The transmembrane region of Gurken is not ... - Semantic Scholar

Mechanisms of Development 89 (1999) 35±42 www.elsevier.com/locate/modo

The transmembrane region of Gurken is not required for biological activity, but is necessary for transport to the oocyte membrane in Drosophila Anne Marie Queenan, Gail Barcelo, Cheryl Van Buskirk, Trudi SchuÈpbach* HHMI, Department of Molecular Biology, Princeton University, Princeton, NJ 08544, USA Received 6 April 1999; received in revised form 30 July 1999; accepted 4 August 1999

Abstract During Drosophila oogenesis, localization of the transforming growth factor a (TGFa )-like signaling molecule Gurken to the oocyte membrane is required for polarity establishment of the egg and embryo. To test Gurken domain functions, full-length and truncated forms of Gurken were expressed ectopically using the UAS/Gal4 expression system, or in the germline using the endogenous promoter. GrkDC, a deletion of the cytoplasmic domain, localizes to the oocyte membrane and can signal. GrkDTC, which lacks the transmembrane and cytoplasmic domains, retains signaling ability when ectopically expressed in somatic cells. However, in the germline, the GrkDTC protein accumulates throughout the oocyte cytoplasm and cannot signal. In addition, we found that several strong gurken alleles contain point mutations in the transmembrane region. We conclude that secretion of Gurken requires its transmembrane region, and propose a model in which the gene cornichon mediates this process. q 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: gurken; cornichon; Transforming growth factor a ; Drosophila; Oogenesis; Secretory pathway; Signal transduction

1. Introduction Many cell fate decisions in development rely on communication between cells, and involve speci®c signaling molecules. This extracellular information, often in the form of a polypeptide ligand, is produced in one cell and transported to the cell surface. Once the ligand is externalized, it can bind to its cognate receptor, initiating a signal transduction cascade and producing an internal cellular response to the outside signal. During Drosophila oogenesis, several intercellular communication events occur between the germ line and the surrounding follicle cells (for review see Nilson and SchuÈpbach, 1999). Communication between the germ line and the soma depends on a ligand/receptor pair: gurken, which encodes a transforming growth factor a (TGF-a ) homolog and is expressed in the germline (Neuman-Silberberg and SchuÈpbach, 1993), and the Drosophila homolog of the epidermal growth factor receptor (Egfr), which is expressed in the follicle cells (Price et al., 1989; Sapir et al., 1998). Genetic analysis of mutants in gurken and Egfr signaling * Corresponding author. Tel.: 11-609-258-6492; fax: 11-609-2581547. E-mail address: [email protected] (T. SchuÈpbach)

has shown that this signaling process is required for several events during oogenesis. Early in oogenesis, it establishes posterior follicle cell fates; later, it initiates the determination of dorsal fates in the follicle cells and, indirectly, in the embryo. In addition to gurken, cornichon (cni) is also required in the germline for signaling activity (Roth et al., 1995). Cornichon is a small hydrophobic protein that has recently been shown to be homologous to the yeast endoplasmic reticulum (ER) protein Erv14p (Powers and Barlowe, 1998). In cni mutants, Gurken protein shows an abnormal localization (Roth et al., 1995). Egfr is expressed in all the follicle cells that surround the developing oocyte (Sapir et al., 1998). In contrast, the localization of Gurken within the oocyte is tightly regulated. Gurken RNA and protein accumulate within the oocyte in early stages, when signaling to the follicle cells establishes posterior cell fates. In mid-oogenesis, Gurken is localized to the future dorsal anterior region of the oocyte designated by the position of the oocyte nucleus (Neuman-Silberberg and SchuÈpbach, 1993). This spatial restriction of Gurken activates Egfr in a restricted number of follicle cells, leading to the establishment of dorsal follicle cell fates. Properly patterned follicle cells secrete a polarized eggshell and regulate the production of a new signal that establishes polarity in the embryo (for review see Nilson and SchuÈpbach, 1999).

0925-4773/99/$ - see front matter q 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(99)00196-3

