Thymidylate Synthase and Dihydropyrimidine Dehydrogenase Levels ...

Download PDF
3 downloads 0 Views 3MB Size Report
Comment
phosphorylase (UP), thymidine phosphorylase (TP), uridine monophosphate kinase (UMPK), and orotate phosphoribosyl transferase (OPRT) (Maring et al., ...
Mol. Cells OS, 344-349, October 31, 2008

Molecules and Cells ©2008 KSMCB

Thymidylate Synthase and Dihydropyrimidine Dehydrogenase Levels Are Associated with Response to 5-Fluorouracil in Caenorhabditis elegans Seongseop Kim1,3, Dae-Hun Park1,2,3, and Jaegal Shim1,* 5-Fluorouracil (5-FU), a pyrimidine antagonist, has a long history in cancer treatment. The targeted pyrimidine biosynthesis pathway includes dihydropyrimidine dehydrogenase (DPD), which converts 5-FU to an inactive metabolite, and thymidylate synthase (TS), which is a major target of 5-FU. Using `~ÉåçêÜ~ÄÇáíáë=ÉäÉÖ~åë as a model system to study the functional and resistance mechanisms of anticancer drugs, we examined these two genes in order to determine the extent of molecular conservation between `K= ÉäÉÖ~åë and humans. Overexpression of the worm DPD and TS homologs (DPYD-1 and Y110A7A.4, respectively) suppressed germ cell death following 5-FU exposure. In addition, DPYD-1 depletion by RNAá resulted in 5-FU sensitivity, while treatment with vNNM^T^KQ RNAá and 5-FU resulted in similar patterns of embryonic death. Thus, the pathway of 5-FU function appears to be highly conserved between `K=ÉäÉÖ~åë and humans at the molecular level.

INTRODUCTION The anti-cancer drug, 5-fluorouracil (5-FU), has been used for more than 40 years as a cancer therapy for colorectal, stomach, ovarian, and head and neck cancers. In fact, 5-FU is still a mainstay drug for the treatment of colorectal cancer. 5-FU induces cell cycle arrest and apoptosis of cancer cells by inhibiting both RNA function and DNA synthesis. Like other pyrimidine antagonists, 5-FU is a pro-drug and is converted to an active drug via the pyrimidine biosynthesis pathway. Therefore, the function of this drug is depended on the activities of the pyrimidine synthesis enzymes including dihydropyrimidine dehydrogenase (DPD), thymidylate synthase (TS), uridine phosphorylase (UP), thymidine phosphorylase (TP), uridine monophosphate kinase (UMPK), and orotate phosphoribosyl transferase (OPRT) (Maring et al., 2005). Dihydropyrimidine dehydrogenase (DPD), one of the first responding enzymes, is a rate-limiting enzyme for 5-FU catabo-

lism and is related to tumor sensitivity (Beck et al., 1994). The expression and activity of this enzyme are very high in the liver. DPD converts 5-FU to the inactive metabolite 5, 6dihydrofluorouracil (DHFU). About 80 to 90 percent of the 5-FU dose is catalyzed by DPD in the liver. Expression levels of DPD in cancer cells are closely related to 5-FU sensitivity (Ishikawa et al., 1999). As a result, 5-FU toxicity is accompanied by suppression of bone marrow, diarrhea, alopecia, and nausea, and these side effects are more severe in patients exhibiting low DPD expression (Katona et al., 1998). Indeed, in patients with a DPD enzyme deficiency, 5-FU chemotherapy is associated with severe, life-threatening toxicity (Hooiveld et al., 2004). On the other hand, high expression of thymidylate synthase (TS), which is the major target enzyme of 5-FU, in cancer cells leads to resistance to 5-fluorouracil (Habara et al., 2001). Recently, single nucleotide polymorphisms in the tandem repeats in the 5′ upstream region of the TS gene were found to affect TS expression. Interestingly, cancer cells that express low levels of TS exhibit 5-FU sensitivity (Morganti et al., 2005). Expression of TS is induced by 5-FU and is regulated by the cell cycle-specific transcription factor E2F (Obama et al., 2002). TS has been shown to function as a translational regulator of cellular gene expression and to interact with several cellular proteins including p53 (Liu et al., 2002; Wu et al., 2004). As a result, TS has been implicated as a biomarker for prognosis in pyrimidine antagonist therapy. Other reports, however, have indicated an incongruity between viability and TS expression level (Nita et al., 1998) as well as a discrepancy between TS mRNA and protein levels (Miyamoto et al., 2001). Nevertheless, the expression levels of TS are closely related to 5-FU function and resistance in general. Therefore, many trials have been conducted to develop direct TS inhibitors such as raltitrexed (Rustum et al., 1997). In this study, we examined the anti-cancer drug resistance mechanism in cancer cells using `K=ÉäÉÖ~åë as a genetic model. Although `K= ÉäÉÖ~åë has been used as a model system in pharmacogenetics and chemical genetics, this organism has

