression. J. Investig. Dermatol. Symp. Proc. 4, 61–64 5. Zhuang, L., Wang, B., and Sauder, D. N. (2000) Molecular mechanism of ultraviolet-induced keratinocyte apoptosis. J. Interferon. Cytokine Res. 20, 445–454 6. Assefa, Z., Garmyn, M., Bouillon, R., Merlevede, W., Vandenheede, J. R., and Agostinis, P. (1997) Differential stimulation of ERK and JNK activities by ultraviolet B irradiation and epidermal growth factor in human keratinocytes. J. Invest. Dermatol. 108, 886–891 7. Dérijard, B., Hibi, M., Wu, I. H., Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R. J. (1994) JNK1: A protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 1025–1037 8. Kyriakis, J. M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E. A., Ahmad, M. F., Avruch, J., and Woodgett, J. R. (1994) The stress-activated protein kinase subfamily of c-Jun kinases. Nature (London) 369, 156–160 9. Kallunki, T., Deng, T., Hibi, M., and Karin, M. (1996) c-Jun can recruit JNK to phosphorylate dimerization partners via specific docking interactions. Cell 87, 929–939 10. Cavigelli, M., Li, W. W., Lin, A., Su, B., Yoshioka, K., and Karin, M. (1996) The tumor promoter arsenite stimulates AP-1 activity by inhibiting a JNK phosphatase. EMBO J. 15, 6269–6279 11. Rosette, C., and Karin, M. (1996) Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science 274, 1194–1197 12. Fanger, G. R., Gerwins, P., Widmann, C., Jarpe, M. B., and Johnson, G. L. (1997) MEKKs, GCKs, MLKs, PAKs, TAKs, and tpls: upstream regulators of the c-Jun amino-terminal kinases? Curr. Opin. Genet. Dev. 7, 67–74 13. Devary, Y., Rosette, C., DiDonato, J. A., and Karin, M. (1993) NF-κB activation by ultraviolet light not dependent on a nuclear signal. Science 261, 1442–1445 14. Simon, M. M., Aragane, Y., Schwarz, A., Luger, T. A., and Schwarz, T. (1994) UVB light induces nuclear factor κB activity independently from chromosomal DNA damage in cellfree cytosolic extracts. J. Invest. Derm. 102, 422–427 15. Barnes, P. J., and Karin, M. (1997) Nuclear factor-κB: a pivotal transcription factor in chronic inflammatory diseases. New Engl. J. Med. 336, 1066–1071

16. Li, N., and Karin, M. (1998) Ionizing radiation and short wavelength UV activate NF-κB through two distinct mechanisms. Proc. Natl. Acad. Sci. USA 95, 13012–13017 17. Scherf, U., Ross, D. T., Waltham, M., Smith, L. H., Lee, J. K., Tanabe, L., Kohn, K. W., Reinhold, W. C., Myers, T. G., Andrews, D. T., Scudiero, D. A., Eisen, M. B., Sausville, E. A., Pommier, Y., Botstein, D., Brown, P. O., and Weinstein, J. N. (2000) A gene expression database for the molecular pharmacology of cancer. Nat. Genet. 24, 236–244 18. Lee, C. K., Klopp, R. G., Weindruch, R., and Prolla, T. A. (1999) Gene expression profile of aging and its retardation by caloric restriction. Science 285, 1390–1393 19. Iyer, V., Eisen, M. B., Ross, D. T., Schuler, G., Moore, T., Lee, J.C.F., Trent, J. M., Staudt, L. M., Hudson Jr., J., Bogulski, M. S., Lashkari, D., Shalon, D., Botstein, D., and Brown, P. O. (1998) The transcriptional program in the response of human fibroblasts to serum. Science 283, 17–18 20. Simon, M., and Green, H. (1984) Participation of membrane-associated proteins in the formation of the cross-linked envelope of the keratinocyte. Cell 36, 827–834 21. Mahadevappa, M., and Warrington, J. A. (1999) A high-density probe array sample preparation method using 10- to 100-fold fewer cells. Nat. Biotechnol. 17, 1134–1136 22. Eisen, M. B., Spellman, P. T., Brown, P. O., and Botstein, D. (1998) Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95, 14863–14868 23. Wang, J. Y. (1998) Cellular responses to DNA damage. Curr. Opin. Cell Biol. 10, 240–247 24. Batty, D. P., and Wood, R. D. (2000) Damage recognition in nucleotide excision repair of DNA. Gene 241, 193–204 25. Scharffetter-Kochanek, K., Wlaschek, M., Brenneisen, P., Schauen, M., Blaudschun, R., and Wenk, J. (1997) UV-induced reactive oxygen species in photocarcinogenesis and photoaging. Biol. Chem. 378, 1247–1257 26. Hanada, K., Sawamura, D., Tamai, K., Baba, T., Hashimoto, I., Muramatsu, T., Miura, N., and Naganuma, A. (1998) Novel function of metallothionein in photoprotection: metallothionein-null mouse exhibits reduced tolerance against ultraviolet B injury in the skin. J. Invest. Dermatol. 111, 582–585 27. Jin, S., Antinore, M. J., Lung, F. D., Dong, X., Zhao, H., Fan, F., Colchagie, A. B., Blanck, P., Roller, P. P., Fornace, A. J., and Zhan, Q. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J. Biol. Chem. 275, 16602–16608 28. Cortes, U., Moyret-Lalle, C., Falette, N., Duriez, C., Ghissassi, F. E., Barnas, C., Morel, A. P., Hainaut, P., Magaud, J. P., and Puisieux, A. (2000) BTG gene expression in the p53dependent and -independent cellular response to DNA damage. Mol. Carcinogen. 27, 57–64