36

A.M. Queenan et al. / Mechanisms of Development 89 (1999) 35±42

gurken encodes a 294 amino acid polypeptide that contains a signal peptide, an EGF motif, a transmembrane domain and a small cytoplasmic domain. These features place Gurken in the TGF-a family of ligands. Several membrane-bound ligands such as proTGF-a , CSF-1, proEGF, and Kit ligand are processed from a membranebound to a soluble form which activates a receptor. However, uncleaved, membrane-bound ligands are also known to have signaling activity (reviewed in Massague and Pandiella, 1993). To test if the extracellular domain of Gurken alone could activate Egfr, a truncation lacking the transmembrane and cytoplasmic domains (GrkDTC) was expressed ectopically using the UAS/Gal4 system (Brand and Perrimon, 1993) and endogenously in the germline using the gurken promoter. We present evidence that this truncated form of Gurken is biologically active and can ectopically activate the receptor. However, the transmembrane and/or juxtamembrane regions of Gurken are required for its proper targeting and export to the plasma membrane of the oocyte. 2. Results To determine the functions of the transmembrane and cytoplasmic domains of Gurken, site-directed mutagenesis was used to generate truncated forms of the protein. To construct the cytoplasmic domain deletion, GrkDC, we introduced a stop codon six amino acids after the end of the transmembrane domain. Deletion of the transmembrane and cytoplasmic domains to create GrkDTC was done by insertion of a stop codon eleven amino acids after the last cysteine in the EGF motif (Fig. 1A). We tested activity and localization of the truncated Gurken proteins in transgenic ¯ies. 2.1. Gurken truncated before the transmembrane region is biologically active GrkDTC is a putative soluble form of Gurken that retains the signal peptide and extracellular regions and is truncated after the EGF motif (Fig. 1A). To test if the GrkDTC molecule is capable of signaling, we expressed it ectopically using the UAS/Gal4 system (Brand and Perrimon, 1993). Although gurken normally functions only in the germline, its receptor, Egfr, is also required during embryogenesis and imaginal disc development. This allowed us to test whether the truncated form could ectopically activate Egfr. When GrkDTC is expressed in the wing disc, extra wing veins are produced (Fig. 1D). When expressed in ovarian follicle cells, GrkDTC produced ectopic Egfr activation and caused a dorsalization of the eggshell and embryo (Fig. 1G). These phenotypes mimic the phenotypes obtained when constitutively activated Egfr (Queenan et al., 1997) or another truncated Egfr ligand, Sspi (Schweitzer et al., 1995), are ectopically expressed. In contrast to the activation observed with GrkDTC, the full-length gurken cDNA, under UAS

Fig. 1. (A) Stop codons introduced by site-directed mutagenesis to obtain GrkDC and GrkDTC. SP, signal peptide; EGF, epidermal growth factor motif; TM, transmembrane; C, cytoplasmic domain. (B±G) GrkDTC is biologically active. Wings and egg shells resulting from ectopic expression of full-length and truncated Gurken. (B,E) wild-type morphology. (C,F) UAS-Grk; Gal4 CY2. (D,G) UAS-GrkDTC; Gal4 CY2.

control and expressed with the same Gal4 lines, did not cause any gain of function phenotypes (Fig 1C,F). Confocal analysis using the Gurken monoclonal antibody 1D12 shows that the Gal4 line CY2 induces expression of these transgenes in all of the follicle cells over the oocyte. Both the full-length and truncated forms of Gurken are present within the cells of the follicular epithelium, but the distribution differs between the two forms. The full-length protein is biased towards the apical side of the cells, while GrkDTC is enriched on the basal side (Fig. 2). These data demonstrate that the truncated form of Gurken is capable of activating Egfr, whereas the full-length form is unable to signal when ectopically expressed in either the follicle cells or the wing disc. Even though the full-length protein accumulates apically in the follicle cells, it is possible that it is not delivered to the cell surface, or not


Fig. 2. Localization of ectopically expressed full-length and truncated Gurken within the follicular epithelium. Confocal sections with Gurken in green, actin in red. (A) UAS-Grk; Gal4 CY2. (B) UAS-GrkDTC; Gal4 CY2.

processed into an active form that would allow interaction with Egfr. In order to assess whether the truncated form of Gurken acts indeed mainly intracellularly, as opposed to being secreted and diffusing over some distance, we used an engrailed-GAL4 line (Sanson et al., 1996) to express the GrkDTC protein in the posterior wing compartment. Even though the resulting progeny were almost entirely lethal, we were able to examine the wings of an escaper male (Fig. 3B). Expansion of wing vein 4 up to the compartment boundary was seen in both wings, but the expansion did not extend across the boundary, consistent with the possibility that GrkDTC protein activates Egfr intracellularly. 2.2. Activity of truncated forms of Gurken in the germline The usefulness of the UAS-Grk and UAS-GrkDTC lines was limited to ectopic expression studies because the UAS

37

Fig. 3. Ectopic wing vein material is restricted to the posterior compartment when UAS-GrkDTC is expressed under engrailed-GAL4 control. (A) wild-type wing. (B) en GAL4/1; GrkD TC /1. The dotted line indicates the anterior/posterior compartment boundary in the region of the anterior cross vein. The ectopic wing vein material (arrow) does not cross the boundary.