1

Cancer Experimental Resources Branch, National Cancer Center, Goyang 411-769, Korea, 2Korea Institute of Oriental Medicine, Daejeon 305-811, Korea, 3These authors contributed equally to this work. *Correspondence: [email protected] Received February 18, 2008; revised June 26, 2008; accepted June 30, 2008; published online July 9, 2008 Keywords: 5-fluorouracil, `K=ÉäÉÖ~åë, dihydropyrimidine dehydrogenase, thymidylate synthase

Seongseop Kim et al.

just begun to be employed to study anti-cancer drugs such as farnesyl transferase inhibitors (Lackner et al., 2005). Following treatment of `K= ÉäÉÖ~åë with 5-FU, germ cell death was observed, and worm development was inhibited (Kim and Shim, 2008). Here, a functional study of `K=ÉäÉÖ~åë DPD and TS homologs provided convincing evidence that 5-FU function and resistance is evolutionarily conserved at the molecular level between humans and worms. Thus, this findings support the use of `K= ÉäÉÖ~åë to study the functional mechanism of anticancer drugs.

MATERIALS AND METHODS `K=ÉäÉÖ~åë strains and 5-FU treatment= The standard Bristol N2 strain was used for the wild-type worms. The vNNM^T^KQ deletion mutant (íãOQOV) was a gift from Dr. Shohei Mitami. The=vNNM^T^KQ EíãOQOVF deletion was confirmed in these worms by PCR. In addition, homozygous íãOQOV embryos died. `K= ÉäÉÖ~åë culture was performed as previously described by Brenner (Brenner, 1974). The 5-FU was added to NGM (Nematode Growth Media) plates before pouring. To observe germ cell and embryo lethality, late L4 worms were transferred onto plates containing several concentrations of 5-FU (400 nM, 5 nM, or 2 nM). Sequence alignment= = The sequences were aligned using the Macvector program (IBI). Dashes in sequence alignments represent gaps introduced to optimize alignments. GenBank accession numbers of the proteins used in the sequence alignments are as follows: human DPD (NP000101) and human TS (BAB83677). The following `K= ÉäÉÖ~åë protein sequences were obtained from Wormbase (www.wormbase.org): DPD homolog (CE38489) and TS homolog (CE24214). = GFP fusion constructs, microinjection, and microscopy= The DPYD-1::GFP plasmid, which expresses full-length DPYD1 fused with GFP at the C-terminus, was constructed with PCR of genomic DNA using the C25F6.1-1 and C25F6.1-2 primers (see below). The 6.7-kb PCR product was inserted into the pPD95.77 vector (Dr. Andrew Fire) using the mëíI and pã~I restriction enzyme sites. The full-length Y110A7A.4::GFP was also generated with PCR of genomic DNA using the Y110A7A.4-1 and Y110A7A.4-2 primers (see below). The 3.35kb PCR product was inserted into the pPD95.77 vector using the mëíI and _~ãHI restriction enzyme sites. Both DPYD1::GFP and Y110A7A.4::GFP plasmids were sequenced to confirm the DNA integrity. Since vNNM^T^KQ appears to be in an operon composed of vNNM^T^KUI= vNNM^T^KTI and vNNM^T^KS, a évNNM^T^KQ::GFP construct, which expresses GFP under the control of the vNNM^T^KQ promoter, was also generated. In this case, the Y110A7A.4-6 and Y110A7A.4-7 primer set (see below) was used to amplify the upstream region of Y110A7A.8. Similar “Materials and Methods” were used for generation of the DPD and TS overexpression constructs, except the C25F6.1-3 and Y110A7.4-3 primers were used. Both of these primers contain stop codons. The following primer sequences were used for generation of these constructs: C25F6.1-1: GCTCTGCAGTGCCGACAGCGTCCATAC, C25 F6.1-2: TATCCCGGGTGCATTCCACCAGTAGTATCTAG, C 25F6.1-3: AAACCCGGGTTACTGCATTCCACCAGTAGTATC, Y110 A7A.4-1: TTACTGCAGTTTGTAATTCCGACAGTATC, Y110A7A.4-2: AATGGATCCAACAGCCATATCCATTGGGA, Y110A7A.4-3: CAAGGATCCTCAAACAGCCATATCCATTGG, Y110A7A.4-6: TTTCTGCAGGAGCTATCGAGAAGTAGAACG-