29. Alhonen, L., Karppinen, A., Uusi-Oukari, M., Vujcic, S., Korhonen, V. P., Halmekyto, M., Kramer, D. L., Hines, R., Janne, J., and Porter, C. W. (1998) Correlation of polyamine and growth responses to N1,N11-diethylnorspermine in primary fetal fibroblasts derived from transgenic mice overexpressing spermidine/spermine N1-acetyltransferase. J. Biol. Chem. 273, 1964–1969 30. Garmyn, M., Degreef, H., and Gilchrest, B. A. (1995) The effect of acute and chronic photodamage on gene expression in human keratinocytes. Dermatology 190, 305–308 31. Hirsch, D. D., and Stork, P. J. (1997) Mitogen-activated protein kinase phosphatases inactivate stress-activated protein kinase pathways in vivo. J. Biol. Chem. 272, 4568–4575 32. Fisher, G. J., Datta, S. C., Talwar, H. S., Wang, Z. Q., Varani, J., Kang, S., and Voorhees, J. J. (1996) Molecular basis of sun-induced premature skin ageing and retinoid antagonism. Nature (London) 379, 335–339 33. Fisher, G. J., Talwar, H. S., Lin, J., Lin, P., McPhillips, F., Wang, Z., Li, X., Wan, Y., Kang, S., and Voorhees, J. J. (1998) Retinoic acid inhibits induction of c-Jun protein by ultraviolet radiation that occurs subsequent to activation of mitogen-activated protein kinase pathways in human skin in vivo. J. Clin. Invest. 101, 1432–1440 34. Amundson, S. A., Zhan, Q., Penn, L. Z., and Fornace, A. J. (1998) Myc suppresses induction of the growth arrest genes gadd34, gadd45, and gadd153 by DNA-damaging agents. Oncogene 17, 2149–2154 35. Felsher, D. W., and Bishop, J. M. (1999) Transient excess of MYC activity can elicit genomic instability and tumorigenesis. Proc. Natl. Acad. Sci. USA 96, 3940–3944 36. Pelengaris, S., Rudolph, B., and Littlewood, T. (2000) Action of Myc in vivo—proliferation and apoptosis. Curr. Opin. Genet. Dev. 10, 100–105 37. Pelengaris, S., Littlewood, T., Khan, M., Elia, G., and Evan, G. (1999) Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol. Cell 3, 565–577 38. Gandarillas, A., and Watt, F. M. (1997) c-Myc promotes differentiation of human epidermal stem cells. Genes Dev. 11, 2869–2882 39. Waikel, R. L., Wang, X. J., and Roop, D. R. (1999) Targeted expression of c-Myc in the epidermis alters normal proliferation, differentiation, and UV-B induced apoptosis. Oncogene 18, 4870–4878 40. Geiser, T., Dewald, B., Ehrengruber, M. U., Clark-Lewis, I., and Baggiolini, M. (1993) The interleukin-8-related chemotactic cytokines GRO alpha, GRO beta, and GRO gamma activate human neutrophil and basophil leukocytes. J. Biol. Chem. 268, 15419–15424