constructs are not expressed in the oocyte (Manseau et al., 1997). To test the functions of the transmembrane and cytoplasmic domains of Gurken in the germline, truncated versions of Gurken expressed from the endogenous genomic promoter were introduced into a gurken mutant background. We ®rst assessed activity of the transgenes by analyzing rescue of the eggshell phenotypes (Table 1). Females homozygous for grk 2B or grk E12 produce strongly ventralized eggs that lack dorsal appendages. In addition, these eggs exhibit patterning defects along the A/P axis, detectable as a lack of the posterior aeropyle. We chose the gurken mutation 2B for the rescue assay because this allele produces no detectable RNA (Neuman-Silberberg and SchuÈpbach, 1993). One copy of a 5 kb wild-type gurken genomic transgene in a grk 2B mutant background produces substantial rescue and restores

Table 1 Rescue of gurken mutant egg shell phenotypes by Gurken deletion constructs a Genotype

grk 2B/grk 2B grk 5 kb/1; grk 2B/grk 2B D C/1; grk 2B/grk 2B D TC/D TC;grk 2B/grk 2B grk E12/grk E12

A/P Axis

D/V Axis

Aeropyle present b

Wild type

2 100 100 5 3

N Strongly ventralized

2 Appendages

Fused at base

1 Appendage

No appendages

0 58 75 0 0

0 28 10 0 0

0 14 12 0 0

100 0 3 100 100

250 231 285 246 197

a All values are in percent of total (N). Rescue of the grk2B mutant is shown with one copy of the Gurken 5 kb genomic control or GrkDC transgene, or 2 copies of the GrkDTC transgene. b Wild-type posterior structure.

38


the aeropyle and appendage material (Table 1). Females carrying two copies of this wild-type genomic transgene in a grk 2B background lay eggs with two dorsal appendages. They also produce some eggs that are weakly dorsalized (data not shown). The 24-amino-acid cytoplasmic domain of Gurken is very highly conserved between D. melanogaster and D. virilis (Fig. 3A; Peri et al., 1999). This strong conservation suggests that the cytoplasmic domain contains an important function. However, expression of a form of Gurken lacking the cytoplasmic domain (GrkDC) rescues both the AP and DV defects of the grk 2B mutant (Table 1). The truncated molecule without the cytoplasmic tail is apparently exported to the surface of the oocyte and is able to signal to the adjacent follicle cells. As with the control wild-type gurken transgene, extra copies of GrkDC result in dorsalization of the egg (data not shown). This result indicates that the carboxy terminus of Gurken is not necessary for signaling activity in the oocyte. Despite the biological activity of the GrkDTC molecule produced in the ectopic expression studies, females carrying the genomic GrkDTC transgene in a grk 2B mutant background are not rescued. They produce eggs that are de®cient in A/P polarity and strongly ventralized with no dorsal appendage material produced by the follicle cells (Table 1). In situ hybridization with a gurken probe revealed that the RNA from this transgene was expressed and appropriately localized near the oocyte nucleus (data not shown). The surprising lack of activity of germline GrkDTC contrasts with the behavior of the same truncated form expressed in the follicle cells and wing disc and indicates that the transmembrane domain plays a crucial role in the oocyte. 2.3. GurkenD TC is mislocalized within the oocyte To determine the localization pattern of the truncated Gurken proteins within the ovary, we used the monoclonal antibody 1D12. In the wild-type ovary, Gurken protein is localized to the oocyte in early stages of oogenesis; in later stages Gurken becomes localized to the dorsal anterior region of the oocyte (Fig. 4B). The grk 2B mutant ovaries contain no detectable Gurken protein (Fig. 4C). The GrkDC transgene produces properly localized protein that retains signaling activity. Even though the bulk of the protein is observed in the membrane overlying the oocyte nucleus, in the confocal analysis the protein appears somewhat less tightly con®ned than the wild-type protein (Fig. 4D). Despite the lack of activity in the rescue experiments, the GrkDTC protein is readily detected within the oocyte cytoplasm (Fig. 4E). However, in mid-oogenesis the protein does not localize to the dorsal anterior region. It remains distributed throughout the oocyte. After stage ten of oogenesis the protein levels appear reduced, possibly due to diffusion throughout the oocyte or degradation. The lack of

