1 Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford ...... Alcamı!, A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L..
Journal of General Virology (2002), 83, 1965–1976. Printed in Great Britain ...................................................................................................................................................................................................................................................................................
The vaccinia virus N1L protein is an intracellular homodimer that promotes virulence Nathan Bartlett,1, 2 Julian A. Symons,1† David C. Tscharke1,2‡ and Geoffrey L. Smith1, 2 1
Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK Department of Virology, The Wright–Fleming Institute, Faculty of Medicine, Imperial College, St Mary’s Campus, Norfolk Place, London W2 1PG, UK 2
The vaccinia virus (VV) N1L gene encodes a protein of 14 kDa that was identified previously in the concentrated supernatant of virus-infected cells. Here we show that the protein is present predominantly ( 90 %) within cells rather than in the culture supernatant and it exists as a nonglycosylated, non-covalent homodimer. The N1L protein present in the culture supernatant was uncleaved at the N terminus and was released from cells more slowly than the VV A41L gene product, a secreted glycoprotein that has a conventional signal peptide. Bioinformatic analyses predict that the N1L protein is largely alpha-helical and show that it is conserved in many VV strains, in other orthopoxviruses and in members of other chordopoxvirus genera. However, database searches found no non-poxvirus proteins with significant amino acid similarity to N1L. A deletion mutant lacking the N1L gene replicated normally in cell culture, but was attenuated in intranasal and intradermal murine models compared to wild-type and revertant controls. The conservation of the N1L protein and the attenuated phenotype of the deletion mutant indicate an important role in the virus life-cycle.
Introduction Vaccinia virus (VV) is the prototypic member of the Poxviridae, a group of complex DNA viruses that replicate in the cell cytoplasm (Moss, 2001). The genomes of VV strains Copenhagen (Goebel et al., 1990), modified virus Ankara (Antoine et al., 1998), and Tian Tan (accession no. AF095689) have been sequenced and contain approximately 200 genes. Genes located in the centre of the virus genome are conserved between orthopoxviruses and generally are essential for virus replication. In contrast, genes located near the termini are more variable, are often dispensable for growth in tissue culture and Author for correspondence : Geoffrey Smith (at Imperial College). Fax j44 207 594 3973. e-mail glsmith!ic.ac.uk †Present address : Roche Bioscience, 3401 Hillview Avenue, Palo Alto, CA 94304, USA. ‡Present address : Cell Biology and Viral Immunology Sections, Laboratory of Viral Diseases, NIAID, NIH, Bethesda, MD 20892, USA. Accession numbers for the vaccinia virus N1L genes are : VV strain Western Reserve, AF451287 ; strain Wyeth, AF455803 ; strain Lister, AF455804 ; strain King Institute, AF455805 ; strain USSR, AF455806.
0001-8385 # 2002 SGM
affect host range or virulence (Perkus et al., 1991). VV and other poxviruses have developed numerous strategies to modulate host responses to infection (Smith et al., 1997 ; Alcamı! & Koszinowski, 2000 ; Moss & Shisler, 2001) and several of these immunomodulatory proteins share amino acid sequence similarity with host cell proteins, suggesting that they were acquired originally from the host. The terminal regions of the VV genome are variable as exemplified by the isolation of spontaneous mutants with rearrangements or deletions in these regions (Wittek et al., 1978 ; Panicali et al., 1981). One such VV strain, Western Reserve (WR) mutant (6\2), contains a large deletion near the left terminus (Moss et al., 1981) ; it exhibits normal growth properties in tissue culture, but is attenuated in vivo (Buller et al., 1985). Nucleotide sequence analysis of this region of the parental virus genome (HindIII C and N fragments) and comparison to virus 6\2 revealed that the 6\2 genome had undergone a transposition event resulting in the loss of 17 open reading frames (ORFs) (Kotwal & Moss, 1988). Among the ORFs missing from the 6\2 mutant is N1L, which was predicted to encode a 13n8 kDa protein (Kotwal & Moss, 1988). Subsequently, this ORF was reported to encode one of several proteins of approximately 12 kDa in the supernatants BJGF
N. Bartlett and others
of VV-infected cells (Kotwal et al., 1989). The contribution of the N1L protein to the attenuated phenotype of the 6\2 mutant was analysed by construction of a VV-recombinant lacking a functional N1L gene. This virus was attenuated in intracranial and intraperitoneal mouse infection models (Kotwal et al., 1989), although a revertant virus was not reported. Here the VV N1L protein has been characterized more extensively and its role in the virus life-cycle has been studied by the construction of deletion and revertant viruses. The N1L protein synthesized by VV WR-infected cells is a nonglycosylated, non-covalent homodimer that is present predominately within infected cells. The deletion mutant was attenuated compared to wild-type and revertant controls in two murine models of infection.
Methods
Cells and viruses. Cell lines were grown as described (Alcamı! & Smith, 1995). VV strain WR was grown and titrated in BS-C-1 cells (Mackett et al., 1985).
respectively. Recombinant proteins made by these viruses were called AN1L and AN1L-his. AN1L-his was purified by nickel chelate and ion exchange chromatography as described for the A41L protein (Ng et al., 2001). For expression in E. coli the N1L ORF was amplified by a PCR using VV WR genomic DNA as template and as primers oligonucleotides (5h GGTTCCCATATGAGGACTCTACTTATTAGATATATTC and 5h CCTTGAATTCTTATTTTTCACCATATAGATC) that contained NdeI and EcoRI sites (underlined). Alternatively, the N1L ORF with a Cterminal (6)His tag was amplified by PCR using the same 5h primer and as the 3h primer an oligonucleotide (5h CCTTCTCGAGTTTTTCACCATATAGATC) containing a XhoI site (underlined) and lacking a stop codon. The resultant DNA fragments were digested with the appropriate enzymes and cloned into NdeI- and EcoRI- or NdeI- and XhoI-restricted pET24a (Novagen) to generate pETN1L and pETN1Lhis, respectively. Recombinant proteins were expressed from E. coli using the pET system (Novagen) according to the manufacturer’s specifications and were called EN1L and EN1L-his, respectively. EN1L-his was purified by Ni#+-affinty chromatography [HiTrap chelating HP column, AmershamPharmacia Biotech (APB)] and gel filtration using a calibrated Superdex 75 HR column (APB). EN1L protein was purified by ion-exchange chromatography using a ResourceQ column (APB), gel filtration (as described above) and a final polishing step using a MonoQ HR column (APB). Buffers all contained 1 mM dithiothreitol.