345

AG, and Y110A7A.4-7: TTTCCCGGGCGAAGTACGGTATGCGACTCC. Plasmid DNA was purified using a commercial midi prep kit (Qiagen, Cat. #12145) for microinjection. Microinjection was carried out by injecting each plasmid mixed with pRF4 into the gonads of young adult hermaphrodites using an Axiovert 200 microscope (Carl Zeiss) and microinjection system (Narishige and Eppendorf). The pRF4 plasmid carried a dominant mutation in the êçäJS gene and was, thus, used for selection. The concentration of total injected DNA (including 75 μg/ml of marker DNA) was 150 μg/ml. The worms were photographed using the Imager M1 microscope (Carl Zeiss) and Axiocam digital camera (Carl Zeiss). = RT-PCR and RNAá= = Total RNA from the N2 strain was prepared using the Trizol reagent (Invitrogen). Reverse transcription was performed using the Superscript II or III kit (Invitrogen). Both `K= ÉäÉÖ~åë= ÇéóÇJN and vNNM^T^KQ cDNAs were subcloned into pBluescript using RT-PCR. PCR products generated using T3 and T7 primers from full-length cDNA clones were used as template DNAs for RNA synthesis. A commercially available áå= îáíêç transcription kit (Promega, Cat. #P2075, P2083) was used for RNA synthesis. Unmodified RNA was resuspended in DEPC-treated water at several concentrations for injection. Following microinjection of double-stranded RNA (dsRNA), the animals (P0) were transferred to new plates every 12 h, and F1 progeny were counted and analyzed. For RT-PCR, total RNA was prepared from N2 worms soaked in M9 buffer with or without 5-FU (400 μM) for 5 h. Then, an equal amount of RNA (1 μg per 20 μl reaction volume) was used for reverse transcription. After testing several genes such as actin and tubulin, βtubulin (íÄ~JO) was used as the control for RT-PCR. vNNM^T^KQ and ÇéóÇJNRNA expression was then analyzed by 20 cycles of PCR using primers to yield 1-kb PCR products. Y110A7A4-12 (ACAATTCCGTTGCTTACCAC), Y110A7A4-13 (GTAGCTGGCAAGGTTGAATG), C25F6.3-7 (TGGACTCGGATTCTTGATGG), and C25F6.3-8 (GCACACACTGTAGCAAAGAG) primers were used for RT-PCR analysis. Integrated density values of RT-PCR product bands were measured by the AlphaImage program (AlphaInnotech). Three independent RTPCR experiments were performed, and their relative densities of 5-FU-treated bands compared to the control bands were calculated.