Fig. 4. (A) Alignment of D. melanogaster (upper) and D. virilis (lower) Gurken proteins beginning at the last cysteine in the EGF motif. Identical amino acids are shaded in black. Stop codons for grk E12, GrkDTC, and GrkDC are indicated. Alanine 245 is the site of the grk QI66, grk DC29, and grk 705 mutations. Lines below sequences indicate transmembrane regions, based upon the TMpredict (blue) and Psort (red) programs (www.public.iastate.edu/~pedro/research_tools.html). (B±F) Localization of Gurken proteins and eggshell rescue. Left, confocal sections of egg chambers with Gurken in green and actin in red. Right, eggshells viewed with dark ®eld optics. Anterior is to the left. Genotypes of the females are: (B) wildtype control; (C) grk 2B/grk 2B mutant control; (D)grk 2B/grk 2B; GrkDC/ GrkDC; (E) grk 2B/grk 2B; GrkDTC/GrkDTC; (F) grk E12/grk E12.

posterior and dorsal eggshell rescue indicates that this truncated form of Gurken cannot signal, even in the early stages when the protein is present at high levels. The abnormal distribution of the protein and the absence of signaling ability further suggest that delivery of Gurken to the surface of the oocyte requires the transmembrane region. In another test to determine if the truncated forms of Gurken are exported to the oocyte plasma membrane, we looked at uptake of extracellular Gurken protein in the overlying follicle cells (Fig. 5; Peri et al., 1999). In the wild-type ovary (Fig. 5A), punctate staining of Gurken is observed in the follicle cells that are adjacent to the oocyte. This punctate staining is visible when the GrkDC construct is


39

mutant for cornichon, a small transmembrane protein required for Gurken signaling during oogenesis (Roth et al., 1995; Neuman-Silberberg and SchuÈpbach, 1996).

3. Discussion 3.1. The conserved cytoplasmic domain of Gurken is not necessary for signaling

Fig. 5. Punctate staining of Gurken in follicle cells is lost when Gurken is truncated before the transmembrane domain. Confocal sections, Gurken in green, actin in red. Genotypes are as follows. (A) Wild-type control; note vesicular staining of Gurken in follicle cells. (B) GrkDC/GrkDC; grk 2B/ grk 2B, note vesicular staining of Gurken in follicle cells. (C) GrkDTC/ GrkDTC; grk 2B/grk 2B. (D) grk E12/grk E12. (E) cni AR/cni AA. In C±E, Gurken protein remains con®ned to the oocyte.

expressed in a grk 2B mutant background (Fig. 5B). In contrast, both GrkDTC (Fig. 5C) and grk E12 (Fig. 5D) do not contain detectable Gurken protein in the follicle cells, similar to mutations in cni (Fig. 5E; and Peri et al., 1999). 2.4. A class of mutants with abnormal Gurken protein localization Several gurken mutant alleles produce Gurken protein that is abnormally distributed throughout the oocyte (Fig 4F; Neuman-Silberberg and SchuÈpbach, 1996), similar to the phenotype produced with the GrkDTC construct. We determined the molecular lesions of these alleles (grk E12, grk QI66, grk DC29 and grk 705) by sequencing genomic DNA. As shown in Fig. 3A, the mutations in this class of alleles all cluster in, or very close to, the predicted transmembrane domain of Gurken. grk E12 contains a stop codon following the EGF motif. This predicted protein is very similar to the GrkDTC truncation, eliminating six more amino acids than GrkDTC. grk QI66, grk DC29, and grk 705 change amino acid alanine 245 to threonine or valine. Alanine 245 is located near the beginning of the transmembrane region. This reveals that this alanine is crucial for the function of Gurken protein, as even a conservative amino acid change strongly disrupts Gurken function. These gurken mutants all lead to an aberrant distribution of Gurken within the oocyte, strongly supporting the model that the transmembrane region is needed to localize Gurken to the membrane of the oocyte. A similar mislocalization of Gurken is seen in oocytes