Construction of VV N1L deletion and revertant viruses. A virus lacking 88 % of the N1L ORF (nucleotides k78 to j276 relative to the N1L initiation codon) was constructed by transient dominant selection (Falkner & Moss, 1990) using the E. coli guanine xanthine phosphoribosyltransferase (Ecogpt) gene as the selectable marker (Boyle & Coupar, 1988). The entire N1L ORF and left and right flanking regions from VV strain WR were amplified by a PCR using VV WR genome DNA as template, and as primers oligonucleotides (5h ACAGAGCTC CGGATATTCTTCTAC and 5h TCGCTGCAGACCTAATCAACATCACACC) that contained SstI and PstI restriction sites (underlined), respectively. This DNA fragment was digested with these enzymes and cloned into plasmid pSJH7 (Hughes et al., 1991) forming pN1L and the fidelity of the DNA sequence was confirmed by DNA sequencing. To generate p∆N1L, plasmid pN1L was linearized with Tth3I and digested with Bal31 exonuclease before religation. The size of the deletion within individual clones was characterized initially by PCR using the above primers and then by sequencing. A plasmid with a deletion from nucleotide k78 to j276 relative to the 5h end of the ORF was called p∆N1L. This was transfected into VV WR-infected CV-1 cells and a deletion mutant (v∆N1L) and a wild-type control virus (vN1L) derived from the same intermediate virus were isolated as described for the A41L gene (Ng et al., 2001). A revertant virus (vN1L-rev) was derived in a similar way by transfecting plasmid pN1L into cells infected with v∆N1L.
Immunoblotting. BS-C-1 cells were mock-infected or were infected with the indicated viruses at 10 p.f.u. per cell in the presence, where specified, of 40 µg\ml β--arabinofuranoside (AraC), 1 µg\ml tunicamycin or 1 µM monensin (all Sigma). At 24 h post-infection (p.i.) cell extracts were prepared as described previously (Ng et al., 2001). Supernatants were centrifuged (3000 g, 10 min) to remove cellular debris before concentration in a centrifugal filter device (Amicon). Where indicated, supernatants were ultracentrifuged (14 000 g for 2 h) to pellet extracellular virus. Cell extracts and supernatants were analysed by SDS–PAGE (15 % gel), transferred to nitrocellulose and probed with rabbit α-N1L IgG or mouse mAb AB1.1 against the VV D8L protein (Parkinson & Smith, 1994) (each diluted 1 : 1000). Bound IgG was detected by incubation with the appropriate horseradish peroxidaseconjugated IgG (Sigma) (diluted 1 : 2000) followed by the enhanced chemiluminescence (ECL) detection system (APB).
Expression and purification of recombinant N1L protein. The N1L protein was expressed from Autographa californica nuclear polyhedrosis virus (AcNPV). The N1L ORF with or without six histidine residues at the C terminus was amplified by PCR using as primers oligonucleotides (5h TAAGGTACCAAGCATGAGGACTC and 5h ATTGGATCCTTATTTTTCACCATATAG) that contained KpnI and BamHI sites (underlined), or (5h AAAGGTACCGAATTCTAAGCATGAGGACTCTAC and 5h ATTCTCGAGTTTTTCACCATATAG) that contained EcoRI and XhoI sites (underlined), and VV WR DNA as template. The resultant DNA fragments were digested with the appropriate enzymes and cloned into plasmids pAcCL29-1 and pBAC1, respectively. The resultant plasmids, pAcN1L and pAcN1L-his, were sequenced to confirm the fidelity of the PCR-derived material and were used to construct AcNPV recombinants AcN1L and AcN1L-his,
Pulse–chase and immunoprecipitation. BS-C-1 cells were infected at 10 p.f.u. per cell with VV WR. At 4 h p.i. the culture medium was removed, the cells were washed in methionine- and cysteine-free medium and the cells were incubated in the same medium for 20 min. Cells were pulsed with 100 µCi [$&S]methionine and [$&S]cysteine (1000 Ci\mmol)\10' cells (APB) for 20 min, the cells were washed with DMEM containing 2 mM unlabelled methionine and cysteine and then incubated in the same. At the indicated times, the supernatants were collected and filtered (0n2 µm) to remove cellular debris. Cells were washed with ice-cold PBS before being scraped into lysis buffer (1n0 ml\10' cells) and harvested. For immunoprecipitations, cell extracts and supernatants were pre-adsorbed against protein A–agarose (Pierce) and then incubated with either α-N1L or α-A41L. Immune complexes were captured with protein A–agarose, washed, eluted in Laemmli buffer,
BJGG
Production of polyclonal antiserum and purification of IgG. A polyclonal antiserum (α-N1L) was generated by immunizing New Zealand White rabbits with the purified AN1L-his protein according to standard protocols (Harlow & Lane, 1988). The IgG fraction was isolated from the antiserum by precipitation with 65 % (w\v) (NH ) SO and %# % affinity purification on a HiTrap protein A–Sepharose column (APB) as instructed by the manufacturer.
