Thyroid hormone receptor &beta - Nature

Oncogene (2011) 30, 854–864

& 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc

ORIGINAL ARTICLE

Thyroid hormone receptor b1 domains responsible for the antagonism with the ras oncogene: role of corepressors S Garcı´ a-Silva1, O Martı´ nez-Iglesias1, L Ruiz-Llorente1 and A Aranda Department of Endocrine and Nervous System Physiopathology, Instituto de Investigaciones Biome´dicas, Consejo Superior de Investigaciones Cientı´ficas and Universidad Autońoma de Madrid, Madrid, Spain

The thyroid hormone receptor (TR) is a suppressor of rasmediated responses. To characterize the receptor domains involved in this function, we analyzed a panel of TRb1 mutants for their ability to interfere with ras-driven cyclin D1 activation, formation of transformation foci and tumor growth in nude mice. Our results show that the domains and mechanisms responsible for the anti-transforming and anti-tumorigenic actions of the receptor are divergent from those operating in classical T3-dependent transcriptional activation. TRb1 mutants that do not bind coactivators and do not transactivate retained the capacity of suppressing cellular transformation and tumor growth, whereas selective mutations in the hinge region affecting corepressors recruitment abolished these actions, while preserving ligand-dependent transcription. There was a strict parallelism between anti-transforming activity of the various mutants and their ability to antagonize cyclin D1 stimulation by ras, indicating that transrepression mechanisms may have an important function in suppression of the transforming effects of the oncogene by TRb1. The inhibitory action of T3 on transformation was further enhanced after over-expression of corepressors, while corepressor depletion by means of small-interference RNA reversed significantly hormonal action. This shows an important functional role of endogenous corepressors in suppression of ras-mediated transformation and tumorigenesis by TRb1 Oncogene (2011) 30, 854–864; doi:10.1038/onc.2010.464; published online 18 October 2010 Keywords: thyroid hormone receptor; Ras; transformation; cyclin D1; corepressors; coactivators Introduction Members of the ras family encode small GTP-binding proteins that have an important function in normal and malignant cell growth. Oncogenic mutations of Ras result in a constitutively active protein that can induce cellular transformation and are present in at least 30% Correspondence: Dr A Aranda, Instituto de Investigaciones Biome´dicas, Consejo Superior de Investigaciones Cientı´ ficas and Universidad Autońoma de Madrid, Arturo Duperier 4, Madrid 28029, Spain. E-mail: [email protected] 1 These authors contributed equally to this work. Received 22 February 2010; revised and accepted 3 September 2010; published online 18 October 2010

of human tumors (Bos, 1989; Lowy and Willumsen, 1993). The mitogen-activated protein kinase (MAPK) signaling pathway has an essential function in Rasinduced transformation (Campbell et al., 1998) and cyclin D1 is one of the main targets for the proliferative and transforming effects of ras (Filmus et al., 1994; Liu et al., 1995; Robles et al., 1998). The actions of the thyroid hormone triiodothyronine (T3) are initiated by binding to nuclear receptors (thyroid hormone receptors, TRs), the cellular counterparts of the v-erbA oncogene (Flamant et al., 2006). TRs are encoded by two genes, a and b, which give rise to different receptor isoforms (Yen, 2001), and display a modular structure with several regions: an N-terminal region (A/B), a conserved DNA-binding domain or region C, a hinge region D that contains residues essential for interaction with corepressors and a conserved E region that contains the ligand-binding domain (LBD) (Aranda and Pascual, 2001). TRs normally act by binding to DNA-response elements (TREs), generally as heterodimers with the retinoid X receptor. Unliganded TRs associate with corepressors such as nuclear receptor corepressor (NCoR) or silencing mediator of retinoic and thyroid receptor (SMRT) that belong to complexes that contain histone deacetylases and cause chromatin compactation (Lazar, 2003; Privalsky, 2004). Ligand binding allows the release of corepressors and the recruitment of coactivators responsible for chromatin decompactation and transcriptional stimulation. Nuclear receptors can also repress expression of genes that do not contain a hormone-response element through interference with the activity of other transcription factors and signaling pathways, a mechanism generally referred to as ‘transcriptional cross-talk’. Thus, some nuclear receptors can transrepress the activity of target gene promoters that carry AP-1, CRE (cAMP-response element) or NF-kB sites (Pfahl, 1993; Mendez-Pertuz et al., 2003; Pascual and Glass, 2006; De Bosscher et al., 2008). The receptors do not bind to these elements ‘in vitro’, but ‘in vivo’ the liganded receptors can be tethered to the promoter through protein–protein interactions (Rogatsky et al., 2001; Mendez-Pertuz et al., 2003). We have previously shown that TRs can inhibit ras-induced cyclin D1 transcription by antagonizing the Ras/MAPK signaling pathway through a CRE present in the proximal promoter. Furthermore, TRs block fibroblast transformation by oncogenic ras and act as

Antagonism of Ras responses by TRb1 S Garcıá-Silva et al

855

suppressors of tumor formation by the oncogene in nude mice (Garcia-Silva and Aranda, 2004). These results show the existence of a transcriptional cross-talk between TRs and the ras oncogene, which influences relevant processes such as cell proliferation, transformation or tumorigenesis. Reduced expression as well as somatic mutations in TRb1 are found at high frequency in human hepatocellular carcinoma (Chan and Privalsky, 2006), which frequently presents ras-activation (Ito et al., 1998). Furthermore, we have recently shown that this receptor acts as a suppressor of invasiveness and metastasis formation by hepatocarcinoma cells (Martı´ nez-Iglesias et al., 2009a, b), suggesting that it could represent a potential therapeutic target in cancer (Aranda et al., 2009). Recently, it has been shown that TRs could function as tumor suppressors in a mouse model of metastatic follicular thyroid carcinoma (Zhu et al., 2010). In this work, we have examined the TRb1 domains involved in the antagonism of ras-induced transcription in hepatocarcinoma HepG2 cells and in the anti-transforming and anti-tumorigenic actions of the receptor in NIH-3T3 fibroblasts. Our results indicate that hinge residues involved in corepressors binding are required for these actions. A functional role of the corepressors SMRT and NCoR in the receptor antitransforming effects is shown by over-expression and knock-down experiments. These results indicate that transrepression could have an important function in the antagonism of the transforming effects of the ras oncogene by the TR.