The transport of a polypeptide growth factor to the cell surface is an essential step in its ability to act as a ligand. Vesicles budding from the ER are involved in the sorting of proteins to various compartments (reviewed in Aridor and Balch, 1996; Bannykh and Balch, 1997). Proteins destined for the plasma membrane contain a variety of targeting signals that may be located in different domains. For example, in mammalian cells, the proteins Aminopeptidase N and Neutral Endopeptidase are properly secreted even when the transmembrane and cytoplasmic regions are deleted (Corbeil et al., 1992; Vogel et al., 1992). In contrast, the protein a -1 Proteinase Inhibitor is retained in the ER when the last four C-terminal amino acids are deleted (Brodbeck and Brown, 1992). The targeting motifs YXXf , DXE, and FF, found in the cytoplasmic domains of several mammalian and viral transmembrane proteins, have roles in subcellular localization and exit from the ER (Thomas and Roth, 1994; Fiedler et al., 1996; Nishimura and Balch, 1997). This variety of motifs suggests that there are multiple possible signals for passage through the secretory system. In our analysis, we present evidence that the transmembrane/juxtamembrane region of Gurken is necessary for the export of this ligand to the oocyte surface, but is not required in other cell types for activation of the receptor. Routing and processing of the TGF-a family of growth factors has been studied in mammalian cells, where it has been shown that the cytoplasmic C-terminal amino acid is necessary for the movement of the protein through the secretory system (Briley et al., 1997). The carboxy terminus of a related signaling molecule, neuregulin, is necessary for biological activity as demonstrated in cytoplasmic domain knockout mice (Liu et al., 1998). The Gurken cytoplasmic region is highly conserved between D. melanogaster and D. virilis, with 20/24 amino acids identical (Peri et al., 1999) and contains a putative ER exit motif, FF (Fiedler et al., 1996). However, when the Gurken cytoplasmic domain is deleted, and this truncated protein is expressed in a gurken null background, a signi®cant amount of GrkDC is still properly localized to the dorsal anterior region of the egg chamber and rescues the mutant phenotype. This rescue requires activation of the receptor which is expressed in the adjacent follicle cells. As additional support for export of the GrkDC protein, we observed punctate Gurken staining in the follicle cells overlying the oocyte expressing GrkDC. Although much of GrkDC was properly localized, we observed a loss of the tight membrane localization at the

40


dorsal anterior. One explanation for this result is that the cytoplasmic region contributes to the targeting or anchoring of Gurken to the cell surface but is not absolutely required. 3.2. The extracellular domain of Gurken retains signaling ability We tested whether Gurken lacking the cytoplasmic and transmembrane domains still retains signaling activity by expressing GrkDTC in wing imaginal discs or in ovarian follicle cells. Ectopic expression of the GrkDTC protein yields gain of function phenotypes consistent with ectopic Egfr activation (Schweitzer et al., 1995; Queenan et al., 1997) These results clearly indicate that GrkDTC retains biological activity. In contrast, the full-length form of Gurken, when ectopically expressed, was unable to activate Egfr. Our data are similar to those of Schweitzer et al. (1995), who showed that ectopic expression of the truncated form of the ligand Spitz, but not the full-length form, resulted in cell fate changes. These results led the authors to propose that Spitz needs to be processed into a soluble form in order to activate Egfr. Schweitzer et al. also proposed that rhomboid, another factor in the signaling process, is involved in the processing and activation of Spitz, based on the observation that soluble Spitz can bypass the requirements for rhomboid. However, rhomboid is not expressed in the oocyte, therefore the model of processing and activation by rhomboid cannot be applied to Gurken. Unexpectedly, the truncated form of Gurken that showed ectopic activity in other tissues was not functional in the oocyte. Only the forms of Gurken that still contained the transmembrane domain could rescue the polarity phenotypes, and only these forms gave rise to secreted vesicular protein that could be seen outside the oocyte. Therefore our results strongly suggest that in the case of Gurken, secretion from the oocyte is regulated requiring the presence of the transmembrane domain, and that this regulated secretion is a crucial step in Gurken's ability to activate the receptor in the adjacent follicle cells. Closer examination of ectopic follicle cell expression of full-length Gurken and Grk DTC by confocal microscopy revealed that the two forms of Gurken are distributed differently within the epithelial cells. The full-length Gurken protein appears distributed with a bias towards the apical side. In contrast, GrkDTC is located on the basal side of the cells. This result suggests that the transmembrane and cytoplasmic domains of Gurken affect its subcellular distribution. At this level of resolution, it appears that the GrkDTC molecule is not located at the apical surface where the receptor accumulates (Sapir et al., 1998), yet it remains a potent activator of Egfr. The activated phenotypes observed in the eggshell could therefore potentially be due to interaction of the ectopic soluble ligand and endogenous receptor within compartments of the secretory pathway. This would be analogous to the recently reported `intracrine' signaling by a similarly truncated EGF molecule expressed in