RESULTS AND DISCUSSION `K=ÉäÉÖ~åë DPYD-1 and Y110A7A.4 are very similar to human DPD and TS, respectively We hypothesized that the functional mechanism of 5-FU is conserved at the molecular level between humans and `K=ÉäÉJ Ö~åë. Thus, we analyzed two metabolic enzymes, DPD and TS, which are involved in the pyrimidine biosynthesis pathway. DPD converts 5-FU to an inactive molecule, and TS is a major target of the 5-FU derivative, 5-fluoro-2′-deoxyuridine-5′monophosphate (5FdUMP). Homology searches revealed single homologs of human DPD and TS in `K= ÉäÉÖ~åë. The ORF names of DPD and TS are C25F6.3 (ÇéóÇJN) and Y110A7A.4, respectively. DPD and TS from humans and `K= ÉäÉÖ~åë showed high similarity at the amino acid level (Fig. 1). In fact, `K= ÉäÉÖ~åë DPYD-1 is 65% identical to human DPD, and the predicted amino acid sequence of Y110A7A.4 is 68% identical to human TS. Next, GFP reporter constructs of DPYD-1 and Y110A7A.4 were generated to determine the expression patterns of these

346

Functional Analysis of DPD and TS in 5-FU Response

A

B

C

Fig. 1. DPD and TS proteins exhibit strong homology between humans and `K=ÉäÉÖ~åë. (A) Alignment of the amino acid sequence of human DPD (hDPD) and worm DPD (cDPD). Human and worm DPD proteins have 65% identity. (B) Alignment of the amino acid sequence of human TS (hTS) and worm TS (cTS). Human and worm TS proteins have 68% identity. The identical amino acids are shaded. (C) The genomic structures of `K= ÉäÉÖ~åë= ÇéóÇJN (C25F7.3) and the TS homologous gene (Y110A7A.4). DPYD-1 has 13 exons, and Y110A7A.4 has 3 exons. DPYD-1 contains a GltD (NADPH-dependent glutamate synthase beta chain and related oxidoreductases) domain, a DHPD-FMN binding domain, and a NADH domain. Y110A7A.4 contains a TS-PHM (pyrimidine hydroxymethylase) domain.

enzymes in `K=ÉäÉÖ~åë. The DPYD-1::GFP fusion protein was expressed in many tissues including the hypodermis, pharynx, and intestine. In fact, DPYD-1::GFP was strongly expressed in

the hypodermal cells of embryos and the pharynx of larvae and adults (Figs. 2A-2F). Interestingly, DPYD-1::GFP appeared as large bright spots in hypodermal cells of early larvae (Figs. 2A and 2D). The strong GFP spots were reduced at late larval stages (Fig. 2A). DPYD-1::GFP was also expressed as scattered small spots in the intestine (Fig. 2F). Transgenic worms expressing Y110A7A.4::GFP showed a severe mosaic pattern and weak GFP signals (data not shown). In addition, transgenic worms expressing the Y110A7A.4::GFP fusion protein exhibited embryonic lethality (> 90%) in fourteen stable lines (Fig. 4C, Supplementary Table 1, and data not shown). Due to this dominant-negative effect of Y110A7A.4::GFP, another GFP construct (pvNNM^T^KQ::GFP), which expresses GFP under the control of the vNNM^T^KQ promoter, was generated. Transgenic worms containing this construct expressed GFP in the intestine and some head neurons similar to the full-length Y110A7A.4:: GFP construct (Fig. 2G and data not shown). Use of the pvNNM^T^KQ::GFP construct allowed us to observe GFP in most cells of early embryos (Fig. 2I). This ubiquitous and relatively strong expression pattern agreed with the characteristics of thymidylate synthase; however, pvNNM^T^KQ::GFP also showed weak and mosaic GFP signals in larvae and adults (Fig. 2G). Because the genomic region of vNNM^T^KQ looked like an operon regulated by the promoter of vNNM^T^KU, an additional pvNNM^T^KQ::GFP construct was generated with the 5′ upstream region of vNNM^T^KU. No differences in expression patterns among transgenic worms with the construct described above were noted (data not shown). DPD and TS are reportedly induced by 5-FU treatment in human cancer patients (Mauritz et al., 2007; Tanaka-Nozaki et al., 2003). We employed RT-PCR to compare the expression levels of the ÇéóÇJN and vNNM^T^KQ genes before and after 5FU treatment in `K= ÉäÉÖ~åë. In contrast to the expression of their human homologs, the transcript levels of ÇéóÇJN and vNNM^T^KQ were slightly decreased following 5-FU treatment of `K=ÉäÉÖ~åë (Figs. 2J and 2K). As this was an unexpected result, we repeated the RT-PCR analysis using a real-time PCR machine. In this analysis, ÇéóÇJN levels were decreased, and vNNM^T^KQ levels were increased following 5-FU treatment (Supplementary Fig. 1). Differences between the two RT-PCR assays included use of `K=ÉäÉÖ~åë actin (~ÅíJN) for complementation of RNA quantities for real-time RT-PCR and `K=ÉäÉÖ~åë β-tubulin (íÄ~JO) for the conventional RT-PCR. We also compared GFP expression of worms containing DPYD-1::GFP and évNNM^T^KQ::GFP constructs with or without 5-FU treatment (soaking worms in M9 buffers with or without 400 μM 5-FU for 5 h). GFP expression levels were not changed by 5-FU in any of the transgenic worms (Supplementary Fig. 2). Thus, RNA expression levels of `K=ÉäÉÖ~åë=ÇéóÇJN and vNNM^T^KQ following 5-FU treatment differed from human ama=and=qpK=Three different experiments did not yield similar results, but the decrease in ÇéóÇJN RNA and no change in Y110A7A.4 RNA were dominant cases following 5-FU. Overexpression of DPD and TS suppresses 5-FU-induced phenotypes In order to evaluate the effects of DPYD-1 and Y110A7A.4 expression levels on 5-FU function, worms that overexpressed DPYD-1 or Y110A7A.4 were generated using DNA microinjection. Then, the hatching ratios of the wild-type and transgenic worms on 5 nM 5-FU plates were compared. Several L4 stage worms were transferred from NGM plates to 5-FU plates, and the egg and larva numbers were then counted. The survival ratios of DPYD-1 or Y110A7A.4 transgenic worms on 5-FU plates did not increase significantly (Fig. 3A); however, the