Results TRb1 antagonizes ras-mediated stimulation of cyclin D1 in human hepatocarcinoma cells As proliferative responses to ras appear to depend on induction of cyclin D1, the levels of this protein were determined in hepatocarcinoma HepG2 cells transiently expressing Ha-rasval12 and/or TRb1. Ras increased cyclin D1 levels and T3 antagonized this response significantly when cells coexpressed Ha-rasval12 and the receptor, while Ras levels were not affected (Figure 1a). In addition, Ha-rasval12 stimulated activity of a reporter plasmid containing the 50 -flanking region of the cyclin D1 gene, and T3 strongly antagonized both basal promoter activity and the response to the oncogene in TRb1-expressing cells (Figure 1b). TRb1 domains involved in transrepression of the cyclin D1 promoter To analyze the TRb domains responsible for the antagonism of ras-induced transcription, we examined the effect of mutations in different receptor domains on cyclin D1 promoter activity. T3-dependent transcription requires the recruitment of coactivators. Hormone binding induces the repositioning of the C-terminal helix 12 (H12) of the LBD that together with residues in H3, 4 and 5 forms a hydrophobic groove that

Figure 1 T3 blocks ras-mediated cyclin D1 expression in HepG2 cells. (a) Representative western blot of cyclin D1 and Ras in cells transfected with 50 ng of Ha-rasval12 and 20 ng TRb1 or with the same amount of an empty vector. After transfection cells were treated for 36 h with 5 nM T3, b-actin was used as a loading control. (b) Transient transfection assays with the pD269-reporter plasmid containing the cyclin D1 promoter, Ha-rasval12, TRb1 or an empty vector. Luciferase activity was determined in control cells and in cells incubated with T3 and is expressed as fold induction over the values obtained in the untreated cells transfected with the empty vector.

accommodates the coactivator receptor interacting domain (Feng et al., 1998). E457 in H12 and K288 in H3 of TRb1 contact directly with the coactivator and form a charge clamp that stabilizes binding. Accordingly, mutations in these residues render receptors with impaired ability to recruit coactivators such as the p160 coactivator ACTR (Figure 2a) and to mediate T3dependent transcriptional activation (Figure 2b). In contrast, the K288I mutant was at least as active as the native receptor to antagonize the activation of the cyclin D1 promoter by Ha-rasval12, and the H12 mutant still presented a significant repressor activity (Figure 2d). The H12 and H3 mutants were expressed at levels comparable with those of the native receptor and neither the native receptor nor the coactivator mutants reduced Ras levels (Figure 2c). These mutants were also able to antagonize induction of cyclin D1 protein by Ras (Supplementary Figure 1). Therefore, association of TRb1 with classical coactivators does not appear to be essential for inhibition of Ras transcriptional activity. The role of corepressors on transrepression was assessed with the use of TRb1 mutants in the hinge Oncogene


856

domain. A triple-point mutation (AHT-GGA) in the CoR box located in H1 blocks interaction with SMRT and NCoR (Ho¨rlein et al., 1995; Perissi et al., 1999; Marimuthu et al., 2002) and appears to affect the overall structure of the LBD (Pissios et al., 2000). In addition, the P214R mutant in a residue preceding H1 was reported to lack silencing activity without altering

LBD stability (Tagami et al., 1997; Pissios et al., 2000). These mutations interfered with SMRT interaction in pull-down assays (Figures 3a and b) and were not able to suppress ligand-independent activity on a TRE, while supporting significant T3-dependent transactivation (Figure 3d). Although these mutants were expressed at similar levels as the wild-type receptor and did not alter Ha-rasval12 levels (Figure 3e), they were unable to repress cyclin D1 promoter induction by the oncogene (Figure 3f), suggesting that binding of corepressors to TRb1 is required for transcriptional antagonism. We also analyzed the effect of mutation R243W that does not affect SMRT or NCoR binding to the unoccupied receptor, but inhibits corepressor release in the presence of T3 (Safer et al., 1998; Figures 3a and b), whereas supporting coactivator recruitment (Figure 3c). This mutant had silencing activity in the absence of ligand and reduced TRE-dependent transactivation possibly because of the abnormal corepressor release (Figure 3d), but in contrast with other hinge mutants was able to support significant transrepression of the cyclin D1 promoter by T3 (Figure 3f). In addition, expression of the R243W mutant reduced cyclin D1 protein levels in cells expressing Ha-rasval12, while the AHT mutant had little effect (Supplementary Figure 2). Residues in the hinge region are required for repression of ATF-2 transcriptional activity by TRb1 We have shown that T3 blocks cyclin D1 activation by Ras by antagonizing the Ras/MAPK signaling pathway (Garcia-Silva and Aranda, 2004). The MAPK extra-

Figure 2 Coactivators are dispensable for transrepression of ras response by TRb1. (a) Pull-down assays were performed with wildtype TRb1, the H3 mutant K288I and the H12 mutant E457Q and the receptor interacting domain of the p160 coactivator ACTR fused to GST. Where indicated, T3 was included in the binding reaction. The input lanes represent 20% of the protein in the binding assay. The right panel represents the quantification of two independent pull-downs. (b) The TRE-reporter plasmid was cotransfected into HepG2 cells with either TRb1 wild-type or the H3 and H12 mutants and reporter activity was determined in control cells and in cells incubated with T3. (c) Levels of the transfected receptors and Ras were measured by western blot. (d) Luciferase activity was determined in untreated and T3-treated cells cotransfected with the cyclin D1-reporter plasmid pD269, Ha-rasval12 and the same TRb1 mutants.