mammalian cells (Wiley et al., 1998). In contrast, the ectopic full-length protein may not encounter the receptor during its traf®c, it may be physically constrained from interacting with the receptor, or require other factors for activation which are not present in the follicle cells. 3.3. The transmembrane/juxtamembrane region of Gurken is required for proper membrane targeting in the oocyte Elimination of both the transmembrane and cytoplasmic domains of Gurken results in a protein with no signaling activity in the oocyte, even though it is capable of signaling in other tissues. This GrkDTC truncated protein is present in the oocyte, but not localized to the plasma membrane. Aberrant Gurken localization is also observed in the gurken mutants E12, QI66, DC29, and 705. All four of these EMS-induced alleles affect the region of Gurken in or near the transmembrane domain. Of particular interest is alanine 245, because Gurken function is disrupted even when this alanine is substituted with valine. The precise extent of the transmembrane region of Gurken varies somewhat depending on which program is used (amino acids 253±269 for PSORT II, 2440-270 for TMpred), making it uncertain whether this alanine is located within or very close to the transmembrane pass. Based upon its unlocalized distribution and its lack of signaling in the oocyte, we conclude that GrkDTC is not able to reach the oocyte plasma membrane. This conclusion is further supported by the observation that in the wild-type ovary, punctate staining of Gurken protein is visible in the follicle cells that lie over the patch of Gurken within the oocyte. This staining is absent when the GrkDTC transgene is expressed in a grk 2B mutant background and in the mutant grk E12. A similar phenotype, consisting of loss of Gurken protein localization and Gurken signaling, is also seen in cornichon mutants. Cornichon is a small integral membrane protein that is required in the germline (Roth et al., 1995). Recent results demonstrate that ERV14, a cornichon homolog in yeast (Powers and Barlowe, 1998), is required for the speci®c transport of the transmembrane protein Axl2p to the plasma membrane. Erv14p is found in COPII-containing vesicles that bud from the ER. In erv14 mutants, Axl2p remains within the ER, while other secretory proteins are transported at wild-type rates, indicating that the role of Erv14p is to speci®cally promote the exit of Axl2p from the ER. Similarly, Cornichon may be required to allow Gurken to exit the ER and be routed to the oocyte surface. The class of gurken alleles in which Gurken protein is mislocalized contain molecular lesions that cluster in or near the transmembrane region. Since Cornichon is predicted to be a transmembrane protein, it is possible that Cornichon and Gurken directly interact via the Gurken transmembrane domain. Alternatively, the effects of Cornichon on Gurken secretion could be more indirect (Powers and Barlowe, 1998).


3.4. Speci®city in the transport of Gurken to the oocyte surface Given that cornichon seems to be required for proper accumulation of Gurken in the oocyte membrane, it is a question whether other proteins can be secreted from the oocyte in the absence of cornichon. Another transmembrane protein that is transcribed and translated within the germline is the vitellogenin receptor. This receptor is necessary for the uptake of the yolk proteins which are produced and secreted by the follicle cells (Schonbaum et al., 1995). The RNA for this receptor is expressed throughout the oocyte (our unpublished observations) and yolk granules are incorporated into the oocyte uniformly (DiMario and Mahowald, 1987). Receptor mutants, termed yolkless, fail to accumulate yolk proteins in the oocyte. Because cornichon mutants are able to complete vitellogenesis, it appears that the yolk protein receptor can traf®c normally to the oocyte membrane in the absence of Cornichon. We therefore propose a model in which cornichon acts as a speci®c transport factor required to localize Gurken to the surface of the oocyte, and that this secretion process requires the transmembrane region of Gurken. This proposed role for Cornichon in speci®c transport would be directly comparable to the proposed role of Erv14p in the speci®c transport of Axl2p to the bud of the yeast cell (Powers and Barlowe, 1998).

4. Experimental procedures 4.1. Molecular techniques Site-directed mutagenesis with a single stranded template (Altered Sites kit, Promega) was used to modify the gurken coding sequences. For GrkDC, the primer used to insert a stop codon six amino acids after the transmembrane domain was 5 0 GGTGACTACAACTAGTCGCCTCC 3 0 . As a result of the mutagenesis, which created a SpeI site, the last amino acid before the stop was changed from an isoleucine to an arginine. For GrkDTC, the primer used to insert a stop codon eleven amino acids after the EGF motif was 5 0 GTGCCGGGATTAACGCCGGAAGC 3 0 . This primer created a HpaI site and changed the last amino acid before the stop from aspartate to glycine. Single-stranded DNA templates were made from gurken genomic or gurken cDNA in pBluescriptSK1 (Stratagene), and Escherichia coli mutS cells were the recipient cells. All mutations were con®rmed by sequencing. In order to obtain expression under the endogenous gurken promoter, the truncations were introduced into a 5 kb genomic fragment derived from the original 9 kb gurken rescue fragment (NeumanSilberberg and SchuÈpbach, 1993). Genomic transgenes were cloned into pCaSpeR4 (Thummel and Pirrotta, 1992). Control and mutated cDNAs were cloned into pUAST (Brand and Perrimon, 1993).