Seongseop Kim et al.

A

B

347

G

H

I C

D

J

E

K

F

Fig. 2. Expression patterns of DPYD-1 and Y110A7A.4. (A-F) DPYD-1::GFP fusion proteins are expressed in many tissues including hypodermis, intestines, and pharynx from early embryos to late adults. (B) DPYD-1::GFP expression is very strong in hypodermal cells of embryos and pharynx of larvae and adults. (A, D) DPYD-1::GFP was expressed as bright spots in the hypodermal cells appeared at the L1 and L2 larval stages. White arrows indicate bright large spots of DPYD-1::GFP in the hypodermal cell. (F) DPYD-1::GFP was also expressed as many small spots in the intestinal cells. (G-I) GFP under the control of the Y110A7A.4 promoter was expressed in most cells of early embryos and in the intestine of larvae. (J, K) RT-PCR analyses of ÇéóÇJN and vNNM^T^KQ gene after 5-FU treatment. Both ÇéóÇJN and vNNM^T^KQ RNA expression decreased following 5-FU treatment. (J) Gel electrophoresis of RT-PCR products. (K) Relative integrated densities of ÇéóÇJN and vNNM^T^KQ RT-PCR products compared to control bands. `K=ÉäÉÖ~åë β-tubulin homolog (íÄ~JO) was used as a control for RT-PCR. (C, H) kçã~êëâá images and (A, B, D-G, and I) GFP images. Scale bars are 100 μm. Error bars indicate standard deviation.

roller ratios representing the transgenic worm ratio increased (Fig. 3B). Transgenic DPYD-1 or Y110A7A.4 worms showed a 5.5% and 12.5% increase respectively, compared with the survival ratio of wild-type worms on 5-FU (5 nM) plates (Supplementary Table 2). Differences between the mean survival ratios were not statistically significant; however, the transgenic ratios of the DPYD-1 or Y110A7A.4 overexpressing worms increased by 11.8% and 16.8%, respectively, and these ratios were significantly different than the controls (Supplementary Table 2). Low increase of the total survival ratios may result from the low stability of these transgenic worms. No differences between the survival ratios of N2 and ROL-6 transgenic worms were observed (Fig. 3A), indicating that overexpression of the transgenic marker ROL-6 did not affect survival ratios on 5-FU plates. Therefore, the increased expression of DPYD-1 or Y110A7A.4 appeared to provide embryonic resistance to 5-FU. Next, we examined the germ cells in the gonads of these transgenic worms. L4 worms were transferred onto 5-FU (400 nM) plates, and germ cells in the gonads were observed 24 h later. The gonads of the transgenic worms exhibited a nearly intact shape on 5-FU plates (Fig. 3C), while the wild-type control worms exhibited cell debris and a vacant area that resulted from germ cell death. Transgenic worms overexpressing DPYD-1 faired better than those overexpressing Y110A7A.4 in this assay. Thus, DPYD-1 overexpression appeared to be more effective than Y110A7A.4 overexpression in conferring 5-FU resistance. We cannot exclude the possibility that differences in expression levels of these two transgenes contribute to this