Figure 3 Mutant receptors in the hinge domain that do not bind corepressors can transactivate, but do not repress the transcriptional response to the ras oncogene. (a) In the left panel, in vitro interaction between TRb1 and the TRb1 mutants AHT and P214R with SMRT was analyzed by GST pull-down, which was performed with in vitro translated 35S-labeled receptors and GST-SMRT or GST alone (GST-0). Where indicated, T3 was included in the binding reaction. The input lanes represent 20% of the protein in the binding assay. The right panel represents binding of the native receptor and the R243W mutant to GST-SMRT and GST-NCoR in the presence and absence of T3. (b) Quantification of three independent pull-downs of the native and mutant receptors with GST-SMRT. Values were corrected with the inputs and are expressed as a percentage (mean±s.d) of the value obtained with the native receptor in the absence of T3. (c) Pull-down assays with the hinge mutants and GST-ACTR. (d) Luciferase activity in control and T3-treated HepG2 cells cotransfected with the TRE-reporter plasmid and expression vectors for the hinge TRb1 mutants. Statistically significant differences of the mutants with respect to cells transfected with wild-type TRb1 are represented by # in the untreated cells and by * in T3-treated cells. (e) Expression levels of the transfected receptors and Ras analyzed by western blot. (f) The effect of T3 on luciferase activity was determined in HepG2 cells cotransfected with the cyclin D1 promoter construct pD269-luc, Ha-rasval12 and the receptor mutants. The symbol # illustrates differences between wild-type and mutant receptors, and * between untreated and T3-treated cells within the same group. * and #Po0.05; ** and ##Po0.01; *** and ###Po0.001. Oncogene


857

cellular signal-regulated kinase 1/2 activates downstream kinases such as Rsk or Msk (Anjum and Blenis, 2008), which then phosphorylate b-Zip transcription factors of the CREB/ATF family that bind CRE motifs (Xing et al., 1996). In agreement with this, mutation of CRE or Sp1 sites in the cyclin D1 promoter reduced induction by Ha-rasval12 and combined mutation of both motifs essentially abolished its effect (Figure 4a). TRs can interact with CREB inhibiting its phosphorylation

(Mendez-Pertuz et al., 2003), and, as shown in Figure 4b, TRb1 also interacts directly with the b-Zip factor ATF-2 (activation transcription factor-2) in pulldown assays. In addition, cotransfection of a dominantnegative ATF-2 blocked the promoter response to Ha-rasval12 (Figure 4c), showing the implication of CRE-binding factors. The CRE binds constitutively b-Zip factors and, accordingly, neither Ras nor TRb1 alters the abundance of the factors that bind this motif

Oncogene


858

SMRT and NCoR increase antagonism of Ras by TRb1 We have previously shown that T3 reduces cyclin D1 levels in NIH-3T3 fibroblasts transfected with Ha-rasval12 and TRb1 (Garcia-Silva and Aranda, 2004). As shown in Figure 5a, TRb1 also antagonized ras-induced cyclin D1 promoter activation in NIH-3T3 cells, whereas the receptor mutants that do not bind corepressors were inactive. Expression of the receptors did not alter Ras levels in NIH-3T3 cells in the absence or presence of ligand (Figure 5a; Supplementary Figure 3). To further examine the role of corepressors on transrepression, NIH-3T3 cells were transfected with expression vectors for SMRT and NCoR. Corepressor expression did not alter the levels of transfected Ras, and in the absence of receptor, SMRT reduced cyclin D1 promoter activity, whereas in the presence of the unliganded receptor, both corepressors significantly enhanced T3-dependent repression (Figure 5b). Furthermore, the endogenous receptor that is expressed at low levels in NIH-3T3 cells was able to mediate a clear T3-dependent inhibition of promoter activity after NCoR transfection, showing increased T3 sensitivity in cells expressing high NCoR levels. Increased sensitivity was also found in HepG2 cells transfected with NCoR (Supplementary Figure 4). Furthermore, a stronger inhibitory effect of T3 on endogenous cyclin D1 levels in NIH-3T3 cells in response to corepressor over-expression was also observed (Supplementary Figure 5). These results suggest again that corepressors have a function in transrepression by TRb1.

Figure 4 b-Zip factors that bind the CRE mediate stimulation by the ras oncogene and repression by T3. (a) The CRE and Sp1 sites in the cyclin D1 promoter were mutated in the pD269-luc plasmid and reporter activity was determined in the native and mutated (mCRE, mSp1 and mCRE/mSp1) constructs 36 after transfection with Ha-rasval12. (b) Pull-down assays performed with wild-type TRb1 and the b-Zip factor ATF-2 fused to GST in the presence and absence of T3. The input lane represents 20% of the protein in the binding assay. In (c) Ha-rasval12 was cotransfected with increasing amounts of a dominant-negative mutant of the ATF-2 (A-ATF2). Luciferase activity was determined 36 h after transfection. (d) Gel retardation assays with an oligonucleotide conforming the CRE of the cyclin D1 promoter and extracts from cells transfected with Ha-rasval12 and TRb1 and treated with and without T3 for 36 h. (e) Cells were transfected with an UAS-reporter plasmid and a fusion construct of the GAL4 DBD with ATF-2. This construct was cotransfected with Ha-rasval12 and the TRb1 mutants as indicated, and luciferase activity was determined in control and T3-treated cells.