Vaccinia virus N1L protein
Fig. 1. (a) Amino acid sequence comparisons of the N1L proteins from variola virus Bangladesh-1975 (VAR, accession no. L22579), VV strain Copenhagen (VV, M35027), cowpox virus strain GRI-90 (CPV, Y11842) and myxoma virus (MYX, AF170726). The alignment was constructed using CLUSTALW (Thompson et al., 1994) and formatted using GeneDoc (Nicholas & Nicholas, 1997). Identical amino acids are shown shaded in black ; identities across three of the sequences are highlighted in grey. The single Cys residue is marked with a dot. Bars above the sequence indicate regions predicted to be alpha helical. (b) Hydrophobicity profile of the N1L protein from VV Copenhagen. The hydrophobicity of the protein sequence was analysed with the program ProtScale (Kyte & Doolittle, 1982).
and proteins were resolved by SDS–PAGE (15 % gel) and visualized by fluorography.
Radio-iodination of the N1L protein. N1L protein was purified from the supernatants of AcN1L-infected insect cells as described above. This protein was then radio-iodinated using the Bolton–Hunter reagent as described previously for human interferon-α2 (Symons et al., 1995).
Immunofluorescence. BS-C-1 cells were grown on 13 mm glass coverslips and were infected with VV WR or v∆N1L at 1 p.f.u. per cell. For surface staining of live cells, the culture medium was removed at 18 h p.i. and was replaced with DMEM containing rabbit α-N1L IgG (diluted 1 : 100) or rat anti-B5R mAb 19C2 (Schmelz et al., 1994) (hybridoma culture supernatant diluted 1 : 100) and the incubation was continued for 1 h at 4 mC. Cells were washed three times with ice-cold PBS and then fixed and permeabilized by incubation in methanol at k20 mC for 10 min. Cells were washed thoroughly with PBS, and then incubated in PBS containing 10 % FBS for 20 min at room temperature followed by rhodamine-conjugated donkey anti-rabbit IgG, or Texas red bisothiocyanate (TRITC)-conjugated donkey anti-rat IgG (both from Jackson Laboratories) in PBS containing 10 % FBS for 30 min at 37 mC. Cells were washed three times in PBS containing 10 % FBS and once in water before mounting in Mowiol as described previously (Sanderson et al., 1996). To stain fixed and permeabilized cells, the culture medium was removed at 18 h p.i. and cells were fixed and permeabilized in methanol
as described above. Primary antibody staining was performed at 37 mC for 1 h. Addition of secondary conjugated antibodies and mounting were as described above. All samples were examined with a Zeiss LSM 510 laser scanning confocal microscope and images were captured and processed using Zeiss LSM Image Browser version 3.1.0.99.
Mouse infection models. The virulence of the recombinant viruses was determined in female BALB\c mice 6–8 weeks old. Mice were anaesthetized and infected intranasally with VV in 25 µl of PBS (Gardner et al., 2001), or by intradermal injection of 10% p.f.u. of VV in 10 µl in the left ear pinna (Tscharke et al., 2002). For intranasal infections, mice were weighed daily and signs of illness were scored as described previously (Alcamı! & Smith, 1992). Mice were euthanized if they lost more than 30 % of their body weight. For intradermal infections, the sizes of lesions on infected ears were estimated daily with the aid of a micrometer. To determine virus titres, infected ears were ground with a tissue homogenizer, subjected to three cycles of freezing and thawing and two sonications and the resulting homogenate was assayed on BS-C1 cells (Tscharke & Smith, 1999).
Results Bioinformatic analysis of the N1L protein
The published sequence of the VV WR N1L gene predicts a protein of 117 amino acids with a size of 13n8 kDa (Kotwal BJGH
N. Bartlett and others
Fig. 2. Expression of the N1L protein by AcNPV and VV. (a) Metabolic labelling. Sf21 cells were mock-infected or infected with AcN1L or AcNPV at 10 p.f.u. per cell. At 24 h p.i. the cells were radiolabelled for 2 h with [35S]methionine and [35S]cysteine (70 µCi/ml ; 100 µl per well) and proteins in the culture supernatant were analysed by SDS–PAGE and autoradiography. An arrow indicates the position of the N1L protein. (b) Immunoblot. Proteins in the culture supernatants of Sf21 cells that were mock-infected or infected with AcN1L, AcN1Lhis or AcNPV were separated by SDS–PAGE (15 %) gel, transferred to nitrocellulose and incubated with rabbit α-N1L (Methods). (c) Immunoblot. Cells were mock-infected or infected with the indicated VVs (Methods) and at 20 h p.i. the proteins in the culture supernatant were analysed by immunoblot using either rabbit α-N1L or pre-immune serum from the same animal. For all panels the positions of molecular size markers are indicated in kDa.
& Moss, 1988). The sequence of the N1L gene of our strain of VV WR (accession no. AF451287) differed from the published sequence by a single nucleotide change that resulted in an N23D amino acid substitution but was identical with the N1L sequence in VV strains Copenhagen and Tian Tan. The N1L protein is highly conserved in variola major virus (VAR) Bangladesh-1975 (Massung et al., 1994) and cowpox virus (CPV) GRI-90 (Shchelkunov et al., 1998). In VV strain modified vaccinia virus Ankara (MVA) the gene is truncated so that a BJGI
protein of only 113 amino acids is predicted (Antoine et al., 1998). Related genes are encoded by the leporipoxviruses Shope fibroma virus (Willer et al., 1999) and myxoma virus (Cameron et al., 1999) and by lumpy skin disease virus, a capripoxvirus (Tulman et al., 2001). In addition we sequenced the N1L gene from VV strains Wyeth (AF455803), Lister (AF455804), King Institute (AF455805) and USSR (AF455806) and found these to encode identical proteins to VV Copenhagen (data not shown). An alignment of the N1L
Vaccinia virus N1L protein
proteins encoded by VAR Bangladesh-1975, VV Copenhagen, CPV GRI-90 and myxoma virus is shown in Fig. 1(a). Note the single conserved cysteine residue and the truncation of the myxoma virus protein. All the N1L proteins lack a hydrophobic N-terminal signal sequence (Fig. 1b) and potential sites for attachment of N-linked carbohydrate side-chains ; however, the program 3D-pssm (Kelley et al., 1999, 2000) suggested that the protein is largely alpha-helical (horizontal bars in Fig. 1a). The N1L protein shares no significant amino acid similarity with non-poxvirus proteins.