difference in resistance. As shown above, DPYD-1::GFP produced much stronger GFP than Y110A7A.4::GFP (Fig. 2 and data not shown). Thymidylate synthase plays an essential role in embryogenesis To further explore the relationship between expression levels of these two proteins and 5-FU function, DPYD-1 and Y110A7A.4 were depleted by RNAá. Following vNNM^T^KQ RNAá treatment, severe embryonic lethality resulted (Fig. 4A and Supplementary Table 3) in accord with previous experiments in other laboratories (Kamath et al., 2003). Since vNNM^T^KQ proved to be an essential gene, only=ÇéóÇJN=RNAá was available to investigate 5-FU resistance. We confirmed a decrease in DPYD-1::GFP following ÇéóÇJN RNAá treatment (Supplementary Fig. 3). After ÇéóÇJN expression was diminished via RNAáI= progeny were more sensitive to 5-FU as measured by a hatching test at low 5-FU (2 nM) concentrations (Fig. 4B and Supplementary Table 4). In this case, survival ratios of wild-type worms were not affected by very low concentration of 5-FU, but those of progeny from ÇéóÇJN RNAá treated worms were reduced by approximately 25%. As a result, different expression levels of DPYD-1 affected the function of 5-FU in `K=ÉäÉÖ~åë and is also likely the case in humans. Progeny from vNNM^T^KQ RNAá-treated, Y110A7A.4::GFP overexpressing, and 5-FU-treated worms exhibited a lethal phenotype (Fig. 4C). In particular, vNNM^T^KQ RNAá and 5-FU treatment resulted in very similar phenotypes in embryo devel-

348

Functional Analysis of DPD and TS in 5-FU Response

A

A

B B

C

Fig. 3. Overexpression of DPYD-1 and Y110A7A.4 suppressed 5FU induced phenotypes. (A) Hatching test was fulfilled on the 5 nM 5-FU plates. The hatching ratios of worms that overexpress DPYD1 and Y110A7A.4 were slightly increased on the 5-FU plate. The marker êçäJS=EëìNMMSF by itself did not increase survival ratio on the 5-FU plate. (B) The roller ratios that represent the transgenic worms also increased on the 5-FU plate. The roller ratios of êçäJS transgenic worms in the normal NGM and 5-FU plate were not different. Three independent experiments were performed for each assay. Error bars represent standard deviation. * é=< 0.001 for comparison to controls determined by an unpaired Student’s í-test. (C) 5-FU induced germ cell death. Transgenic worms expressing many copies of DPYD-1 and Y110A7A.4 were affected by 5-FU to a lesser degree than wild-type worms. Black arrows indicate dying cells, and the white asterisk indicates a vacant area resulting from germ cell death. Both N2 and WT indicate wild-type. ExROL-6, ExY110A7A.4, and ExDPYD-1 indicate worms that express these respective proteins via their transgenes. The scale bar is 10 μm.

opment. This similarity resulted from the common inhibition of TS activity by both vNNM^T^KQ RNAá and 5-FU treatment. In contrast to wild-type embryos, which exhibited a typical embryonic cell-dividing pattern on NGM plates, embryos with their TS function inhibited showed a retarded embryo development and irregular cell sizes (Fig. 4C). Specifically, embryos of Y110 A7A.4::GFP transgenic worms exhibited the most severe phenotype. Thus, Y110A7A.4::GFP proteins may function in a dominant-negative manner that is different from simple overexpression of Y110A7A.4 proteins, which had only a weak effect on `K=ÉäÉÖ~åë development (Supplementary Table 2 and data