(Figure 4d). However, Ha-rasval12 induced transcriptional activation of ATF-2, as assessed by cotransfection of a GAL4-ATF-2 fusion with a reporter plasmid containing binding motifs for GAL4, and this activation was blocked by the native receptor in a T3-dependent manner. In contrast, the hinge TRb mutants that were unable to mediate transrepression of the cyclin D1 promoter also lost the ability of antagonizing ATF-2 activation by the oncogene (Figure 4e). Oncogene

Receptor domains involved in the anti-transforming activity of TRb1 We next examined the effect of TRb1 mutants on the repression of Ras-induced transformation. For this purpose, we performed foci formation assays in NIH3T3 fibroblasts transfected with Ha-rasval12 and various TRb1 mutants. The results obtained showed a strict parallelism between repression of Ha-rasval12-induced transcription and inhibition of transformation. The number of transformation foci was greatly reduced by T3 in fibroblasts coexpressing the oncogene and the native receptor (Figure 6a). In contrast, the AHT and P214R receptors that do not bind corepressors were unable to mediate ligand-dependent anti-transforming effects, whereas R243W had detectable activity (Figure 6b), indicating that the residues required for transrepression are also essential to antagonize cellular transformation by Ha-rasval12. Furthermore, the LBD mutants E457 and K288 that bind T3 but do not recruit coactivators can antagonize Ras-mediated transcription and were able to repress fibroblast transformation by Ha-rasval12. Unsurprisingly, a TRb1 mutation in the LBD (PV mutant), which produces a frameshift in H12 resulting in total loss of T3 binding (Meier et al., 1992), was devoid of ligand-mediated anti-transforming activity (Figure 6c), and the same occurred with v-ErbA that does not bind hormone and that in contrast with its TRa proto-oncogene was unable to antagonize foci formation by Ha-rasval12 in the presence of T3 (data not shown).


859

Figure 5 Role of SMRT and NCoR on transrepression in NIH-3T3 fibroblasts. (a) The effect of T3 on luciferase activity was determined in NIH-3T3 cells cotransfected with the cyclin D1 promoter construct pD269-luc, Ha-rasval12 and TRb1 mutants with altered corepressor binding. The levels of the transfected receptors and Ras determined by western blot are shown. In (b) the reporter plasmid was transfected with the oncogene and the wild-type receptor alone or in combination with expression vectors for the corepressors SMRT and NCoR. Corepressor levels determined by western blot (in duplicate) in cells transfected with an empty vector or the corepressors, as well as Ras levels in cells transfected with the corepressors are also represented.

Functional role of SMRT and NCoR on the antagonism of Ras-induced transformation by TRb1 As increased corepressor levels enhance T3-dependent transrepression of the cyclin D1 promoter, the influence of SMRT and NCoR over-expression on NIH-3T3 transformation was also examined. The anti-transforming effects of T3 became more notorious after cotransfection of TRb1 with expression vectors for SMRT (Figure 7a) or NCoR (Figure 7b), suggesting again that these corepressors participate in the inhibition of the responses to Ha-rasval12. Next, short-interfering RNA (siRNA) was used to directly address whether endogenous SMRT and NCoR have a functional role in the antitransforming ability of TRb1. For this purpose, NIH-

3T3 cells were cotransfected with Ha-rasval12, TRb1 and control, SMRT or NCoR siRNAs. Corepressor protein and mRNA levels were reduced by the corresponding siRNAs (Figures 8a and b, respectively), without altering TRb1 levels (Figure 8a), and transformation by Ha-rasval12 was enhanced in NCoR- and SMRTdepleted cells, in comparison with that found with the cells transfected with the control siRNA, the increase in transformation being stronger in NCoR-depleted cells (Figure 8c). In addition, siRNAs for NCoR, and to a lesser extent SMRT, alleviated T3-dependent inhibition of foci formation, showing that these coregulators are essential for inhibition of cellular transformation by this hormone. Oncogene


860

Figure 7 Effect of SMRT and NCoR over-expression on Ha-rasval12-induced fibroblast transformation. Foci formation by untreated and T3-treated NIH-3T3 cells transfected with Ha-rasval12 plus TRb1 in combination with SMRT (a) or NCoR (b).

or the E457 mutant, whereas tumor development was not inhibited by the AHT mutant (Figure 9b). These results show the importance of corepressors and the dispensability of coactivators recruitment not only for the anti-transforming effects of the receptor, but also to inhibit tumor formation in mice. Discussion

Figure 6 TRb1 domains involved in repression of Ha-rasval12induced transformation of NIH-3T3 fibroblasts. (a) Representative foci formation in fibroblasts transfected with Ha-rasval12 and TRb1. After transfection, cells were grown in hormone-depleted medium in the presence and absence of T3 during 14 days. (b) NIH-3T3 cells were transfected with Ha-rasval12 alone or in combination with TRb1 hinge mutants or LBD mutants (c). The cells were grown for the same time period, and the number of foci was scored in the different groups in control and T3-treated cultures. Data are expressed as the percent of the foci number obtained in cells transfected with Ha-rasval12 alone.

The AHT corepressor mutant fails to impair tumor growth in nude mice To analyze the TRb1 domains responsible for the repression of tumor formation by Ras, NIH-3T3 cells expressing Ha-rasval12 (Garcia-Silva and Aranda, 2004) were transfected in a stable manner with wild-type TRb1 or with the AHT and E457Q mutants. These fibroblasts, which express at similar levels the oncoprotein and the various receptors (Figure 9a), were injected into the flanks of immunodeficient mice, and tumor growth was followed for 30 days. Tumor formation was strongly repressed in mice injected with fibroblasts coexpressing Ha-rasval12 in combination with either the native receptor Oncogene