41

The TnT wheat germ lysate in vitro transcription/translation kit (Promega) was used to con®rm the stop codon in the cDNA construct. The integrity of the genomic constructs in transgenic ¯ies was checked by polymerase chain reaction (PCR) analysis for the restriction enzyme site added during the mutagenesis. To generate transformant ¯ies, P-element mediated transformation (Spradling, 1986) was used with pTurbo (gift from P. Schedl) as the helper plasmid injected into yw recipients. gurken alleles were sequenced at the Princeton SynSeq facility, using PCR-generated genomic fragments from gurken mutant ¯ies and primers that spanned the entire gurken genomic region. 4.2. Fly stocks The gurken alleles are described in Neuman-Silberberg and SchuÈpbach (Neuman-Silberberg and SchuÈpbach, 1993). The transgenic lines used in this study were: control gurken genomic #GK8, genomic GrkDC #100 genomic GrkDTC #4.1, UAS-Grk #R1, and UAS-GrkDTC #84. The Gal4 line used was CY2 which is expressed in the wing and in all follicle cells after stage 7 of oogenesis (Queenan et al., 1997). Flies were cultured in standard cornmeal/agar medium at room temperature. Eggs were collected on yeasted apple juice agar plates, washed with water, and mounted in Hoyer's medium for examination under dark ®eld (Wieschaus and NuÈssleinVolhard, 1986). In cases where females retained their eggs (grk 2B, grk E12 and GrkDTC in grk 2B), ovaries were dissected into PBS and mounted. Wings were washed with water and mounted in Hoyer's medium. 4.3. Antibody procedures The gurken monoclonal antibody 1D12 was made in the Princeton monoclonal facility, using a GST-grk fusion containing amino acids 53±185 from the Gurken extracellular domain (Neuman-Silberberg and SchuÈpbach, 1996). Ovaries were ®xed 10 minutes (6% formaldehyde,16.7 mM KH2PO4, pH 6.8, 75 mM KCl, 25 mM NaCl, 3.3 mM MgCl2) and blocked for 1 h in 1% BSA, PBSTx (PBS, 0.3% Triton X-100). Wash protocol was three rinses and 3£30-min washes in PBSTx. The ovaries were incubated in monoclonal 1D12 supernatant (1:30 in PBSTx) overnight at 48C and washed. The ovaries were incubated with the secondary antibody anti-mouse Alexa 568,1:1000 (Molecular Probes), washed, counterstained with phalloidin Oregon Green 488 (Molecular Probes) and mounted in Aqua Polymount (Polysciences, Inc.). Confocal images were collected on BioRad MRC 600 confocal microscope. Acknowledgements We thank M. Marlow for production of the monoclonal antibody 1D12, G. Gray for ¯y food, J. Goodhouse for

42


confocal microscopy assistance and the members of the SynSeq facility for primers and sequencing. We thank G. Waters, L. Nilson and L.M. Pai for discussion and suggestions. A.M.Q. was supported by a Howard Hughes Medical Institute Predoctoral Fellowship. This work was supported by U.S. Public Health Service grant PO1 CA 41086 to T.S. and the Howard Hughes Medical Institute. References Aridor, M., Balch, W.E., 1996. Principles of selective transport: coat complexes hold the key. Trends Cell Biol. 6, 315±320. Bannykh, S.I., Balch, W.E., 1997. Membrane dynamics at the endoplasmic reticulum-Golgi interface. J. Cell Biol. 138, 1±4. Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401±415. Briley, G.P., Hissong, M.A., Chiu, M.L., Lee, D.C., 1997. The carboxylterminal valine residues of proTGF alpha are required for its ef®cient maturation and intracellular routing. Mol. Biol. Cell 8, 1619±1631. Brodbeck, R.M., Brown, J.L., 1992. Secretion of alpha-1-proteinase inhibitor requires an almost full length molecule. J. Biol. Chem. 267, 294± 297. Corbeil, D., Boileau, G., Lemay, G., Crine, P., 1992. Expression and polarized apical secretion in Madin-Darby canine kidney cells of a recombinant soluble form of neutral endopeptidase lacking the cytosolic and transmembrane domains. J. Biol. Chem. 267, 2798±2801. DiMario, P.J., Mahowald, A.P., 1987. Female sterile (1) yolkless: a recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes. J. Cell Biol. 105, 199±206. Fiedler, K., Veit, M., Stamnes, M.A., Rothman, J.E., 1996. Bimodal interaction of coatomer with the p24 family of putative cargo receptors. Science 273, 1396±1399. Liu, X., Hwang, H., Cao, L., Buckland, M., Cunningham, A., Chen, J., Chien, K.R., Graham, R.M., Zhou, M., 1998. Domain-speci®c gene disruption reveals critical regulation of neuregulin signaling by its cytoplasmic tail. Proc. Natl. Acad. Sci. USA 95, 13024±13029. Manseau, L., Baradaran, A., Brower, D., Budhu, A., Elefant, F., Phan, H., Philp, A., Yang, M., Glover, D., Kaiser, K., Patler, K., Selleck, S., 1997. Gal4 enhancer traps expressed in the embryo, larval brain, imaginal discs, and ovary of Drosophila. Dev. Dyn. 209, 310±332. Massague, J., Pandiella, A., 1993. Membrane-anchored growth factors. Annu. Rev. Biochem. 62, 515±541. Neuman-Silberberg, F.S., SchuÈpbach, T., 1993. The Drosophila dorsoventral patterning gene gurken produces a dorsally localized RNA and encodes a TGF alpha-like protein. Cell 75, 165±174. Neuman-Silberberg, F.S., SchuÈpbach, T., 1996. The Drosophila TGFalpha-like protein Gurken: expression and cellular localization during Drosophila oogenesis. Mech. Dev. 59, 105±113.