C

Fig. 4. Depletion of=DPYD-1 and Y110A7A.4 by RNAáK=(A) The ÇéóÇJ N and vNNM^T^KQ transcripts were depleted using RNAá. vNNM^T^KQ RNAá= caused embryo lethality, but ÇéóÇJN RNAá had no effect on viability or worm development. (B) Progeny of DPYD-1-depleted worms were more sensitive to 2 nM 5-FU. Error bars indicate standard deviation. “Y” axes show the mean percentage of worms that survived until adulthood. * indicates a é value < 0.0001 as determined by the unpaired Student’s í-test. (C) kçã~êëâá images of embryos. Most embryos from vNNM^T^KQ RNAáI=vNNM^T^KQ::GFP overexpression, 5-FU treatment, and homozygous progeny from íãOQOVLH were dead and showed retarded embryogenesis. The scale bar is 10 μm.

not shown). Some Y110A7A.4 overexpression transgenic lines showed a low percentage of embryonic lethality (data not shown). To summarize, we studied the anti-cancer drug 5-FU and two related metabolic enzyme homologs in `K= ÉäÉÖ~åë in order to examine the molecular conservation and function. The functional pathways of 5-FU action in humans and `K=ÉäÉÖ~åë are

Seongseop Kim et al.

very similar based on our studies of the DPD and TS homologs. Although 5-FU and other anti-cancer drugs have been studied vigorously in human cancer cells and patients, studies in model organisms will allow us to further investigate their functions and mechanisms thoroughly. Based on this molecular conservation of the pyrimidine biosynthesis pathway, `K= ÉäÉÖ~åë is a likely model system to study the mechanism of anti-cancer drugs. kçíÉW=pìééäÉãÉåí~êó=áåÑçêã~íáçå=áë=~î~áä~ÄäÉ=çå=íÜÉ=jçäÉÅìäÉë= ~åÇ=`Éääë=ïÉÄëáíÉ=EïïïKãçäÅÉääëKçêÖFK=

ACKNOWLEDGMENTS

This work was supported by research grants from the National Cancer Center (NCC-0510583 and NCC-0810070), Korea. We appreciate the Mitami Laboratory for sending several mutants including the vNNM^T^KQ deletion mutant (íãOQOV). We thank Jiwon Shim (Dr. Lee’s lab., Seoul National University) for the real-time RT-PCR experiment.

REFERENCES Beck, A., Etienne, M.C., Cheradame, S., Fischel, J.L., Formento, P., Renee, N., and Milano, G. (1994). A role for dihydropyrimidine dehydrogenase and thymidylate synthase in tumour sensitivity to fluorouracil. Eur. J. Cancer=PM^, 1517-1522. Brenner, S. (1974). The genetics of `~ÉåçêÜ~ÄÇáíáë=ÉäÉÖ~åë. Genetics=TT, 71-94. Habara, K., Ajiki, T., Kamigaki, T., Nakamura, T., and Kuroda, Y. (2001). High expression of thymidylate synthase leads to resistance to 5-fluorouracil in biliary tract carcinoma=áå=îáíêç. Jpn. J. Cancer Res.=VO, 1127-1132. Hooiveld, E.A., van Kuilenburg, A.B., Haanen, J.B., and Westermann, A.M. (2004). Severe toxicity after treatment with capecitabine and fluorouracil due to partial dihydropyrimidine dehydrogenase deficiency. Nederlands tijdschrift voor geneeskunde=NQU, 626-628. Ishikawa, Y., Kubota, T., Otani, Y., Watanabe, M., Teramoto, T., Kumai, K., Kitajima, M., Takechi, T., Okabe, H., and Fukushima, M. (1999). Dihydropyrimidine dehydrogenase activity and messenger RNA level may be related to the antitumor effect of 5fluorouracil on human tumor xenografts in nude mice. Clin. Cancer Res.=R, 883-889. Kamath, R.S., Fraser, A.G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., et al. (2003). Systematic functional analysis of the `~ÉåçêÜ~ÄÇáíáë ÉäÉÖ~åë genome using RNAi. Nature=QON, 231-237. Katona, C., Kralovanszky, J., Rosta, A., Pandi, E., Fonyad, G., Toth, K., and Jeney, A. (1998). Putative role of dihydropyrimidine dehydrogenase in the toxic side effect of 5-fluorouracil in colorectal cancer patients. Oncology=RR, 468-474.