We have previously shown that TRb1 is a strong suppressor of the actions of the ras oncogene and that repression of cyclin D1 expression by T3 appears to be an important component of the mechanism by which the hormone blocks Ras-dependent actions (Garcia-Silva and Aranda, 2004). In this work, we show that induction of cyclin D1 by Ras in hepatocarcinoma cells is dependent on the integrity of CRE and Sp1 motifs located at the proximal promoter and is antagonized by T3 in TRb1-expressing cells. The CRE binds factors of the CREB/ATF family, and the receptor does not alter the abundance of the factors that bind this motif, but attenuates their transcriptional activity (Garcia-Silva and Aranda, 2004). In agreement with this, we now show that ATF-2 transcriptional activity is markedly enhanced upon expression of Ha-rasval12 and is repressed by T3 in hepatocarcinoma cells. TRs can antagonize CREmediated transcription without binding to this motif by a direct interaction of the receptor with the b-Zip factor CREB (Mendez-Pertuz et al., 2003) and we now observe that the receptors can also interact with ATF-2. Whereas the liganded TRb1 represses cyclin D1 expression, it has been reported that repression via the CRE is lost in the TRb1 mutant PV (Furumoto et al., 2005). The PV mutation was identified in a patient with thyroid hormone resistance syndrome and is tumorigenic in mice (Suzuki et al., 2002). It has been postulated that the lack of T3-dependent cyclin D1 repression by the PV mutant results in constitutive activation of cyclin D1 contributing to its tumorigenic effects (Furumoto et al., 2005).


861

Figure 8 Role of endogenous corepressors in repression of Harasval12-induced transformation by TRb1. (a) SMRT and NCoR levels were analyzed by western blot in NIH-3T3 cells 5 days after transfection with control, SMRT or NCoR siRNAs. TRb1 levels were also determined and extracellular signal-regulated kinase 2 (ERK2) levels were used as a loading control. (b) SMRT and NCoR mRNA levels measured by real-time PCR 2 and 5 days after transfection with the same siRNAs. Data are expressed as percent of the values obtained in cells transfected with the siControl. (c) Effect of SMRT (left) and NCoR (right) knock-down on foci formation assays by NIH-3T3 cells transfected with Ha-rasval12 and TRb1 16 days after incubation in the presence and absence of T3.

We have previously reported that repression of cyclin D1 expression appears to have a function in the antitransforming effect of TR in NIH-3T3 fibroblasts (Garcia-Silva and Aranda, 2004). Our present data show that whereas the PV mutant that has lost T3 binding was unable to repress transformation in response to the hormone, the LBD mutants K288I and E457Q preserved T3-dependent anti-transforming capacity, as well as their ability to repress cyclin D1

activation by Ras. These results indicate the dispensability of the charge clamp between H3 and H12 for inhibition of Ras responses, although the clamp is crucial for coactivators recruitment and ligand-dependent transactivation, and predict that these mutations would not be tumorigenic in mice or when present in patients. Indeed, the E457Q mutant was able to antagonize tumor formation by Ras-transformed fibroblasts in mice as strongly as the native receptor. Furthermore, the finding that the interaction of TRb1 with classical coactivators appears to be dispensable to an important extent for the antagonism of Ras-mediated responses by TRb1 supports a model wherein receptormediated antagonism is not intrinsically linked to activation and that both can be separated mechanistically. However, at present we cannot dismiss the possibility that TRb1 could use a different activation domain and/or non-classical coactivators to drive expression of factors that could affect cyclin D1 expression or tumorigenesis. Our results show an important role for the hinge domain on TRb1 antagonism of Ras-induced transcription, transformation and tumorigenesis. Mutation AHT in the CoR box abolished these receptor actions, suggesting that corepressors could be involved. However, in addition to been required for corepressor binding, the CoR box has also a central function in stabilizing the global structure of the LBD (Pissios et al., 2000) and, therefore, the effects of AHT mutation cannot be unambiguously attributed to deficient corepressors recruitment. Therefore, we tested the effect of P214R mutation that abolishes corepressor binding (Tagami et al., 1997) without affecting overall receptor structure or stability (Pissios et al., 2000). This mutation is homologous to that present in a v-erbA transformation-deficient mutant (td359) that lacks silencing activity (Damm et al., 1987). The results obtained with this mutant again favored the hypothesis that binding of corepressors to TRb1 is a requisite for the antitransforming effects of the receptor and for its ability to antagonize Ras-mediated transcription in a T3dependent manner. The finding that both corepressor mutants were still able to mediate TRE-dependent transcription again showed that Ras antagonism could be mechanistically separated from classical liganddependent transactivation. Contrary to AHT and P214R mutants, the R243W mutant was able to antagonize Ras-mediated responses. Therefore, in contrast with the prominent role of corepressor binding to the unliganded receptor, T3-dependent release does not appear to be required to inhibit transformation or to antagonize stimulation of cyclin D1 promoter activity by Ras. It is still unclear how corepressors that are released in response to hormone might be required for T3dependent Ras antagonism. Furthermore, the effect of the receptor mutants on transformation parallel those on cyclin D1 expression, as the coactivator mutants and the R243 mutant were still able to reduce as strongly as the native receptor cyclin D1 promoter activity and the levels of cyclin D1 protein in cells, while the AHT corepressor mutant was ineffective. On the other hand, Oncogene


862

Figure 9 Tumor formation in nude mice. (a) The levels of TRb and Ras were determined by western blot in NIH-3T3 cells transfected in a stable manner with Ha-rasval12 alone or in combination with wild-type TRb1 or the E457 and AHT mutants. (b) The stable transfectants were inoculated into the flanks of immunodeficient mice and the appearance of tumors was scored during 30 days after injection. The Kaplan–Meir plot of tumor appearance is shown.