Use of anti-N1L antibody to detect the N1L protein
To produce protein for biochemical characterization and to raise a polyclonal antiserum, the N1L protein was expressed in recombinant AcNPV with or without a C-terminal 6(his) tag (Methods). Fig. 2(a) shows that Sf21 cells infected with AcN1L express a protein of approximately 14 kDa that is not made by mock-infected cells or cells infected with AcNPV. The AcN1Lhis protein (AN1L-his) was purified and used to generate a rabbit polyclonal antiserum (Methods). This antiserum detected a protein of 14 kDa in the supernatant of Sf21 cells infected with AcN1L, and a slightly larger protein from cells infected with AcN1L-his, but did not detect proteins from mock-infected cells, or from cells infected with AcNPV. AN1Lhis was purified from the supernatant of AcN1L-his-infected cells and its N-terminal sequence was determined and found to be identical to the predicted primary translation product. The polyclonal antiserum was also used to identify the N1L protein in concentrated culture supernatants from cells infected with VV. Fig. 2(c) shows that a protein of 14 kDa was made by cells infected with vN1L and vN1L-rev but not by mockinfected cells or cells infected with v∆N1L (see below). These data confirmed the specificity of the antiserum and that the expression of N1L by the different viruses was as predicted.
Growth properties of N1L deletion and revertant viruses Fig. 3. Analysis of the N1L protein made by VV. (a) Cells were mockinfected or infected with vN1L for 15 h in the presence of AraC, monensin or tunicamycin, or in the absence of drug (Methods). Proteins in cell extracts were resolved by SDS–PAGE, transferred to nitrocellulose and the membrane was probed with α-N1L rabbit IgG. (b) Cells were infected as in (a) in the absence of drugs and cells and supernatants were collected at 18 h p.i. Supernatants were clarified by low-speed centrifugation (2000 g, 10 min) and the clarified supernatant was then centrifuged at higher speed to pellet virus particles (14 000 g, 2 h). The resulting supernatant was retained and analysed by immunoblotting before or after concentration 12-fold in a Centriprep YM-10 centrifugal filter device (Amicon). The virus pellet was re-suspended in Laemmli protein loading buffer. To prepare samples from cells that had comparable amounts of N1L protein to supernatants, dilutions of the cell extract was prepared. Lanes 1–4 : cell extracts from 4n2i104 (1), 2n1i104 (2), 8n4i103 (3) or 4n2i103 (4) cell equivalents. Lanes 5 and 6 : supernatants from 4n2i104 (5) or 5i105 (6) cell equivalents. Lane 7 : pellet sample, 4n2i106 cell equivalents. Proteins in all samples were separated on
Previous work demonstrated that the N1L gene is not essential for virus replication in tissue culture and that a mutant virus with the N1L gene disrupted was attenuated in vivo (Kotwal et al., 1989). However, in the absence of a revertant virus it was not proven that the loss of N1L contributed to this attenuated phenotype. Therefore, we constructed wild-type, deletion and revertant viruses (Methods) and studied their properties in cell culture and in animal models. The genomic structure of these viruses was analysed by PCR and Southern blotting (see supplementary data 1 at JGV Online : http :\\
duplicate SDS–polyacrylamide gels and membranes were immunoblotted with either the anti-N1L rabbit IgG or mAb AB1.1 against the VV D8L protein (Parkinson & Smith, 1994).
BJGJ
N. Bartlett and others
Fig. 4. Pulse–chase analysis of the N1L protein expressed by VV WR. Cells were infected and pulsed with isotope for 20 min and proteins in cell extracts and supernatants were harvested at the indicated time post-chase and were immunoprecipitated and analysed by SDS–PAGE and fluorography (Methods). The positions of protein size markers are indicated in kDa.
vir.sgmjournals.org). After DNA was extracted from purified virus and digested with HindIII, the HindIII N and C fragments (approximately 1n6 kb and 12n2 kb, respectively) were present with vN1L and vN1L-rev. In contrast, with v∆N1L the HindIII N fragment was not detected and the C fragment increased in size slightly due to the loss of the HindIII site between the N and C fragments (Supplementary data Fig. 1a). Similarly, after digestion with either EcoRI or BglII, bands of equivalent size were detected with vN1L and vN1L-rev but these were reduced in size by approximately 350 bp for v∆N1L. These observations confirmed the absence of the N1L gene from v∆N1L, consistent with the lack of N1L protein expression by this virus (Fig. 2c). The growth properties of vN1L, v∆N1L and vN1L-rev were examined in cell culture and found to be indistinguishable. The rate of increase in virus infectivity after infection and the final titre obtained were the same for each virus (supplementary data 2a). Moreover, there were no differences in the amount of intracellular or extracellular virus produced and the plaques BJHA
formed by each virus were of equal size (supplementary data 2b). These data confirm that the N1L gene is dispensable for virus growth in cell culture. The N1L protein is predominantly intracellular
To examine the kinetics of N1L protein expression, cells were infected with VV WR in the presence or absence of AraC, an inhibitor of DNA replication and late gene expression. Immunoblotting detected the 14 kDa N1L protein in cell extracts in the presence of AraC indicating early expression (Fig. 3a). This was consistent with transcriptional data that identified early and late RNA start sites upstream of the N1L initiation codon (Kotwal & Moss, 1988). Addition of monensin or tunicamycin did not affect the size of the N1L protein indicating this protein was not post-translationally modified by attachment of O- or N-linked carbohydrate (Fig. 3a). Preliminary experiments indicated that the majority of the N1L protein was present in cell extracts rather than culture supernatants at 24 h p.i. (data not shown). To investigate the
Vaccinia virus N1L protein
Fig. 5. Analysis of the location of the N1L protein in infected cells by immunofluorescence. Cells were infected with the indicated viruses and processed for immunofluorescence (Methods). In (a)–(c) cells were fixed and permeabilized before staining with the indicated Ab. In (d)–(i) live cells were incubated at 4 mC with the indicated Ab prior to fixation and permeabilization. Bound Abs were detected with secondary conjugates and examined by confocal microscopy (Methods). Phase-contrast images of panels (d) and (g) are shown in panels (e) and (h). Scale bars, 20 µm.