41. Kemeny, L., Kenderessy, A. S., Ocsovszky, I., Michel, G., Ruzicka, T., and Dobozy, A. (1995) Interleukin-8 induces HLA-DR expression on cultured human keratinocytes via specific receptors. Int. Arch. Allergy Immunol. 106, 351–356 42. Fujisawa, H., Wang, B., Sauder, D. N., and Kondo, S. (1997) Effects of interferons on the production of interleukin-6 and interleukin-8 in human keratinocytes. J. Interferon Cytokine Res. 17, 347–353 43. Moser, B., Barella, L., Mattei, S., Schumacher, C., Boulay, F., Colombo, M. P., and Baggiolini, M. (1993) Expression of transcripts for two interleukin 8 receptors in human phagocytes, lymphocytes and melanoma cells. Biochem. J. 294, 285–292 44. Aragane, Y., Kulms, D., Luger, T. A., and Schwarz, T. (1997) Down-regulation of interferon gamma-activated STAT1 by UV light. Proc. Natl. Acad. Sci. USA 94, 11490–11495 45. Jiang, C. K., Flanagan, S., Ohtsuki, M., Shuai, K., Freedberg, I. M., and Blumenberg, M. (1994) Disease-activated transcription factor: allergic reactions in human skin cause nuclear transcription of STAT-91 and induce synthesis of keratin K17. Mol. Cell. Biol. 14, 4759– 4769 46. Freedberg I. M., Tomic-Canic M., Komine M. and Blumenberg M. (2001) Keratins and the keratinocyte activation cycle. J. Invest. Dermatol. 116, 330–338 47. Kartasova, T., and van de Putte, P. (1988) Isolation, characterization, and UV-stimulated expression of two families of genes encoding polypeptides of related structure in human epidermal keratinocytes. Mol. Cell Biol. 8, 2195–2203 48. Kreis, T., and Vale, R. (1999) Guidebook to the Cytskeletal and Motor Proteins, Oxford University Press: New York 49. Gordon, A. M., Homsher, E., and Regnier, M. (2000) Regulation of contraction in striated muscle. Physiol. Rev. 80, 853–924 50. De Matteis, M. A., and Morrow, J. S. (2000) Spectrin tethers and mesh in the biosynthetic pathway. J. Cell. Sci. 113, 2331–2343 51. Niu, M., and Nachmias, V. T. (2000) Increased resistance to apoptosis in cells overexpressing thymosin beta four: A role for focal adhesion kinase pp125FAK. Cell Adhes. Commun. 7, 311–320 52. Voehringer, D. W., Hirschberg, D. L., Xiao, J., Lu, Q., Roederer, M., Lock, C. B., Herzenberg, L. A., and Steinman, L. (2000) Gene microarray identification of redox and mitochondrial elements that control resistance or sensitivity to apoptosis. Proc. Natl. Acad. Sci. USA 97, 2680–2685

53. Mitchell, P., and Tollervey, D. (2000) mRNA stability in eukaryotes. Curr. Opin. Genet. Dev. 10, 193–198 54. Gorospe, M., Wang, X., and Holbrook, N. J. (1998) p53-dependent elevation of p21Waf1 expression by UV light is mediated through mRNA stabilization and involves a vanadatesensitive regulatory system. Mol. Cell Biol. 18, 1400–1407 55. Leverkus, M., Yaar, M., Eller, M. S., Tang, E. H., and Gilchrest, B. A. (1998) Posttranscriptional regulation of UV induced TNF-alpha expression. J. Invest. Dermatol. 110, 353–357 56. Caspari, T. (2000) How to activate p53. Curr. Biol. 10, R315–317 57. Zhang, M., Pierce, R. A., Wachi, H., Mecham, R. P., and Parks, W. C. (1999) An open reading frame element mediates posttranscriptional regulation of tropoelastin and responsiveness to transforming growth factor beta1. Mol. Cell Biol. 19, 7314–7326 58. Varani, J., Fligiel, S. E., Schuger, L., Perone, P., Inman, D., Griffiths, C. E., and Voorhees, J. J. (1993) Effects of all-trans retinoic acid and Ca++ on human skin in organ culture. Am. J. Pathol. 142, 189–198 59. Komine, M., Rao, L. S., Kaneko, T., Tomic-Canic, M., Tamaki, K., Freedberg, I. M., and Blumenberg, M. (2000) Inflammatory versus proliferative processes in epidermis. tumor necrosis factor alpha induces K6b keratin synthesis through a transcriptional complex containing NFkappa B AND C/EBPbeta. J. Biol. Chem. 275, 32077–32088 60. Adams, J. C., and Watt, F. M. (1989) Fibronectin inhibits the terminal differentiation of human keratinocytes. Nature (London) 340, 307–309 61. Efimova, T., LaCelle, P., Welter, J. F., and Eckert, R. L. (1998) Regulation of human involucrin promoter activity by a protein kinase C, Ras, MEKK1, MEK3, p38/RK, AP1 signal transduction pathway. J. Biol. Chem. 273, 24387–24395 62. Bernerd, F., Sarasin, A., and Magnaldo, T. (1999) Galectin-7 overexpression is associated with the apoptotic process in UVB-induced sunburn keratinocytes. Proc. Natl. Acad. Sci. USA 96, 11329–11334 63. Hill, L. L., Ouhtit, A., Loughlin, S. M., Kripke, M. L., Ananthaswamy, H. N., and OwenSchaub, L. B. (1999) Fas ligand: a sensor for DNA damage critical in skin cancer etiology. Science 285, 898–900 64. Aragane, Y., Kulms, D., Metze, D., Wilkes, G., Poppelmann, B., Luger, T. A., and Schwarz, T. (1998) Ultraviolet light induces apoptosis via direct activation of CD95 (Fas/APO-1) independently of its ligand CD95L. J. Cell Biol. 140, 171–182