the oncogenic TR mutants such as v-erbA or PV that act as dominant negatives blocking the anti-proliferative effects of the wild-type receptors do not suppress Ras function, although they bind corepressors constitutively, indicating that ligand binding is also required for this receptor action. A functional role for corepressors on inhibition of cyclin D1 induction by Ras was also suggested by experiments in which SMRT and NCoR were overexpressed. There is evidence that corepressors could be involved in T3-dependent negative regulation of gene expression through negative TREs and that coactivators and corepressors could have a reversed role in this context, as corepressors can activate rather than suppress basal transcription of genes that are negatively regulated by T3 (Tagami et al., 1997; Berghagen et al., 2002). In addition, it has been recently shown that NCoR and SMRT are required for full estrogen receptor transcriptional activity (Peterson et al., 2007), indicating the complexity of the role of coregulators on nuclear receptor action. It is then conceivable that NCoR and SMRT could function as TR coactivators in the setting of Ras-transformed cells. Interestingly, we found that coexpression of corepressors with TRb1 enhanced T3 antagonism of cylin D1 activation by ras. This was particularly relevant in the case of NCoR, as T3 was able to repress induction of promoter activity by the oncogene even in the absence of exogenously transfected receptor. Corepressors also augmented the inhibitory effect of T3 on transformation foci by Ras, reinforcing the hypothesis that they are involved in the antagonism. The relevant role of endogenous SMRT and NCoR on the anti-transforming effects of TRb1 was shown with siRNA experiments that revealed that corepressor down-regulation counteracted to a significant extent the inhibitory effect of T3 on cellular transformation. Furthermore, NCoR knock-down increased foci formation by Ras in the absence of transfected receptor, indicating that corepressors act to inhibit fibroblast transformation. These results agree with the increasing evidence that NCoR and SMRT influence cellular transformation and tumorigenesis. For instance, corepressor levels influence breast cancer progression Oncogene

(Peterson et al., 2007) and acquisition of tamoxifen resistance (Lavinsky et al., 1998), the aberrant recruitment of SMRT by the oncoprotein PML-RAR is a landmark in myeloid leukemias (Hong et al., 2001), down-regulation of SMRT can induce transformation of immortalized lymphoma cell lines (Song et al., 2005) and aberrant cytoplasmic distribution of NCoR and SMRT is a general trait of colorectal tumors (FernandezMajada et al., 2007). Moreover, in a recent study (Furuya et al., 2009), it has been shown that NCoR is a regulator of activation of PI3K signaling by the PV mutant TRb1 that causes development of metastastic thyroid carcinoma in mice (Suzuki et al., 2002), and that the corepressor could be considered as a novel tumor suppressor in this model of thyroid cancer. Therefore, our results show that the molecular mechanisms and receptor domains governing the antitransforming activity of TRb1 are clearly distinct from those leading to classical transcriptional activation that imply binding to the TRE and coactivators recruitment by the AF-2 domain. Thus, residues within the hinge domain and the corepressors SMRT and NCoR are essential to inhibit transformation, whereas p160 coactivators are dispensable. Our data demonstrating that a corepressor mutant, but not a coactivator mutant, fails to inhibit tumor formation by oncogenic Ras in nude mice further stresses this point. On the other hand, the strict parallelism found between the anti-transforming activity of TRb1 mutants and the antagonism of cyclin D1 transcription indicates that transrepression mechanisms are essential for inhibition of transformation by the receptor. This suggests that it would be possible to develop ligands that can separate TRb1 functionalities and that could have anti-transforming capacity without stimulating transcription.

Materials and methods Transfections For transfections, HepG2 and NIH-3T3 cells were transferred to medium containing 10% serum depleted of thyroid hormones by treatment with resin AG-1-X8 (Bio-Rad, Prat de Llobregat, Spain). Cells were transfected with the plasmids


863 indicated in the Supplementary Information by incubation with a mixture of cationic liposomes in 35 mm wells for 6 h and were then treated for 36 h in the presence and absence of 5 nM T3 in medium containing 0.1% of T3-depleted serum. Luciferase activity was determined in 10 mg of cell protein and transfection efficiency was determined by cotransfection with a renilla vector (50 ng). Gel retardation assays An oligonucleotide corresponding to a consensus TRE (50 AGCTCAGGTCACAGGAGGTCAG-30 ) or the cyclin D1 CRE (50 - AGCTTAACAACAGTAACGTCACACGGACTA CA-30 ) was used in the assays. Wild-type and mutant TRs as well as retinoid X receptor (cloned in pSG5) were used for in vitro transcription and translation with TNT Quick (Promega, Alcobendas, Spain). Assays were performed with cell extracts (10 mg) or with in vitro translated receptors (1.5 ml of each receptor subunit in the presence and absence of 1 mM T3). Assays were performed as previously described (Castillo et al., 2004). GST pull-down assays Protein–protein interactions were performed with 5 ml of in vitro translated wild-type or mutant 35S-TRb1 and with the fusion proteins GST-SMRT, GST-NCoR, GST-ACTR, GST-ATF-2 (kindly provided by Pedro Lazo) or with GST as a control (Castillo et al., 2004; Sanchez-Martinez et al., 2006). Fifteen minutes before and during the binding reaction, 35 S-TRb1 mutants were incubated in the absence or presence of 1 mM T3. The bound proteins were analyzed by SDS–PAGE in a 10% polyacrylamide gel and identified by autoradiography. Western blot analysis Whole extracts from cells transiently transfected with expression vectors for TRb1 and/or Ha-ras Val12 (50 ng) were treated with 5 nM T3 for 36–48 h and used for immunodetection of cyclin D1, with antibody sc-718 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a 1:2000 dilution as described (Garcia-Silva and Aranda, 2004). Transfected Ha-rasVal12 was detected with antibody sc-520 and NCoR and SMRT levels with antibodies 32582 (Upstate, Lake Placid, NY, USA) and PAI-842 (Affinity BioReagents, Rockford, IL, USA), respectively. b-actin (SC-1615) or total extracellular signal-regulated kinase 2 (SC-154) were used as loading controls. Foci formation assays NIH3T3 fibroblasts were plated in 90 mm dishes and transfected with calcium phosphate with 100 ng of Ha-rasVal12 and 4 mg of expression vectors for wild-type or mutant TRb1 (Garcia-Silva and Aranda, 2004). In some experiments, cells were also transfected with 4 mg of expression vectors for SMRT and NCoR. Empty vectors were used to equal the amount of plasmid. Cultures were fed with thyroid hormonedepleted medium in the presence and absence of 5 or 0.2 nM