relative distribution of the N1L protein, cell extracts and supernatants were prepared from VV WR-infected cells and analysed by immunoblotting. To obtain an N1L signal from the cell extract that was equivalent to that present in the culture supernatant, a series of dilutions of the cell extract was prepared and the supernatant was analysed before and after concentration 12-fold. These analyses showed that 90 % of the N1L protein was associated with cells and, at the exposure shown, N1L was detected in the supernatant only after the sample had been concentrated (Fig. 3b). Kotwal et al. (1988) had used supernatants concentrated between 20- and 50-fold to detect the N1L protein, but did not analyse cell extracts. To compare the release of N1L into the supernatant with other VV proteins, the samples were also immunoblotted with mAb AB
1.1, which recognizes the D8L protein (Parkinson & Smith, 1994) that is present in cytoplasmic factories, on the surface of IMV particles and in virions released from cells (Fig. 3b). As for N1L, the majority ( 90 %) of D8L was retained in the cell fraction, and the released D8L protein was detected only after concentration of the supernatant. If the supernatant was centrifuged to collect virus particles, the great majority of the D8L protein was detected in the pellet fraction. In contrast, N1L remained in the soluble fraction after such treatment. Collectively, these data indicated that N1L was predominantly a cell-associated protein but that some ( 10 %) was released into the culture medium as soluble protein. To examine the release of the N1L protein further, the kinetics of N1L protein release from cells were investigated by BJHB
N. Bartlett and others
Fig. 6. The N1L protein made by VV is a homodimer. (a) Concentrated supernatants from BS-C-1 cells infected with VV WR and N1L purified from E. coli were resolved by SDS–PAGE in the presence or absence of 2-ME. Proteins were transferred to nitrocellulose and immunoblotted with α-N1L IgG. Alternatively, N1L protein expressed by AcN1L was purified, labelled with
BJHC
Vaccinia virus N1L protein
Fig. 7. The N1L protein contributes to virulence in a murine intranasal model. (a) Groups of five mice were infected intranasally with 104 (a, c) or 105 (b, d) p.f.u. of vN1L, v∆N1L or vN1L-rev and the weights (a, b) of the animals and signs of illness (c, d) were recorded daily. The mean weight of each group of animals on each day is expressed as a percentage of the mean weight of the same group of animals on day zero. Signs of illness were assigned an arbitrary scale of 1 to 4 as defined previously (Alcamı! & Smith, 1992). Mean values (pSEM) for each group of animals are shown.
pulse–chase analysis and were compared with the secretion of the VV A41L protein, an immunomodulatory glycoprotein secreted into the culture supernatant (Ng et al., 2001). VVinfected cells were pulsed with [$&S]methionine and [$&S]cysteine and chased for the indicated periods of time. Cells and supernatants were harvested and proteins were immunoprecipitated with either α-N1L IgG or anti-A41L polyclonal serum, resolved by SDS–PAGE and visualized by fluorography (Fig. 4). The A41L protein was exported efficiently from infected cells and the majority of radioactive protein was in the supernatant within 60 min of pulse. In contrast, the N1L protein appeared to be released from cells slowly and at all times examined the great majority remained in the cell extract. Therefore, it is unlikely that N1L is a true secreted protein, but rather its presence in supernatants is most likely a result of leakage from infected cells. The distribution of N1L protein was also examined in baculovirus-infected Sf21 cells (data not shown). Cells were infected with AcNPV, AcN1L or AcA41L, which expresses the VV strain WR A41L secretory glycoprotein (Ng et al., 2001). At 24, 48 or 72 h p.i. the cells and supernatants were collected and analysed by immunoblotting with either α-N1L or antiA41L Ab. At 24 h p.i. N1L was an abundant protein in cells but
was absent from the supernatant, but the N1L protein appeared in the supernatant by 48 and 72 h p.i. In contrast, the A41L protein was distributed equally between cells and the supernatant by 24 h p.i. and continued to accumulate in the supernatant with time. The presence of the N1L protein in the supernatant at only very late times after infection is consistent with non-specific release due to cell lysis late after infection. Consonant with these observations, recombinant N1L protein made by Pichia pastoris was retained within yeast cells and was not secreted (data not shown). The location of the N1L protein was also examined by immunofluorescence (Fig. 5). BS-C-1 cells were infected with vN1L or v∆N1L for 16 h and were stained with α-N1L IgG and mAb 19C2 directed against the B5R protein that is present on the cell surface and cell-associated enveloped virus and extracellular enveloped virus particles. Bound Abs were detected with appropriate secondary Abs and visualized by confocal microscopy (Methods). The NIL protein was detected predominantly in the cytoplasm of WR-infected cells that had been permeabilized prior to addition of Ab (Fig. 5a), but only background fluorescence was observed if the cells were stained prior to permeabilization (Fig. 5d), or if the cells were infected with v∆N1L (Fig. 5b, g). Phase contrast images confirmed the
125
I, and analysed by SDS–PAGE in the presence or absence of 2-ME before visualization by autoradiography. (b) N1L protein made by VV or E. coli as in (a) was separated by PAGE (10 % gel) in the absence of SDS, with or without 2-ME, and analysed by immunoblotting with rabbit α-N1L IgG. N1L protein expressed by E. coli and AcN1L was analysed in parallel together with the 35 kDa chemokine-binding protein from VV Lister (Alcamı! et al., 1998) ; both were detected by Coomassie blue staining. (c) N1L protein made by VV as in (a) was mixed with protein size markers (APB) ribonuclease A (15n7 kDa), chymotrypsin A (20 kDa), ovalbumin (48n6 kDa) and albumin (63n7 kDa) and analysed by gel filtration. Proteins present in fractions 7–17 were analysed by SDS–PAGE and immunoblotting with α-N1L IgG. The positions of molecular size markers in kDa are indicated on the gels shown in (a) and (c).