65. Shen, Y., Devgan, G., Darnell, J. E., and Bromberg, J. F. (2001) Constitutively activated Stat3 protects fibroblasts from serum withdrawal and UV-induced apoptosis and antagonizes the proapoptotic effects of activated Stat1. Proc. Natl. Acad. Sci. USA 98, 1543–1548 66. Kennedy, M., Kim, K. H., Harten, B., Brown, J., Planck, S., Meshul, C., Edelhauser, H., Rosenbaum, J. T., Armstrong, C. A., and Ansel, J. C. (1997) Ultraviolet irradiation induces the production of multiple cytokines by human corneal cells. Invest. Ophthalmol. Vis. Sci. 38, 2483–2491 Received April 4, 2001; revised July 23, 2001.

Table 1

Table 1. UV-regulated genes in human epidermal keratinocytes. The second column lists the accession numbers of the entries. The third and fourth columns contain the function and description of each regulated gene. On the right, the fold regulations at the indicated time points are given. The yellow and tan fields mark the 2.0–2.5- and >2.5-fold induced values, respectively, whereas the green and blue fields mark the 2.0–2.5- and >2.5-fold suppressed values, respectively.

Table 1 (cont)

UV-regulated genes in human epidermal keratinocytes. The second column lists the accession numbers of the entries. The third and fourth columns contain the function and description of each regulated gene. On the right, the fold regulations at the indicated time points are given. The yellow and tan fields mark the 2.0–2.5- and >2.5-fold induced values, respectively, whereas the green and blue fields mark the 2.0–2.5- and >2.5-fold suppressed values, respectively.

Table 1 (cont)

UV-regulated genes in human epidermal keratinocytes. The second column lists the accession numbers of the entries. The third and fourth columns contain the function and description of each regulated gene. On the right, the fold regulations at the indicated time points are given. The yellow and tan fields mark the 2.0–2.5- and >2.5-fold induced values, respectively, whereas the green and blue fields mark the 2.0–2.5- and >2.5-fold suppressed values, respectively.

Fig. 1

Figure 1. Northern blots of UV-regulated genes. A) The RNAs used to prepare samples for the array hybridizations were first tested with the c-fos probe in Northern blots. The GAPDH probe was used as a control of loading the gel. Note that the 1-h untreated sample was used as a control for the 0.50-, 1-, and 2-h treated samples. B) Hybridization of 7 UVregulated probes. The Northern blots closely, but not perfectly, correlate with the results obtained by using arrays. The GAPDH probe was used as a control.

Fig. 2

Figure 2. Three waves of regulated events. The clustering algorithm was used to group the time points. The heights of the branches represent the relative similarities of the time points. Green and red rectangles stand for suppressed and induced values for individual genes, respectively. Only a small portion of the genes analyzed is presented in the figure. For a table of all regulated genes, please see the Supplement.

Fig. 3

Figure 3. The changes in protein levels parallel the changes in mRNA levels. Western blots of protein extracts prepared from irradiated keratinocytes harvested at indicated times after illumination. Antibody recognizing JNK1 was used as a loading control in a parallel gel.

Fig. 4

Figure 4. UV illumination enhances the expression of involucrin in human skin organ culture. Note the suprabasal staining of the epidermis with the involucrin antibody, which is greatly augmented 16 h after illumination.