T3. For siRNA experiments, the cells were transfected with 400 ng of Ha-rasVal12, 0.5 mg of TRb1 and 33 nM siRNAs using lipofectamine2000 (Invitrogen, Prat de Llobregat, Spain). siRNAs for NCoR (M-058556), SMRT (M-045364) and Non-target control (M-001210) were from Dharmacon (Lafayette, CO, USA). At 14–16 days after transfection, foci were stained with Giemsa and counted. Data are expressed as the percentage of the foci obtained in Ha-rasVal12 transfected cells that normally ranged between 75 and 120. Real-time PCR Total RNA was extracted 2 and 5 days after transfection with siRNAs using Tri Reagent (Sigma, St Louis, MO, USA), and mRNA levels were analyzed by quantitative reverse transcription–PCR. RT was performed with 2 mg of RNA following specifications of SuperScript First-Strand Synthesis System (Invitrogen Life Technologies, Carlsbad, CA, USA). PCRs reactions were performed in an Mx3005P thermocycler (Stratagene, Madrid, Spain) and detected with Sybr Green using the following primers: 50 -GCTGCAGGAGAGGTT TATCG-30 (forward) and 50 -CCTGCATCTGCTGTGAGG TA-30 (reverse) for NCoR, and 50 -TGTCACCTCAGCCAG CATAG-30 (forward) and 5-CGCCGTAAGTAGTCCTCC TG-3 (reverse) for SMRT. Values obtained were corrected by L19 expression and results were analyzed by the CT comparative method (DDCT). Tumorigenesis in nude mice NIH-3T3 fibroblasts expressing Ha-Rasval12 (Garcia-Silva and Aranda, 2004) were transfected with 1 mg of empty vector, pLPCX-TRb1 or the AHT and E457Q mutants and selected with puromycin. Pools of resistant cells were used in all cases. For tumor formation in mice (athymic nude), 106 cells were injected subcutaneously into each flank of five mice. Tumor appearance was followed for 30 days. Experiments were performed in compliance with European Community law 86/609/EEC and were approved by the Consejo Superior de Investigaciones Cientı´ ficas committee.

Conflict of interest The authors declare no conflict of interest.

Acknowledgements We are grateful to M Sańchez-Prieto and PA Cha´vez for technical help and to A Zambrano for TR mutants. This work was supported by Grant BFU2007–62402 from Ministerio de Educacioń y Ciencia, RD06/0020/0036 and Accioń Transversal de Cańcer from the Fondo de Investigaciones Sanitarias and by the European Grant CRESCENDO (FP-018652).

References Anjum R, Blenis J. (2008). The RSK family of kinases: emerging roles in cellular signalling. Nat Rev Mol Cell Biol 9: 747–758. Aranda A, Pascual A. (2001). Nuclear hormone receptors and gene expression. Physiol Rev 81: 1269–1304. Aranda A, Martı´ nez-Iglesias O, Ruiz-Llorente L, Garcı´ a-Carpizo V, Zambrano A. (2009). Thyroid receptor: roles in cancer. Trends Endocrinol Metab 20: 319–324.

Berghagen H, Ragnhildstveit E, Krogsrud K, Thuestad G, Apriletti J, Saatcioglu F. (2002). Corepressor SMRT functions as a coactivator for thyroid hormone receptor T3Ralpha from a negative hormone response element. J Biol Chem 277: 49517–49522. Bos JL. (1989). ras oncogenes in human cancer: a review. Cancer Res 49: 4682–4689. Oncogene


864 Campbell SL, Khosravi-Far, Rossman KL, Clark GJ, Der CJ. (1998). Increasing complexity of Ras signaling. Oncogene 17: 1395–1413. Castillo AI, Sanchez-Martinez R, Moreno JL, Martinez-Iglesias OA, Palacios D, Aranda A. (2004). A permissive retinoid X receptor/ thyroid hormone receptor heterodimer allows stimulation of prolactin gene transcription by thyroid hormone and 9-cis-retinoic acid. Mol Cell Biol 24: 502–513. Chan IH, Privalsky ML. 2006. Thyroid hormone receptors mutated in liver cancer function as distorted antimorphs. Oncogene 25: 3576–3588. Damm K, Beug H, Graf T, Vennstro¨m B. (1987). A single point mutation in erbA restores the erythroid transforming potency of a mutant avian erythroblastosis virus (AEV) defective in both erbA and erbB oncogenes. EMBO J 6: 675–682. De Bosscher K, Van Craenenbroeck K, Meijer OC, Haegeman G. (2008). Selective transrepression versus transactivation mechanisms by glucocorticoid receptor modulators in stress and immune systems. Eur J Pharmacol 583: 290–302. Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ et al. (1998). Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 280: 1747–1749. Fernandez-Majada V, Pujadas J, Vilardell F, Capella G, Mayo MW, Bigas A et al. (2007). Aberrant cytoplasmic localization of N-CoR in colorectal tumors. Cell Cycle 6: 1748–1752. Filmus J, Robles AI, Shi W, Wong MJ, Colombo LL, Conti CJ. (1994). Induction of cyclin D1 overexpression by activated ras. Oncogene 9: 3627–3633. Flamant F, Baxter JD, Forrest D, Refetoff S, Samuels H, Scanlan TS et al. (2006). International Union of Pharmacology. LIX. The pharmacology and classification of the nuclear receptor superfamily: thyroid hormone receptors. Pharmacol Rev 58: 705–711. Furumoto H, Ying H, Chandramouli GV, Zhao L, Walker RL, Meltzer PS et al. (2005). An unliganded thyroid hormone beta receptor activates the cyclin D1/cyclin-dependent kinase/retinoblastoma/E2F pathway and induces pituitary tumorigenesis. Mol Cell Biol 25: 124–135. Furuya F, Lu C, Guigon CJ, Cheng SY. (2009). Nongenomic activation of phosphatidylinositol 3-kinase signaling by thyroid hormone receptors. Steroids 74: 628–634. Garcia-Silva S, Aranda A. (2004). The thyroid hormone receptor is a suppressor of ras-mediated transcription, proliferation, and transformation. Mol Cell Biol 24: 7514–7523. Hong SH, Yang Z, Privalsky ML. (2001). Arsenic trioxide is a potent inhibitor of the interaction of SMRT corepressor with its transcription factor partners, including the PML-retinoic acid receptor alpha oncoprotein found in human acute promyelocytic leukemia. Mol Cell Biol 21: 7172–7182. Ho¨rlein AJ, Naä¨r AM, Heinzel T, Torchia J, Gloss B, Kurokawa R et al. (1995). Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377: 397–404. Ito Y, Sasaki Y, Horimoto M, Wada S, Tanaka Y, Kasahara A et al. (1998). Activation of mitogen-activated protein kinases/extracellular signal-regulated kinases in human hepatocellular carcinoma. Hepatology 27: 951–958. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TMG, Schiff R et al. (1998). Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95: 2920–2925. Lazar MA. (2003). Nuclear receptor corepressors. Nucl Recept Signal 1: e001. Liu JJ, Chao JR, Jiang MC, Ng SY, Yen JJ, Yang-Yen HF. (1995). Ras transformation results in an elevated level of cyclin D1 and acceleration of G1 progression in NIH 3T3 cells. Mol Cell Biol 15: 3654–3663. Lowy DR, Willumsen BM. (1993). Function and regulation of ras. Annu Rev Biochem 62: 851–891. Marimuthu A, Feng W, Tagami T, Nguyen H, Jameson JL, Fletterick RJ et al. (2002). TR surfaces and conformations required to bind nuclear receptor corepressor. Mol Endocrinol 16: 271–286.