BJHD
N. Bartlett and others
presence of cells in the fields shown in panels (d) and (g) (Fig. 5e, h, respectively). In contrast, the B5R protein was detected in cells infected with either virus and was detected in cells that had or had not been permeabilized (Fig. 5c, f, i). These data show that N1L is an intracellular protein and is not present on the cell surface. The VV N1L protein is a non-covalent homodimer
To determine if the VV N1L protein was monomeric or oligomeric, the protein was analysed by PAGE with or without 2-mercaptoethanol (2-ME) and SDS (Fig. 6a, b). Recombinant N1L proteins from E. coli or Sf21 cells were analysed in parallel. The N1L protein made by VV migrated as a monomer (" 14 kDa) in the presence of SDS with or without reducing agent, whereas much of the N1L protein from E. coli and AcN1L migrated as a dimer in the absence of 2-ME (Fig. 6a). Under native conditions (without SDS) and in the presence of 2-ME, N1L from VV and E. coli each had an electrophoretic mobility similar to the monomeric 35 kDa chemokine-binding protein from VV strain Lister (Alcamı! et al., 1998) (Fig. 6b). On these native gels, the 14 kDa form of N1L from VV or E. coli was detected only if SDS was included in the sample loading buffer (data not shown). However, N1L protein from bacteria formed larger oligomers in the absence of 2-ME. These data suggested that the N1L protein made by VV might be a dimer or trimer and this was investigated further by gel filtration (Fig. 6c). The concentrated supernatant from VV-infected cells (Fig. 6c) or from VV-infected cell extracts (data not shown) was fractionated by gel filtration and analysed by SDS–PAGE and immunoblotting. The N1L protein eluted in fractions 11, 12 and 13 with the majority of protein in fraction 12 and more in fraction 13 than 11. The sizes of proteins eluting in fractions 11, 12 and 13 were calculated by comparison with protein molecular size markers to be 34n4, 28n6 and 23n7 kDa, respectively. The predicted size of the N1L complex was therefore slightly less than 28n6 kDa, indicating N1L exits as a dimer under physiological conditions. Deletion of N1L reduces the virulence of vaccinia virus
The virulence of the deletion mutant v∆N1L was examined in two murine models in comparison with wild-type and revertant controls. In the intranasal model, infection with v∆N1L at doses of 10% and 10& p.f.u. induced fewer signs of illness and induced less weight loss than controls (Fig. 7a). These differences were significant for both weights (P 0n02) and signs of illness (P 0n02) at 10% p.f.u and for signs of illness at 10& p.f.u (P 0n03). Moreover, at both doses no mice infected with v∆N1L had lost 30 % of their body weight by 14 days p.i. in contrast to all animals infected with the control viruses and which therefore required euthanasia in compliance with ethical requirements. Even at the higher dose of 10' p.f.u. three out of five mice infected with v∆N1L survived. In the intradermal model, where the infection remains local and there is little, if any, virus dissemination to other organs BJHE
Fig. 8. The N1L protein contributes to virulence in a murine intradermal model. (a) Groups of five mice were infected by intradermal injection of the indicated virus dose into the left ear pinna. Each day the lesion size was determined as described previously (Tscharke & Smith, 1999), and the data shown are the mean lesion size for each group of animals. The black bar indicates the days on which the data for v∆N1L are significantly different from the vN1L and vN1L-rev groups (P 0n005, Student’s ttest). (b) Analysis of virus titres in infected ears. At days 2, 6 and 11, animals were sacrificed and ears were removed and the titre of infectious virus was determined as described previously (Tscharke & Smith, 1999). The data are presented as the mean log10 p.f.u./earpSEM.
(Tscharke & Smith, 1999), infection with v∆N1L gave lower lesion sizes from days 7–19 p.i. compared to control viruses and these were significantly different (P 0n05) on days 12 to 17 inclusive (Fig. 8a). In addition, the titre of infectious virus present in infected ears was reduced after infection with v∆N1L at days 6 and 11 (Fig. 8b). Therefore, in both models of infection the deletion of N1L caused significant virus attenuation.
Discussion A characterization of the VV protein N1L is presented. Hitherto, the N1L protein was described as a secreted protein that contributes to virulence. However, data presented here show that the protein is predominately intracellular ( 90 %) and exists as a non-covalent homodimer. Using an N1L deletion mutant and appropriate wild-type and revertant controls, the N1L protein was shown to enhance VV virulence in intradermal and intranasal models of infection.