Nilson, L.A., SchuÈpbach, T., 1999. EGF receptor signaling in Drosophila oogenesis. Curr. Top. Dev. Biol. 44, 203±243. Nishimura, N., Balch, W.E., 1997. A di-acidic signal required for selective export from the endoplasmic reticulum. Science 277, 556±558. Peri, F., BoÈkel, C., Roth, S., 1999. Local Gurken signaling and dynamic MAPK activation during Drosophila oogenesis. Mech. Dev. 81, 83±96. Powers, J., Barlowe, C., 1998. Transport of axl2p depends on erv14p, an ER-vesicle protein related to the Drosophila cornichon gene product. J. Cell Biol. 142, 1209±1222. Price, J.V., Clifford, R.J., SchuÈpbach, T., 1989. The maternal ventralizing locus torpedo is allelic to faint little ball, an embryonic lethal, and encodes the Drosophila EGF receptor homolog. Cell 56, 1085±1092. Queenan, A.M., Ghabrial, A., SchuÈpbach, T., 1997. Ectopic activation of Torpedo/Egfr, a Drosophila receptor tyrosine kinase, dorsalizes both the eggshell and the embryo. Development 124, 3871±3880. Roth, S., Neuman-Silberberg, F.S., Barcelo, G., SchuÈpbach, T., 1995. cornichon and the EGF receptor signaling process are necessary for both anterior-posterior and dorsal-ventral pattern formation in Drosophila. Cell 81, 967±978. Sanson, B., White, P., Vincent, J.P., 1996. Uncoupling cadherin-based adhesion from wingless signalling in Drosophila. Nature 383, 627±630. Sapir, A., Schweitzer, R., Shilo, B.Z., 1998. Sequential activation of the EGF receptor pathway during Drosophila oogenesis establishes the dorsoventral axis. Development 125, 191±200. Schonbaum, C.P., Lee, S., Mahowald, A.P., 1995. The Drosophila yolkless gene encodes a vitellogenin receptor belonging to the low density lipoprotein receptor superfamily. Proc. Natl. Acad. Sci. USA 92, 1485± 1489. Schweitzer, R., Shaharabany, M., Seger, R., Shilo, B.Z., 1995. Secreted Spitz triggers the DER signaling pathway and is a limiting component in embryonic ventral ectoderm determination. Genes Dev. 9, 1518± 1529. Spradling, A.C., 1986. P element-mediated transformation. In: Roberts, D.B. (Ed.). Drosophila, A Practical Approach, IRL Press, Oxford, pp. 175±197. Thomas, D.C., Roth, M.G., 1994. The basolateral targeting signal in the cytoplasmic domain of glycoprotein G from vesicular stomatitis virus resembles a variety of intracellular targeting motifs related by primary sequence but having diverse targeting activities. J. Biol. Chem. 269, 15732±15739. Thummel, C.S., Pirrotta, V., 1992. New pCaSpeR P element vectors. Drosoph. Inform. Serv. 71, 150. Vogel, L.K., Spiess, M., Sjostrom, H., Noren, O., 1992. Evidence for an apical sorting signal on the ectodomain of human aminopeptidase N. J. Biol. Chem. 267, 2794±2797. Wieschaus, E., NuÈsslein-Volhard, C., 1986. Looking at Embryos. In: Roberts, D.B. (Ed.). Drosophila, A Practical Approach, IRL Press, Oxford, pp. 199±227. Wiley, H.S., Woolf, M.F., Opresko, L.K., Burke, P.M., Will, B., Morgan, J.R., Lauffenburger, D.A., 1998. Removal of the membrane-anchoring domain of epidermal growth factor leads to intracrine signaling and disruption of mammary epithelial cell organization. J. Cell Biol. 143, 1317±1328.