349

Kim, S., and Shim, J. (2008). A forward genetic approach for analyzing the mechanism of resistance to the anti-cancer drug, 5fluorouracil, using Caenorhabditis elegans. Mol. Cells= OR, 119123. Lackner, M.R., Kindt, R.M., Carroll, P.M., Brown, K., Cancilla, M.R., Chen, C., de Silva, H., Franke, Y., Guan, B., Heuer, T., et al. (2005). Chemical genetics identifies Rab geranylgeranyl transferase as an apoptotic target of farnesyl transferase inhibitors. Cancer Cell=T, 325-336. Liu, J., Schmitz, J.C., Lin, X., Tai, N., Yan, W., Farrell, M., Bailly, M., Chen, T., and Chu, E. (2002). Thymidylate synthase as a translational regulator of cellular gene expression. Biochim. Biophys. Acta=NRUT, 174-182. Maring, J.G., Groen, H.J., Wachters, F.M., Uges, D.R., and de Vries, E.G. (2005). Genetic factors influencing pyrimidine-antagonist chemotherapy. The Pharmacogenomics J.=R, 226-243. Mauritz, R., van Groeningen, C.J., Smid, K., Jansen, G., Pinedo, H.M., and Peters, G.J. (2007). Thymidylate synthase and dihydropyrimidine dehydrogenase mRNA expression after administration of 5-fluorouracil to patients with colorectal cancer. Int. J. Cancer=NOM, 2609-2612. Miyamoto, S., Ochiai, A., Boku, N., Ohtsu, A., Tahara, M., Yoshida, S., Okabe, H., Takechi, T., and Fukushima, M. (2001). Discrepancies between the gene expression, protein expression, and enzymatic activity of thymidylate synthase and dihydropyrimidine dehydrogenase in human gastrointestinal cancers and adjacent normal mucosa. Int. J. Oncol.=NU, 705-713. Morganti, M., Ciantelli, M., Giglioni, B., Putignano, A.L., Nobili, S., Papi, L., Landini, I., Napoli, C., Valanzano, R., Cianchi, F., et al. (2005). Relationships between promoter polymorphisms in the thymidylate synthase gene and mRNA levels in colorectal cancers. Eur. J. Cancer=QN, 2176-2183. Nita, M.E., Tominaga, O., Nagawa, H., Tsuruo, T., and Muto, T. (1998). Dihydropyrimidine dehydrogenase but not thymidylate synthase expression is associated with resistance to 5fluorouracil in colorectal cancer. Hepatogastroenterology= QR, 2117-2122. Obama, K., Kanai, M., Kawai, Y., Fukushima, M., and Takabayashi, A. (2002). Role of retinoblastoma protein and E2F-1 transcription factor in the acquisition of 5-fluorouracil resistance by colon cancer cells. Int. J. Oncol. ON, 309-314. Rustum, Y.M., Harstrick, A., Cao, S., Vanhoefer, U., Yin, M.B., Wilke, H., and Seeber, S. (1997). Thymidylate synthase inhibitors in cancer therapy: direct and indirect inhibitors. J. Clin. Oncol.=NR, 389-400. Tanaka-Nozaki, M., Tajiri, T., Tanaka, N., Furukawa, K., Takasaki, H., Yoshimura, K., Suzuki, H., Naito, Z., Sugizaki, Y., Merk, H.F., et al. (2003). Intratumoral induction of thymidylate synthase mRNA by 5-FU in colorectal cancer patients: association with survival. Oncol. Rep.=NM, 1425-1429. Wu, M.W., Xian, L.J., Li, X.M., Pasquale, I., and Francis, L. (2004). Circadian expression of dihydropyrimidine dehydrogenase, thymidylate synthase, c-myc and p53 mRNA in mouse liver tissue. Ai zheng = Aizheng = Chinese J. Cancer=OP, 235-242.