Vaccinia virus N1L protein
Although the N1L protein was described originally as a secreted protein, analysis of the distribution of the N1L protein showed that it was present predominantly within infected cells, and only a small fraction ( 10 %) was released into the cell culture medium (Fig. 3b). How this protein is released is unclear, but the N terminus of N1L lacks a conventional signal peptide and amino acid sequencing showed that the N1L protein released from insect cells infected with AcN1L is uncleaved at the N terminus. Moreover, pulse–chase analyses established that in comparison with glycoprotein A41L, which is expressed by VV during the same phase of infection, has a signal peptide and is secreted from infected cells, the N1L protein leaks out of cells very slowly and the majority of the protein is always present within cells (Fig. 4). The N1L protein also has a distribution comparable with the VV D8L protein that is described as intracellular and a component of released virions. In addition, immunofluorescence showed the protein was predominantly cytoplasmic and was not present on the cell surface (Fig. 5). Collectively, these observations suggest that the small fraction of the total N1L protein released into the cell supernatant might be due to lysis of some cells following virus infection ; alternatively, some N1L protein might be released by an unidentified and unconventional pathway. Biochemical analyses of N1L protein made by VV showed that the protein is a homodimer, and that this dimer can be disrupted by treatment with SDS but not reducing agents. So non-covalent bonds hold the dimer together. Recombinant N1L protein, synthesized in E. coli or in insect cells infected with recombinant baculoviruses, forms additional oligomeric structures that contain disulphide bonds. As there is only a single cysteine residue in N1L, these bonds must be intermolecular. Purification of recombinant N1L was therefore performed in the presence of reducing agent. VV expresses many proteins that are non-essential for virus replication in cell culture but which contribute to virus virulence in vivo and several proteins of this group function as immunomodulators to affect the host response to infection. VV immunomodulators may be grouped according to their site of action. Those proteins secreted from the infected cell usually bind to and inhibit the function of host proteins such as interferons, cytokines, chemokines or complement, whereas intracellular proteins may interfere with interferon-induced antiviral proteins, cell signalling pathways or apoptosis. The correct location of the protein is essential to mediate these different functions. In several cases the function of VV immunomodulatory proteins has been inferred from computational analyses of amino acid sequences that revealed similarities between a VV protein and a host protein of known function. In other cases, the function of a virus protein has been deduced by functional studies. In the case of N1L, although bioinformatic analyses established that the protein is conserved in several orthopoxviruses and in other chordopoxvirus genera, no amino acid similarity with host proteins was detected. Predictions of the secondary structure of N1L
showed a largely alpha-helical protein that has a similar overall topology to other small alpha-helical proteins such as IL-10 and interferon-γ. This similarity, taken together with the proposed secreted nature of N1L, led this protein to be described by some as a virokine (Chang et al., 1992) and suggested a possible mechanism by which N1L contributed to virulence. However, data presented here cause the mechanism of action of N1L to be reconsidered. Computational analyses suggest that N1L is also related structurally to intracellular alpha-helical proteins such as the N-terminal actin-cross-linking domain of fimbrin (pdb 1aoa), histone acetyltransferase bromodomain (pdb 1b91) and the N-terminal domain of transcription elongation factor TFIIS (pdb 1eo0). It remains possible that the small fraction of N1L that is released from cells mediates an important extracellular function ; however, it is more likely that the site of action of N1L is intracellular where the majority of the protein is located. Determination of the mechanism of action of N1L requires additional study. Data presented here confirm that N1L promotes VV virulence and does so in both the intradermal and intranasal models of infection in mice. This is in contrast to a variety of other VV proteins that are associated with virulence only after inoculation by one of these routes (Tscharke et al., 2002). Furthermore in each model, the attenuation caused by deletion of N1L is amongst the strongest seen for genes that do not affect growth in culture. The attenuation seen in the intradermal model was accompanied by a reduction in virus titre in the infected skin, indicating that N1L expression may affect either virus growth in vivo or influence the rate at which virus is cleared by the host response to infection. In conclusion, the N1L protein is demonstrated to be a noncovalent homodimer that is largely intracellular and contributes to virulence in intradermal and intranasal models of infection by an unknown mechanism. This work was supported by programme grants from the Medical Research Council and The Wellcome Trust. We thank Tony Willis (Department of Biochemistry, University of Oxford) for amino acid sequencing. D. C. T. was a Wellcome Trust Travelling Research Fellow and G. L. S. is a Wellcome Trust Principal Research Fellow.
References Alcamı! , A. & Koszinowski, U. H. (2000). Viral mechanisms of immune
evasion. Trends in Microbiology 8, 410–418. Alcamı! , A. & Smith, G. L. (1992). A soluble receptor for interleukin-1
beta encoded by vaccinia virus : a novel mechanism of virus modulation of the host response to infection. Cell 71, 153–167. Alcamı! , A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633–4639. Alcamı! , A., Symons, J. A., Collins, P. D., Williams, T. J. & Smith, G. L. (1998). Blockade of chemokine activity by a soluble chemokine binding protein from vaccinia virus. Journal of Immunology 160, 624–633. Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain : comparison with other orthopoxviruses. Virology 244, 365–396. BJHF
N. Bartlett and others Boyle, D. B. & Coupar, B. E. H. (1988). A dominant selectable marker
for the construction of recombinant poxviruses. Gene 65, 123–128. Buller, R. M., Smith, G. L., Cremer, K., Notkins, A. L. & Moss, B. (1985). Decreased virulence of recombinant vaccinia virus expression
vectors is associated with a thymidine kinase-negative phenotype. Nature 317, 813–815. Cameron, C., Hota-Mitchell, S., Chen, L., Barrett, J., Cao, J. X., Macaulay, C., Willer, D., Evans, D. & McFadden, G. (1999). The
complete DNA sequence of myxoma virus. Virology 264, 298–318. Chang, P. Y., Lai, A. C. & Pogo, B. G. (1992). Attenuated deletion mutant of vaccinia virus IHD-W recovered virulence by reinsertion of a terminal restriction fragment. Microbial Pathogenesis 13, 49–59. Falkner, F. G. & Moss, B. (1990). Transient dominant selection of recombinant vaccinia viruses. Journal of Virology 64, 3108–3111. Gardner, J. D., Tscharke, D. C., Reading, P. C. & Smith, G. L. (2001).