Martı´ nez-Iglesias O, Garcı´ a-Silva S, Tenbaun SP, Regadera J, Larcher F, Paramio JM et al. (2009a). The thyroid hormone receptor beta1 acts as a potent suppressor of tumor invasiveness and metastasis. Cancer Res 69: 501–509. Martı´ nez-Iglesias O, Garcı´ a-Silva S, Regadera J, Aranda A. (2009b). Hypothyroidism enhances tumor invasiveness and metastasis development. PLoS One 4: e6428. Meier CA, Dickstein BM, Ashizawa K, McClaskey JH, Muchmore P, Ransom SC et al. (1992). Variable transcriptional activity and ligand binding of mutant beta 1 3,5,3’-triiodothyronine receptors from four families with generalized resistance to thyroid hormone. Mol Endocrinol 6: 248–258. Mendez-Pertuz M, Sanchez-Pacheco A, Aranda A. (2003). The thyroid hormone receptor antagonizes CREB-mediated transcription. EMBO J 22: 3102–3112. Pascual G, Glass CK. (2006). Nuclear receptors versus inflammation: mechanisms of transrepression. Trends Endocrinol Metab 17: 321–327. Perissi V, Staszewski LM, McInerney EM, Kurokawa R, Krones A, Rose DW et al. (1999). Molecular determinants of nuclear receptorcorepressor interaction. Genes Dev 13: 3198–3208. Peterson TJ, Karmakar S, Pace MC, Gao T, Smith CL. (2007). The silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) corepressor is required for full estrogen receptor alpha transcriptional activity. Mol Cell Biol 27: 5933–5948. Pfahl M. (1993). Nuclear receptor/AP-1 interaction. Endocr Rev 14: 651–658. Pissios P, Tzameli I, Kushner P, Moore DD. (2000). Dynamic stabilization of nuclear receptor ligand binding domains by hormone or corepressor binding. Mol Cell 6: 245–253. Privalsky ML. (2004). The role of corepressors in transcriptional regulation by nuclear hormone receptors. Annu Rev Physiol 66: 315–360. Robles AI, Rodriguez-Puebla ML, Glick AB, Trempus C, Hansen L, Sicinski P et al. (1998). Reduced skin tumor development in cyclin D1-deficient mice highlights the oncogenic ras pathway in vivo. Genes Dev 12: 2469–2474. Rogatsky I, Zarember KA, Yamamoto KR. (2001). Factor recruitment and TIF2/GRIP1 corepressor activity at a collagenase-3 response element that mediates regulation by phorbol esters and hormones. EMBO J 20: 6071–6083. Safer JD, Cohen RN, Hollenberg AN, Wondisford FE. (1998). Defective release of corepressor by hinge mutants of the thyroid hormone receptor found in patients with resistance to thyroid hormone. J Biol Chem 273: 30175–30182. Sanchez-Martinez R, Castillo AI, Steinmeyer A, Aranda A. (2006). The retinoid X receptor ligand restores defective signalling by the vitamin D receptor. EMBO Rep 10: 1030–1034. Song L, Zlobin A, Ghoshal P, Zhang Q, Houde C, Weijzen S et al. (2005). Alteration of SMRT tumor suppressor function in transformed non-Hodgkin lymphomas. Cancer Res 65: 4554–4561. Suzuki H, Willingham MC, Cheng SY. (2002). Mice with a mutation in the thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse model of thyroid carcinogenesis. Thyroid 12: 963–969. Tagami T, Madison LD, Nagaya T, Jameson JL. (1997). Nuclear receptor corepressors activate rather than suppress basal transcription of genes that are negatively regulated by thyroid hormone. Mol Cell Biol 17: 2642–2648. Xing J, Ginty DD, Greenberg ME. (1996). Coupling of the RASMAPK pathway to gene activation by RSK2, a growth factorregulated CREB kinase. Science 273: 959–963. Yen PM. (2001). Physiological and molecular basis of thyroid hormone action. Physiol Rev 81: 1097–1142. Zhu XG, Zhao L, Willingham MC, Cheng SY. (2010). Thyroid hormone receptors are tumor suppressors in a mouse model of metastatic follicular thyroid carcinoma. Oncogene 29: 1909–1919.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc) Oncogene