Moss, B., Winters, E. & Cooper, J. A. (1981). Deletion of a 9,000-basepair segment of the vaccinia virus genome that encodes nonessential polypeptides. Journal of Virology 40, 387–395. Ng, A., Tscharke, D. C., Reading, P. C. & Smith, G. L. (2001). The vaccinia virus A41L protein is a soluble 30 kDa glycoprotein that affects virus virulence. Journal of General Virology 82, 2095–2105. Nicholas, K. B. & Nicholas, H. B. (1997). GeneDoc : a tool for editing and annotating multiple sequence alignments, 2.5.000. Distributed by the author. Panicali, D., Davis, S. W., Mercer, S. R. & Paoletti, E. (1981). Two major variants present in serially propagated stocks of the WR strain of vaccinia virus. Journal of Virology 37, 1000–1010. Parkinson, J. E. & Smith, G. L. (1994). Vaccinia virus gene A36R encodes a Mr 43–50 K protein on the surface of extracellular enveloped virus. Virology 204, 376–390.
Vaccinia virus semaphorin A39R is a 50–55 kDa secreted glycoprotein that affects the outcome of infection in a murine intradermal model. Journal of General Virology 82, 2083–2093.
Perkus, M. E., Goebel, S. J., Davis, S. W., Johnson, G. P., Norton, E. K. & Paoletti, E. (1991). Deletion of 55 open reading frames from the
Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus.
Sanderson, C. M., Parkinson, J. E., Hollinshead, M. & Smith, G. L. (1996). Overexpression of the vaccinia virus A38L integral membrane
Virology 179, 247–266. Harlow, E. & Lane, D. (1988). Antibodies : a Laboratory Manual, pp. 1–726. Cold Spring Harbor, NY : Cold Spring Harbor Laboratory. Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991).
Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103–20109. Kelley, L. A., MacCallum, R. & Sternberg, M. J. E. (1999). Recognition of remote routeing homologies using three-dimensional information to generate a position specific scoring matrix in the program 3D-PSSM. In Third Annual Conference on Computational Molecular Biology, pp. 218–225. Edited by S. Istrail, P. Pevzner & W. Waterman. New York : The Association for Computational Machinery. Kelley, L. A., MacCallum, R. M. & Sternberg, M. J. (2000). Enhanced genome annotation using structural profiles in the program 3D-PSSM. Journal of Molecular Biology 299, 499–520. Kotwal, G. J. & Moss, B. (1988). Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant. Virology 167, 524–537. Kotwal, G. J., Hugin, A. W. & Moss, B. (1989). Mapping and insertional mutagenesis of a vaccinia virus gene encoding a 13,800-Da secreted protein. Virology 171, 579–587. Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157, 105–132. Mackett, M., Smith, G. L. & Moss, B. (1985). The construction and characterization of vaccinia virus recombinants expressing foreign genes. In DNA Cloning : a Practical Approach, pp. 191–211. Edited by D. M. Glover. Oxford : IRL Press. Massung, R. F., Liu, L. I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the
complete genome of smallpox variola major virus strain Bangladesh1975. Virology 201, 215–240. Moss, B. (2001). Poxviridae : the viruses and their replication. In Virology, 4th edn, pp. 2849–2883. Edited by D. M. Knipe & P. M. Howley. Philadelphia : Lippincott Williams & Wilkins. Moss, B. & Shisler, J. L. (2001). Immunology 101 at poxvirus U : immune evasion genes. Seminars in Immunology 13, 59–66.
BJHG
termini of vaccinia virus. Virology 180, 406–410.
protein promotes Ca#+ influx into infected cells. Journal of Virology 70, 905–914. Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E., Shida, H., Hiller, G. & Griffiths, G. (1994). Assembly of vaccinia virus : the second wrapping
cisterna is derived from the trans Golgi network. Journal of Virology 68, 130–147. Shchelkunov, S. N., Safronov, P. F., Totmenin, A. V., Petrov, N. A., Ryazankina, O. I., Gutorov, V. V. & Kotwal, G. J. (1998). The genomic
sequence analysis of the left and right species-specific terminal region of a cowpox virus strain reveals unique sequences and a cluster of intact ORFs for immunomodulatory and host range proteins. Virology 243, 432–460. Smith, G. L., Symons, J. A., Khanna, A., Vanderplasschen, A. & Alcamı! , A. (1997). Vaccinia virus immune evasion. Immunological Reviews 159, 137–154. Symons, J. A., Alcami, A. & Smith, G. L. (1995). Vaccinia virus encodes a soluble type I interferon receptor of novel structure and broad species specificity. Cell 81, 551–560. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W : improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751–2755. Tscharke, D. C., Reading, P. C. & Smith, G. L. (2002). Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes. Journal of General Virology 83, 1977–1986. Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Kutish, G. F. & Rock, D. L. (2001). Genome of lumpy skin disease virus. Journal of Virology 75,
7122–7130. Willer, D. O., McFadden, G. & Evans, D. H. (1999). The complete
genome sequence of Shope (rabbit) fibroma virus. Virology 264, 319–343. Wittek, R., Muller, K., Menna, A. & Wyler, R. (1978). Length
heterogeneity in the DNA of vaccinia virus is eliminated by cloning the virus. FEBS Letters 90, 41–46. Received 7 February 2002 ; Accepted 22 March 2002